ID: 946196167

View in Genome Browser
Species Human (GRCh38)
Location 2:218034030-218034052
Sequence CTGTCGCAAGGGCTGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 365}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946196167_946196178 8 Left 946196167 2:218034030-218034052 CCCGCCCCCAGCCCTTGCGACAG 0: 1
1: 1
2: 2
3: 32
4: 365
Right 946196178 2:218034061-218034083 AGAGCGCCTGCGACATTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 36
946196167_946196175 4 Left 946196167 2:218034030-218034052 CCCGCCCCCAGCCCTTGCGACAG 0: 1
1: 1
2: 2
3: 32
4: 365
Right 946196175 2:218034057-218034079 GCCCAGAGCGCCTGCGACATTGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946196167 Original CRISPR CTGTCGCAAGGGCTGGGGGC GGG (reversed) Intergenic
900390434 1:2431608-2431630 CTCTGGCAGGGCCTGGGGGCGGG + Intronic
900402393 1:2477916-2477938 CTGTGGCCAGGGGCGGGGGCAGG + Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900621731 1:3590671-3590693 ATTTCACAACGGCTGGGGGCTGG + Intronic
901219325 1:7574215-7574237 CTGAGCCAAGGGCTGGGAGCTGG + Intronic
901673792 1:10871107-10871129 CTGGGGAAATGGCTGGGGGCGGG + Intergenic
901794624 1:11673212-11673234 CTGGCCCCAGGGGTGGGGGCAGG - Intronic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902142644 1:14369717-14369739 CTGGCACAAGGGCTGTGGTCAGG - Intergenic
902688559 1:18095253-18095275 CTGACCCAGGGCCTGGGGGCTGG + Intergenic
903157851 1:21460371-21460393 CTGTCCCTGGGGTTGGGGGCTGG - Intronic
903664908 1:25000372-25000394 CTGTCGCCCAGGCTGGAGGCTGG + Intergenic
903781775 1:25824660-25824682 GTGTCGCAGGGGTAGGGGGCAGG + Intronic
904013876 1:27405914-27405936 TCGTGGAAAGGGCTGGGGGCAGG - Exonic
904082143 1:27879098-27879120 CTGGCGGAATGGGTGGGGGCTGG + Intronic
904410118 1:30320102-30320124 CTGTGCCAAGGCCTGGGAGCCGG - Intergenic
904613616 1:31738373-31738395 CAGTGGCCAGGACTGGGGGCAGG - Intronic
906211857 1:44016604-44016626 CAGTGGCAAGGGGTGGGGGAAGG - Intronic
906296257 1:44650815-44650837 CTGTCACAGAGGCTGGGGGCAGG - Exonic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
907945982 1:59137137-59137159 GTGGCTCAAGGGCTGGGGGCTGG + Intergenic
913219918 1:116651039-116651061 CTGTCTGAAGGGTTGTGGGCTGG - Intronic
913229968 1:116733650-116733672 ATGTGGCAAGAGCTGTGGGCTGG - Intergenic
915346764 1:155201463-155201485 ATGTGGCAGGGGCTGTGGGCTGG + Exonic
915513686 1:156400772-156400794 CTGTGGCAGCGGGTGGGGGCTGG + Intergenic
915899991 1:159840013-159840035 CACTCACAAGGGCTAGGGGCTGG + Intronic
916491868 1:165309214-165309236 GTGTGCCAAGGGCTGGGGGTGGG - Intronic
917301780 1:173582414-173582436 ATGTCTCCTGGGCTGGGGGCAGG - Intronic
917919956 1:179743233-179743255 AGGTGGCCAGGGCTGGGGGCAGG - Exonic
918133180 1:181646645-181646667 CTGTCTCTGGGGCTGGGGGCTGG + Intronic
919541053 1:198845882-198845904 CGGTCGCCGGGGCTGGGGGGAGG + Intergenic
919946745 1:202324940-202324962 CTTGTGCAAGGGCTGTGGGCAGG + Intergenic
920052887 1:203174188-203174210 CTTTCTCAAGGCGTGGGGGCTGG + Intronic
921007690 1:211111417-211111439 CGGTGGCAAAGGGTGGGGGCCGG - Intronic
922460629 1:225812081-225812103 CAGGTGCAAAGGCTGGGGGCAGG + Intronic
922555341 1:226528221-226528243 CTGTACCAAGGGATGGGGTCGGG + Intergenic
922801602 1:228367180-228367202 CCGTCTCAGGGGCTGAGGGCAGG - Intronic
923218892 1:231875275-231875297 CACTCACCAGGGCTGGGGGCTGG - Intronic
923291165 1:232547557-232547579 CTGTGGCCCGGGGTGGGGGCTGG + Intronic
923365219 1:233253365-233253387 CTGTTGCCAAGGCTGGAGGCTGG + Intronic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
