ID: 946193420

View in Genome Browser
Species Human (GRCh38)
Location 2:218019674-218019696
Sequence TTCTGTTGATGAAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946193411_946193420 14 Left 946193411 2:218019637-218019659 CCTTTCGCCTCAGAGCAGGGAGG No data
Right 946193420 2:218019674-218019696 TTCTGTTGATGAAAGGAAGAAGG No data
946193418_946193420 -10 Left 946193418 2:218019661-218019683 CCTGGGGAGAGATTTCTGTTGAT No data
Right 946193420 2:218019674-218019696 TTCTGTTGATGAAAGGAAGAAGG No data
946193410_946193420 15 Left 946193410 2:218019636-218019658 CCCTTTCGCCTCAGAGCAGGGAG No data
Right 946193420 2:218019674-218019696 TTCTGTTGATGAAAGGAAGAAGG No data
946193417_946193420 -9 Left 946193417 2:218019660-218019682 CCCTGGGGAGAGATTTCTGTTGA No data
Right 946193420 2:218019674-218019696 TTCTGTTGATGAAAGGAAGAAGG No data
946193414_946193420 7 Left 946193414 2:218019644-218019666 CCTCAGAGCAGGGAGGCCCTGGG No data
Right 946193420 2:218019674-218019696 TTCTGTTGATGAAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946193420 Original CRISPR TTCTGTTGATGAAAGGAAGA AGG Intergenic
No off target data available for this crispr