ID: 946193738

View in Genome Browser
Species Human (GRCh38)
Location 2:218021392-218021414
Sequence TGCCTAATAGCACCCCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946193734_946193738 -3 Left 946193734 2:218021372-218021394 CCCATGGACCCAGCAGAGATTGC No data
Right 946193738 2:218021392-218021414 TGCCTAATAGCACCCCCAAGAGG No data
946193732_946193738 13 Left 946193732 2:218021356-218021378 CCTCTGAACTCTGTCACCCATGG No data
Right 946193738 2:218021392-218021414 TGCCTAATAGCACCCCCAAGAGG No data
946193735_946193738 -4 Left 946193735 2:218021373-218021395 CCATGGACCCAGCAGAGATTGCC No data
Right 946193738 2:218021392-218021414 TGCCTAATAGCACCCCCAAGAGG No data
946193731_946193738 14 Left 946193731 2:218021355-218021377 CCCTCTGAACTCTGTCACCCATG No data
Right 946193738 2:218021392-218021414 TGCCTAATAGCACCCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946193738 Original CRISPR TGCCTAATAGCACCCCCAAG AGG Intergenic
No off target data available for this crispr