924244763 1:242073379-242073401 CTGTAGCAAGGGCTGTGGACAGG - Intergenic
924667337 1:246086875-246086897 CTGTCGGAAGGGCGAGGGGAGGG - Intronic
1063209330 10:3864562-3864584 CTGTCTCAAGTTCTGGAGGCTGG - Intergenic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1064547917 10:16469223-16469245 CTGTCGCAAGGTCTCTGAGCAGG - Intronic
1065000608 10:21334631-21334653 GTGTCTCTGGGGCTGGGGGCTGG - Intergenic
1065634409 10:27715850-27715872 CTATGGGATGGGCTGGGGGCTGG + Intronic
1065727927 10:28684312-28684334 CTGTCGCCCGGGCTGGAGTCCGG + Intergenic
1067158498 10:43802644-43802666 CTGTGTCATGGGCTGGGGGTTGG - Intergenic
1067429613 10:46234422-46234444 CTGGCTCAAGGGGTGGGGCCAGG + Intergenic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070779570 10:79129772-79129794 CTCAGGCCAGGGCTGGGGGCAGG - Intronic
1072041502 10:91611225-91611247 AAGTGGCAAGGGCTGGGGCCTGG - Intergenic
1072717761 10:97762920-97762942 ATTTCGCTAGGGCTGGGGGTGGG - Intergenic
1073297557 10:102450427-102450449 CCGCCGCAAGGCCTAGGGGCGGG - Exonic
1073588659 10:104735176-104735198 CTGTCGGCTGGGCAGGGGGCCGG + Intronic
1074709946 10:116169022-116169044 CTGCAGCAAGGGCAGTGGGCTGG + Intronic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1074876251 10:117615777-117615799 CTGAGGCATGTGCTGGGGGCTGG - Intergenic
1074885558 10:117690256-117690278 CTGTTGGAAATGCTGGGGGCTGG + Intergenic
1075197690 10:120375270-120375292 ATGCCCCAGGGGCTGGGGGCAGG + Intergenic
1075630390 10:123997157-123997179 CAGAGGCCAGGGCTGGGGGCTGG + Intergenic
1076345107 10:129774319-129774341 CTCTTGCAAGAGCTGTGGGCTGG + Intergenic
1076536151 10:131179022-131179044 CTGTCAGAGGGGCTGGAGGCTGG - Intronic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1077870748 11:6259775-6259797 CAGGCGCCTGGGCTGGGGGCGGG + Exonic
1078447692 11:11416897-11416919 CAGGAGCAAGGGCTGGGGGAGGG - Intronic
1079185476 11:18232170-18232192 CTGTTGCAGGGGCTGGGTGCAGG - Intronic
1079228864 11:18632114-18632136 CTGTCGTCCGGGCTGGAGGCTGG - Intronic
1081031398 11:38088718-38088740 CTGTCGCAGAGGCTGGAGGCTGG - Intergenic
1081869128 11:46375383-46375405 ATGGCACCAGGGCTGGGGGCAGG - Intronic
1083339883 11:61952107-61952129 CTGAGGCTGGGGCTGGGGGCTGG + Intronic
1083511235 11:63211001-63211023 CTGTCCCAAGGGCTGAGGAGTGG + Intronic
1083616954 11:64031029-64031051 TTGTTTCAAGGCCTGGGGGCAGG + Intronic
1083893373 11:65607932-65607954 CTGTGCGAAGGGCTCGGGGCAGG + Exonic
1083898744 11:65633540-65633562 ATGTCACATGGGCAGGGGGCGGG - Intronic
1083957488 11:65993160-65993182 CTGTGGCCAGGGCCGGGGGGTGG - Intergenic
1083997262 11:66278549-66278571 CTGGGGCTGGGGCTGGGGGCGGG + Intronic
1084097508 11:66921414-66921436 CTGACGCAATGCCTGGGGTCTGG - Intronic
1084515648 11:69636938-69636960 GTGCCTTAAGGGCTGGGGGCAGG - Intergenic
1084546389 11:69817141-69817163 CTGTGGTGGGGGCTGGGGGCGGG + Intronic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1085530393 11:77189167-77189189 CTGAGCCAAGGGCTGGGGTCTGG - Intronic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1088392909 11:109334978-109335000 CTGTCGCCCAGGCTGGAGGCTGG - Intergenic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1090225658 11:125070772-125070794 CTGTCACGAGGGGTGGGGGATGG - Intronic
1090727911 11:129544177-129544199 ATGTGAGAAGGGCTGGGGGCAGG - Intergenic
1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG + Exonic
1091658934 12:2367119-2367141 CTGACTGAAGGGATGGGGGCAGG + Intronic
1092859272 12:12705978-12706000 CTGTGGCCAGGGGTGAGGGCTGG - Intergenic
1093490744 12:19701264-19701286 TTGTAGCAAGGGCAGGGTGCTGG - Intronic
1094495691 12:30987995-30988017 CTGGGGCAGAGGCTGGGGGCCGG + Intronic
1094546853 12:31412398-31412420 CTGTCGCAGGGGCTGGGGAGGGG + Intronic
1096271083 12:50167023-50167045 CTGTGGGAAGGGCCGAGGGCCGG - Intronic
1099165945 12:79307602-79307624 TGGTCGGAAGGGCTGGGGGTGGG + Intronic
1100089793 12:90955077-90955099 CTGAGGCACGGGCTGGGGCCGGG + Exonic
1102928936 12:116847995-116848017 CTGTTGCGGGGGCTGGGGGAGGG - Intronic
1104631400 12:130405663-130405685 CAGCAGCAAGGGGTGGGGGCGGG + Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104963844 12:132500409-132500431 CTCAGGCAAGGGCTGGAGGCTGG + Intronic
1105773767 13:23637881-23637903 CTTTCACAGGGGCTGGAGGCCGG + Intronic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1106193933 13:27477165-27477187 CAGGAGCAAGGGCTTGGGGCAGG + Intergenic
1107988869 13:45799608-45799630 CTTTCCCAAGGCCTGGGGGTTGG + Intronic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1110439073 13:75507579-75507601 ATGTGGCAAGCGGTGGGGGCTGG + Intergenic
1113080056 13:106509984-106510006 CTGTCATAAGGGCTGGGTGGAGG - Intronic
1113543084 13:111123878-111123900 CAGCCGCAGGGGCAGGGGGCGGG - Intronic
1113964386 13:114144437-114144459 CTCTGTCAAGGGCTGGGGACAGG + Intergenic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118316159 14:64727507-64727529 CGGTTGCCAGGGGTGGGGGCAGG - Intronic
1119362614 14:74063827-74063849 CTGTCGCACAGGCTGGGGTGCGG - Intronic
1121245040 14:92456122-92456144 CTGTCACCAGGGCCGTGGGCTGG + Intronic
1122123930 14:99569123-99569145 CTGTGGCTAGGTCTGGGGACGGG - Intronic
1122542671 14:102506807-102506829 CTGTCGCATGCACTGGGGGCTGG - Exonic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1123038573 14:105481266-105481288 CTGTGCCAACGGCTGGGAGCAGG - Intergenic
1124692052 15:31831952-31831974 CTGGCGGAAGGGCTGGGGCAGGG + Intronic
1125604098 15:40930325-40930347 GTGTCCCAAGAGCTGGGGACGGG - Intronic
1126943629 15:53792821-53792843 CTGTCACCTGGGCTGGAGGCCGG - Intergenic
1128240143 15:66096110-66096132 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
1128392007 15:67188620-67188642 CTGCCGCAGGAGCTGGCGGCTGG - Intronic
1128467891 15:67928154-67928176 CTGCCGAGAGGGCTGGGGGTGGG + Intergenic
1129928410 15:79386113-79386135 ATTTTCCAAGGGCTGGGGGCTGG + Intronic
1130227907 15:82073624-82073646 CTGGTGCATGGCCTGGGGGCTGG + Intergenic
1131508973 15:93038602-93038624 CTGTCGCCCAGGCTGGAGGCTGG + Intronic
1132391230 15:101439538-101439560 CTGTGTCATGGGCTGAGGGCAGG - Intronic
1132409980 15:101569343-101569365 CTGTCACCTGGGCTGGGAGCGGG + Intergenic
1132747716 16:1443894-1443916 CAGGCTCAAGGGCTCGGGGCTGG + Exonic
1135516936 16:23143868-23143890 ATGTCCCAGGGGGTGGGGGCAGG + Intronic
1136368746 16:29822547-29822569 CTGTGGGAAGGTCTGGGGGCAGG + Intronic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1136460550 16:30407703-30407725 CTGGGGCACGGGCTGGAGGCGGG - Intronic
1137300559 16:47144104-47144126 CTGCCGTTAGGGCTGGGAGCCGG + Intergenic
1138597860 16:58038662-58038684 CTGCAGCAAGGGATGGGGGATGG + Intronic
1138813893 16:60182392-60182414 CTAGCACAAGGGCTGGGGGTGGG - Intergenic
1139490297 16:67282362-67282384 CTGGGGCAAGATCTGGGGGCCGG - Intronic
1139758999 16:69169270-69169292 CAGTTCCATGGGCTGGGGGCTGG - Intronic
1141983149 16:87562225-87562247 CTGTGGCACGGCCTGGGTGCAGG + Intergenic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142266885 16:89068047-89068069 CTCTCCCCAGGGCTGGAGGCTGG + Intergenic
1142403516 16:89873519-89873541 TTGGCGCGAGGGGTGGGGGCAGG - Intergenic
1142476165 17:191609-191631 CTGTCGCAGGGGCGGGGGAACGG - Intergenic
1142487878 17:258582-258604 CTGAGGCACGGGCCGGGGGCTGG - Intronic
1142539515 17:647208-647230 CTGAAGCAGGGGCTGAGGGCAGG - Intronic
1142613843 17:1123981-1124003 CTGTGGGAAGGGCTGGCGGGGGG - Intronic
1142744233 17:1947751-1947773 GTCTCGCATGGGGTGGGGGCTGG + Intronic
1143030310 17:3963985-3964007 CCGGCGCCGGGGCTGGGGGCTGG - Intronic
1143697490 17:8630942-8630964 CTGTGGCCTGGGCTGGGAGCGGG - Intergenic
1143771330 17:9170843-9170865 GTGTCACAAGAGCTTGGGGCAGG - Intronic
1143993718 17:10988924-10988946 CTTTAGAAAGTGCTGGGGGCAGG + Intergenic
1144549122 17:16224183-16224205 CTGTCGCAAGAGCAAGAGGCTGG - Intronic
1145005414 17:19334620-19334642 GTGTCCCTAGGGCTGGGGGGTGG - Exonic
1145736962 17:27239906-27239928 CTGAAGGAAGGGCAGGGGGCGGG - Intergenic
1145776470 17:27532445-27532467 CAGTCTCAAGTGCTGCGGGCTGG - Intronic
1146065498 17:29631773-29631795 CTGTCTCCAGGGCTGTGGACAGG + Exonic
1146656716 17:34638896-34638918 CTGCCCCAAGGGCTTTGGGCAGG + Exonic
1146710717 17:35039194-35039216 CTGTCATATGGGCTGGGTGCAGG - Intronic
1147187236 17:38719601-38719623 CTGGAGGAGGGGCTGGGGGCAGG + Intronic
1147213563 17:38886272-38886294 GTCTCGCCAGGGCTGGGGGCTGG + Intronic
1147995257 17:44356563-44356585 CTGCACCAAGGGCTGGGAGCGGG + Exonic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1149643571 17:58221471-58221493 CTGTCGCAAAGTCTGGGGCAGGG - Intronic
1150066685 17:62115929-62115951 CTGTCGCCCAGGCTGGAGGCTGG - Intergenic
1150143319 17:62748365-62748387 CTGTCGCCCGGCCTGGAGGCTGG - Intronic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1150620467 17:66804065-66804087 CTGCGGGGAGGGCTGGGGGCTGG - Exonic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152528367 17:80902574-80902596 CAGACGCATGGGCTGGGGGCCGG - Intronic
1152742218 17:82023336-82023358 CTGTCGCGAGGGCGGGGGTCGGG + Exonic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1153981532 18:10314756-10314778 CTGTCGCCAGGACTGGAGGAAGG + Intergenic
1155101209 18:22611936-22611958 CTGTCGCCCAGGCTGGAGGCTGG - Intergenic
1155279173 18:24220519-24220541 TTGTGGTGAGGGCTGGGGGCTGG - Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1158140119 18:54246680-54246702 CTGTCGCCCAGGCTGGAGGCTGG - Intergenic
1158435148 18:57430270-57430292 CGGTCCCCAGGACTGGGGGCTGG - Intergenic
1160923000 19:1529352-1529374 CTGTCCCTGGGGCTGGGGCCGGG + Intronic
1161124960 19:2550705-2550727 ATGTGGCAAGGCCCGGGGGCTGG - Intronic
1161153099 19:2719871-2719893 CAGTCACAAGGGCTTGGGGCCGG + Intronic
1161313270 19:3606631-3606653 GTGGGGCGAGGGCTGGGGGCGGG + Exonic
1161753428 19:6114129-6114151 CTCTGGCCAGGGCTGGGAGCGGG - Intronic
1161773837 19:6246609-6246631 CGGTTGTAAGGGCTGGGGGTGGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162531118 19:11237005-11237027 CTGGGACCAGGGCTGGGGGCAGG - Intronic
1162736519 19:12750048-12750070 TTCCCGCAGGGGCTGGGGGCAGG - Intergenic
1163517794 19:17775354-17775376 CTGAGTCAAGGCCTGGGGGCAGG + Intronic
1163823104 19:19507567-19507589 CTGGAGCTGGGGCTGGGGGCCGG - Exonic
1163845023 19:19633868-19633890 CTGAGGCTAGGACTGGGGGCTGG + Exonic
1165329888 19:35135486-35135508 CTGTAGCCAGGGGAGGGGGCTGG - Intronic
1165446813 19:35861113-35861135 CTGTCGCAGGTGCTGGGCTCTGG + Exonic
1165533820 19:36426388-36426410 TTGTCGCCCGGGCTGGGGTCTGG + Intergenic
1166717199 19:44976203-44976225 TCGTGGCAAGGCCTGGGGGCTGG - Intronic
1166975625 19:46603472-46603494 CTCTGGCATTGGCTGGGGGCTGG + Intronic
1168240993 19:55088821-55088843 CTGCCCCAAGGGCGGGGGGCGGG - Intergenic
1168330090 19:55563147-55563169 CTGACTGAAGGGCTGGGAGCGGG + Intergenic
925007840 2:458608-458630 CTCTCCCAGGGGCTGGGGGGAGG + Intergenic
928024488 2:27728644-27728666 GGGTAGCAAGGGCTGGGGCCAGG - Intergenic
929314995 2:40466217-40466239 CTGTGGCAAGGGCAGGGGTTGGG + Intronic
932144366 2:69305541-69305563 CTGCAGCAAGGGGTGGGGGGGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934140794 2:89045441-89045463 CTGTAGTAAGGGTTGGGAGCTGG - Intergenic
934228440 2:90155101-90155123 CTGTAGTAAGGGTTGGGAGCTGG + Intergenic
935080409 2:99787516-99787538 CTGTGGCAAGGGCTGGGAGCTGG - Intronic
935208954 2:100922118-100922140 CTGTGGCTATGGCTGGGGGTGGG + Intronic
938070441 2:128305547-128305569 CTGTGGCAAGGGTTGGAGCCCGG + Intronic
940962033 2:159797209-159797231 CTGGGGCAAGGGGTGGGGGGGGG + Intronic
941168265 2:162106521-162106543 CTGTCACACAGGCTGGAGGCTGG + Intergenic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
946171322 2:217897697-217897719 CTGGCACAGGGGCTGGTGGCAGG + Intronic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
947732544 2:232439331-232439353 CTGAAGCCAGGGCAGGGGGCAGG + Intergenic
948509977 2:238457718-238457740 CTCTGGCAAGGGCTCTGGGCAGG - Intergenic
949055230 2:241924487-241924509 CTGTGGGAAGGGCTGGGGCCAGG + Intergenic
1169027214 20:2381197-2381219 CTGTCTCCTGGGCTGGGGCCAGG + Intronic
1170155025 20:13261619-13261641 CTGTGGAAAGGACTGGGGCCAGG - Intronic
1170433023 20:16294592-16294614 CAGTCCCAAAGGCTGGGAGCAGG - Intronic
1171029027 20:21659902-21659924 AGGTCACAGGGGCTGGGGGCTGG + Intergenic
1172448936 20:35008273-35008295 CCGCTGCTAGGGCTGGGGGCTGG - Intronic
1173751469 20:45480045-45480067 CTGCCGCAATGGCTGTGGGAAGG + Exonic
1174974857 20:55320359-55320381 CTGTCACAATGTCTGGGGGGTGG - Intergenic
1175019542 20:55829378-55829400 CTGTCGCCCAGGCTGGAGGCTGG - Intergenic
1175645451 20:60667069-60667091 CAGTCGCAGGGGCTGGGGGAGGG - Intergenic
1175917837 20:62435269-62435291 GTGTCGCCAGGGCTGAGGGAGGG - Intergenic
1176292996 21:5056076-5056098 CTCCCTCCAGGGCTGGGGGCAGG - Intergenic
1176520275 21:7819102-7819124 CTGTTGTAAGGGGTGGGGGGTGG - Exonic
1176545536 21:8196359-8196381 CGGTGGCAAAGGCTGGGGACTGG - Intergenic
1176564487 21:8379404-8379426 CGGTGGCAAAGGCTGGGGACTGG - Intergenic
1179405461 21:41122097-41122119 CTGTCGAGAGGGCTGAGGCCAGG - Intergenic
1179864264 21:44207574-44207596 CTCCCTCCAGGGCTGGGGGCAGG + Intergenic
1179899203 21:44380105-44380127 GTGTCGGAAGGGCTGGGTGGAGG + Intronic
1179911889 21:44455223-44455245 AGGTCGCAGGGGCTGTGGGCGGG - Intergenic
1180065087 21:45408462-45408484 TTGTTGAAAAGGCTGGGGGCTGG + Intronic
1180143343 21:45906351-45906373 GTGTCACAGGGGCTGGGGTCAGG + Intronic
1180821212 22:18829070-18829092 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
1180844155 22:18972389-18972411 CTGTGGCAAGGGCCCTGGGCTGG + Intergenic
1180985017 22:19898962-19898984 CTGCCGGAAGGGCGGGTGGCAGG + Intronic
1181057316 22:20266322-20266344 CTGTGGCAAGGGCCCTGGGCTGG - Intronic
1181191766 22:21146975-21146997 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1181479116 22:23186554-23186576 CAGTGCCAGGGGCTGGGGGCAGG - Intronic
1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG + Intronic
1182129073 22:27837580-27837602 CTGTTGCTAGGCCTGGGGGAGGG + Intergenic
1182435476 22:30326969-30326991 CCGCCGCAAGGCCGGGGGGCGGG + Intronic
1182476305 22:30578533-30578555 CAGACTCAAGGACTGGGGGCGGG - Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182623479 22:31630360-31630382 CTGCCGGAGGGCCTGGGGGCAGG - Intronic
1183603073 22:38851202-38851224 CTGTGGCTAGTGCTGGTGGCAGG - Intergenic
1183745784 22:39690995-39691017 CTGTCGGGAGGGGTGGGGGTAGG + Intergenic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184783028 22:46658566-46658588 CTGGCCCCAGGCCTGGGGGCTGG - Intronic
1184790429 22:46696447-46696469 CTCTCTCAAGTGCAGGGGGCAGG + Intronic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
1185318654 22:50190223-50190245 CAGGGGCCAGGGCTGGGGGCTGG + Intronic
1185380361 22:50505016-50505038 CTGGGGGATGGGCTGGGGGCAGG - Intronic
1203219488 22_KI270731v1_random:31881-31903 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1203250406 22_KI270733v1_random:112596-112618 CGGTGGCAAAGGCTGGGGACTGG - Intergenic
1203271337 22_KI270734v1_random:54946-54968 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
950015488 3:9751966-9751988 CTGATGGAAGGCCTGGGGGCAGG - Intronic
950424000 3:12914846-12914868 CAGGCGCAGGGTCTGGGGGCTGG + Intronic
950626811 3:14253314-14253336 CTGTGGGAAGGCCTTGGGGCCGG + Intergenic
953867032 3:46593147-46593169 CTATGGCAAGGGCAGGGGTCCGG - Intronic
954146130 3:48635201-48635223 CTGCAGCAAGGGGTGGGGGCGGG - Intronic
954249896 3:49359096-49359118 CTCTCTCCAGGGCTGGGGGTAGG - Intergenic
954291424 3:49652040-49652062 CTGCTGCCCGGGCTGGGGGCTGG - Exonic
954326528 3:49867097-49867119 CTCTCTCAAGGGCTGGGGCTGGG + Intronic
954443455 3:50534213-50534235 CTGCTGCCAGGGCTGGGGACAGG - Intergenic
954886867 3:53882260-53882282 CCGGCGCAGGGGCTGGGGGCGGG + Intergenic
955808526 3:62761856-62761878 CAGGGCCAAGGGCTGGGGGCTGG - Intronic
958927468 3:100174361-100174383 CTGTTGCATGGGGTGGGGGCTGG - Intronic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
960999006 3:123359748-123359770 CTGTCTTTAGGGCTGGGGCCAGG - Intronic
961361595 3:126371388-126371410 CGGAGGCATGGGCTGGGGGCGGG + Intergenic
961530686 3:127538182-127538204 CTATAGCAAGGGCTCTGGGCAGG - Intergenic
961791606 3:129380605-129380627 CTGTCCCCAGGGCAGGGAGCAGG + Intergenic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
961797321 3:129418810-129418832 CAGATGCAAAGGCTGGGGGCGGG - Intronic
962249840 3:133829163-133829185 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
966919328 3:184601919-184601941 CTGCCGCCCGGGCCGGGGGCCGG + Intronic
967824833 3:193869759-193869781 GTGTCTGCAGGGCTGGGGGCGGG - Intergenic
968493568 4:903420-903442 CTGTCTCAGGCGCTGGGGTCGGG - Intronic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
968811411 4:2801151-2801173 CTGCGGCAGAGGCTGGGGGCTGG + Intronic
968950626 4:3689658-3689680 GTGTGGCAAGGTCGGGGGGCTGG + Intergenic
969172760 4:5377031-5377053 CTGTGGGGAGAGCTGGGGGCAGG - Intronic
971036700 4:22701188-22701210 CTGTCACAAGGTGTGGGGGAAGG - Intergenic
976765260 4:88592353-88592375 CCGTGGCACGGGCTGGAGGCGGG - Intronic
979114956 4:116812014-116812036 CTGGGCCAGGGGCTGGGGGCTGG + Intergenic
979723886 4:123937020-123937042 CTGGGGCAGAGGCTGGGGGCTGG + Intergenic
981036081 4:140169999-140170021 CTGGTGTAAGGGCTGGGGGCTGG + Intergenic
984888584 4:184473042-184473064 CAGTGGCACGGCCTGGGGGCCGG - Intronic
985781982 5:1876380-1876402 CTGTCGCCAGGGTTCAGGGCAGG + Intergenic
985783238 5:1881620-1881642 CTGTCCCAGGGGGTGGGGGTGGG + Intronic
986066170 5:4236396-4236418 CTGCTGCAAGGGCTGGAGGCTGG - Intergenic
986068892 5:4263281-4263303 CTGTAGCAGGAGCTGGGGTCTGG - Intergenic
986402979 5:7396682-7396704 CTCTGGCAAGGGCTGCGGGCGGG + Intronic
986552580 5:8974652-8974674 CTGTGGCAATGGCTGCAGGCAGG + Intergenic
989289071 5:39740600-39740622 CTGTCGCCAGGTCTCAGGGCTGG - Intergenic
990252656 5:53932368-53932390 CTGTTGGCAGGGCTAGGGGCTGG - Intronic
990353281 5:54939940-54939962 CTGTTGCAAGGGATGCTGGCTGG + Intergenic
992342886 5:75844302-75844324 CTGCTGAAAGAGCTGGGGGCTGG - Intergenic
992783404 5:80148111-80148133 CTGTTGCACGGGCCGTGGGCAGG + Intronic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
998132079 5:139656277-139656299 CTGTGGCAAGAGCAGGGGCCAGG - Intronic
998385114 5:141753127-141753149 CTCTGTCAAGGGCTGGGAGCTGG + Intergenic
999461122 5:151758385-151758407 GGGTCGCAAAAGCTGGGGGCTGG + Intronic
1000055484 5:157602521-157602543 CTGTGGCAAGGGGTGGGAGACGG + Intergenic
1000802277 5:165743203-165743225 CTGTCACACAGGCTGGAGGCTGG + Intergenic
1000987462 5:167876272-167876294 CTGAAACAAGGGCTGGGGGAAGG + Intronic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001269896 5:170303103-170303125 CTGTGTCCAGGCCTGGGGGCAGG - Intergenic
1001395995 5:171419951-171419973 CTGGCGCAGGGGCTGCGGGGCGG - Exonic
1001596628 5:172902764-172902786 CTGCCGCAAGGGCTTGGGGTGGG - Intronic
1002784886 6:393024-393046 CTGGCGCAGGGGATCGGGGCGGG + Intronic
1005013973 6:21360364-21360386 CTGTTGCATGGGCTGTGCGCTGG + Intergenic
1006371559 6:33647523-33647545 TAGTTGCAAGGGCTGGGGGGAGG - Intronic
1007207490 6:40164463-40164485 CAGTCGGAAGGGCTTGTGGCTGG - Intergenic
1007225620 6:40311740-40311762 TTGTGGCAAGGGCTGTGGGAGGG - Intergenic
1007380696 6:41488507-41488529 GTGTAGGAGGGGCTGGGGGCGGG - Intergenic
1018556932 6:165059981-165060003 CTATACCAAGGGCTAGGGGCTGG - Intergenic
1019129655 6:169864415-169864437 CAGTGGCGAGGGTTGGGGGCTGG + Intergenic
1019190682 6:170249048-170249070 CTCCGGCAAGGCCTGGGGGCCGG - Intergenic
1019326724 7:442106-442128 CTGCCCCAAGGGCTGGGTGGTGG - Intergenic
1019701859 7:2477986-2478008 CTGTCCCTGGGGCTGGGGGCAGG - Intergenic
1021078249 7:16331369-16331391 ATGTGGCAAGGTGTGGGGGCGGG - Intronic
1023164765 7:37332747-37332769 CACTGGCAAGAGCTGGGGGCAGG + Intronic
1024191811 7:47019778-47019800 CTGTGGCCAGGGCTGGGGCTGGG - Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1025940906 7:66075753-66075775 CCGTCGCCAGGGGTGGGGACAGG + Intergenic
1026877534 7:73888080-73888102 CGGTTGTAGGGGCTGGGGGCTGG - Intergenic
1027128284 7:75572838-75572860 CTGCAGCTGGGGCTGGGGGCGGG - Intronic
1029371637 7:100154565-100154587 CTGTCTCAGGGGTTGGGGACAGG - Exonic
1029446685 7:100616970-100616992 CTTTCTGAGGGGCTGGGGGCAGG + Intergenic
1029699876 7:102239404-102239426 CTGGTGCTGGGGCTGGGGGCTGG - Exonic
1031300849 7:120059705-120059727 CTGCTGCAAGGGCTGAGGGAAGG - Intergenic
1032396244 7:131592076-131592098 CTGTGGCCAGGGCTGAGGGAAGG + Intergenic
1033652807 7:143355124-143355146 CTGTGCCAAGGGCTGGGGAGGGG + Exonic
1034425158 7:151010208-151010230 CAGCCGCAAGAGCTGAGGGCTGG - Exonic
1034498002 7:151433480-151433502 CTGCCTCAAGGGTTGGGGCCAGG + Intronic
1035222083 7:157411809-157411831 CTGTGGCTATGGCTGTGGGCGGG + Intronic
1035523709 8:295137-295159 TTGTCACAATGGCTGGAGGCCGG - Intergenic
1035733443 8:1869812-1869834 CTGACCCACAGGCTGGGGGCGGG + Intronic
1036207895 8:6818795-6818817 GTCTGGCAGGGGCTGGGGGCTGG - Intronic
1036665239 8:10733291-10733313 CTGTCGCCAGCGCTGGGTTCGGG + Intronic
1036765731 8:11548238-11548260 CTGGGGCCAGGGCTGGGGGCAGG - Intronic
1037815432 8:22109378-22109400 CTGCCGCAGGGACTGGGAGCGGG - Exonic
1038005212 8:23424166-23424188 CTGGCCCCAGGGATGGGGGCAGG - Intronic
1042138172 8:65652134-65652156 CTGTCGCCCGGGCTGGAGTCTGG + Intronic
1042922516 8:73933716-73933738 CTGTCGCCCAGGCTGGAGGCTGG + Intergenic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1046507478 8:115154704-115154726 CTGTCCCAAAGGAAGGGGGCAGG - Intergenic
1049050678 8:140192538-140192560 CTGGTGCGAGGGCTGTGGGCGGG - Intronic
1049255016 8:141609138-141609160 CAGTGGCAGGGGGTGGGGGCTGG + Intergenic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049433679 8:142576647-142576669 CTGGCAGGAGGGCTGGGGGCAGG - Intergenic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1051182286 9:14424012-14424034 TTTTGGCAAGGGGTGGGGGCTGG + Intergenic
1051287732 9:15513388-15513410 CTGAAGCAAGGGGAGGGGGCAGG + Intergenic
1052131466 9:24853698-24853720 TTGTGGCAAGACCTGGGGGCAGG - Intergenic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1053269486 9:36740269-36740291 CTGAAGCAAGGGCAGGGGGCAGG - Intergenic
1055951737 9:81735755-81735777 CAGAAGCAAGGGCTGGGGGTGGG + Intergenic
1056154079 9:83817627-83817649 GTGTCGGCAGAGCTGGGGGCAGG + Exonic
1056356419 9:85805466-85805488 GTGTCGGCAGAGCTGGGGGCAGG - Intergenic
1058016151 9:100034476-100034498 CAGCCGCAAGGGCTGCTGGCTGG - Intronic
1058875787 9:109243851-109243873 CTCTGACAAAGGCTGGGGGCTGG + Intronic
1059611985 9:115908278-115908300 CTGTCTCAGGGGCTGGGGATAGG + Intergenic
1061003632 9:127916452-127916474 CTGTCTCCAGGGCTGGGGCTGGG + Exonic
1061222032 9:129257890-129257912 CAGTGCCAAGAGCTGGGGGCAGG - Intergenic
1061371013 9:130197604-130197626 CTGGCGGGAGGGCTGGGGGCAGG + Intronic
1061539697 9:131271532-131271554 CTGGCCCAAGGGTTGGGAGCTGG + Intronic
1062374442 9:136255626-136255648 CTGAAGGAGGGGCTGGGGGCTGG + Intergenic
1203466808 Un_GL000220v1:95868-95890 CGGTGGCAAAGGCTGGGGACTGG - Intergenic
1187318323 X:18219141-18219163 CTGTGGCAAGTGCTGGGCGATGG - Intronic
1188491777 X:30745495-30745517 CTGAAGGAAGGGCTGGAGGCTGG - Intergenic
1189339926 X:40197164-40197186 CTGGAGCAAGGGCCTGGGGCTGG - Intergenic
1189368210 X:40406350-40406372 GTGGCTCAAAGGCTGGGGGCTGG - Intergenic
1189373433 X:40447758-40447780 GTGTCTCAAAGGCTGGGAGCTGG - Intergenic
1190137055 X:47807029-47807051 TCGTGGAAAGGGCTGGGGGCAGG + Intergenic
1190212761 X:48460953-48460975 CTGGGGCTAGGGCTGGGGGGAGG - Intronic
1191726047 X:64282355-64282377 CTGTCAGAAGGGGTGGGGGTAGG + Intronic
1192481898 X:71492915-71492937 CCGAGGCTAGGGCTGGGGGCTGG - Intronic
1194669148 X:96708534-96708556 ATGTCGCAGGGGGTGGGGGACGG - Intronic
1194932184 X:99901546-99901568 CTGTTGCAGGGCCTGGGGGGTGG - Intergenic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195239266 X:102935029-102935051 CTGTCGGAGGGGGCGGGGGCGGG + Intergenic
1195252394 X:103062030-103062052 TTGTGTCATGGGCTGGGGGCAGG + Intergenic
1196867937 X:120086355-120086377 CTGTCCCAAGGGCTGAGGAATGG - Intergenic
1196875165 X:120149926-120149948 CTGTCCCAAGGGCTGAGGAATGG + Intergenic
1196950905 X:120875138-120875160 CTGTCCCAGAGGCTGGGTGCAGG - Exonic
1198724991 X:139667609-139667631 CTGTCTCAGGGGGTGTGGGCAGG + Intronic
1199343456 X:146709495-146709517 CTGTCACAAGGGCTGTTTGCTGG + Intergenic
1199720898 X:150542160-150542182 GTTTGGCAAAGGCTGGGGGCTGG + Intergenic
1199786618 X:151112013-151112035 TTGTGGCATGGGATGGGGGCAGG + Intergenic
1200064893 X:153499636-153499658 CTGCCTGAGGGGCTGGGGGCTGG - Intronic
1200213792 X:154358568-154358590 CTGTCCCTGGGGCTGGGGCCAGG - Exonic