ID: 946197404

View in Genome Browser
Species Human (GRCh38)
Location 2:218043323-218043345
Sequence CTGGATGACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 985
Summary {0: 5, 1: 54, 2: 137, 3: 274, 4: 515}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946197404_946197406 2 Left 946197404 2:218043323-218043345 CCTCTCTGCAGCTGGTCATCCAG 0: 5
1: 54
2: 137
3: 274
4: 515
Right 946197406 2:218043348-218043370 GTCTGCAGCTCTCAACAGAAAGG 0: 1
1: 1
2: 31
3: 190
4: 584
946197404_946197409 17 Left 946197404 2:218043323-218043345 CCTCTCTGCAGCTGGTCATCCAG 0: 5
1: 54
2: 137
3: 274
4: 515
Right 946197409 2:218043363-218043385 CAGAAAGGAGGCCCTGGAGAAGG 0: 6
1: 69
2: 155
3: 280
4: 788
946197404_946197408 11 Left 946197404 2:218043323-218043345 CCTCTCTGCAGCTGGTCATCCAG 0: 5
1: 54
2: 137
3: 274
4: 515
Right 946197408 2:218043357-218043379 TCTCAACAGAAAGGAGGCCCTGG 0: 1
1: 15
2: 139
3: 249
4: 440
946197404_946197407 5 Left 946197404 2:218043323-218043345 CCTCTCTGCAGCTGGTCATCCAG 0: 5
1: 54
2: 137
3: 274
4: 515
Right 946197407 2:218043351-218043373 TGCAGCTCTCAACAGAAAGGAGG 0: 1
1: 3
2: 97
3: 180
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946197404 Original CRISPR CTGGATGACCAGCTGCAGAG AGG (reversed) Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900792535 1:4689840-4689862 GCGGATGCCCAGCAGCAGAGGGG + Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
901957714 1:12798323-12798345 CAGGAAGACCAGTGGCAGAGAGG + Intergenic
902402657 1:16166592-16166614 CTGGATGAGGAGCTGGGGAGGGG + Intergenic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902531119 1:17091284-17091306 CTGCATGCCCAGCTGCCTAGGGG - Intronic
903003663 1:20284154-20284176 CTCGAGGACCAGCTACAGACAGG + Intergenic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
903311867 1:22465331-22465353 TGGGATGACTAGCTACAGAGAGG - Intronic
903337492 1:22634905-22634927 TTGGATGACCAGCTGCCGAGAGG - Intergenic
903672100 1:25042603-25042625 CAGGACAACTAGCTGCAGAGAGG - Intergenic
903672122 1:25042784-25042806 TAGGATGACCAGCTGTAGAGAGG - Intergenic
903785812 1:25860516-25860538 CTGGCTGACCTGCTGCAGACTGG - Intergenic
903855698 1:26336606-26336628 CTGTAGGACCGGCTGCAGCGAGG + Exonic
904042916 1:27594465-27594487 CAGGATGACCAGGTGCCAAGGGG + Intronic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
904370118 1:30042904-30042926 TGGGATGACCAGCTGCAGACAGG + Intergenic
904403938 1:30274291-30274313 TGGGAGAACCAGCTGCAGAGGGG - Intergenic
904559994 1:31390120-31390142 CTGGGTAACCAGCTGCCGTGTGG - Intergenic
904577391 1:31513900-31513922 TGGGATGACTAGCAGCAGAGAGG - Intergenic
905001313 1:34671882-34671904 TGGGATGACCAACTTCAGAGAGG + Intergenic
905001326 1:34672007-34672029 CAGGATGACTGGCTGCAGAGAGG + Intergenic
905001336 1:34672075-34672097 TGGGATGACCACCTGCAGAGAGG + Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
905146175 1:35888445-35888467 CTGGAACACCTGCTGCAGGGGGG - Exonic
905546094 1:38801590-38801612 CCTGACCACCAGCTGCAGAGAGG + Intergenic
905546106 1:38801660-38801682 CGGGACTACCAGTTGCAGAGAGG + Intergenic
905746982 1:40426492-40426514 CTGGTTGACCAGCTGGAAATTGG + Intergenic
905803069 1:40858040-40858062 CAGGATCAGCAGCTGCAGAAGGG - Intergenic
906074320 1:43041015-43041037 CTGGATCCCCAACTACAGAGTGG - Intergenic
906132407 1:43468579-43468601 CCCAATGACCAGCTGCAGAGAGG - Intergenic
906526898 1:46498881-46498903 CTTGATGTCCAGCTGTAGTGAGG + Intergenic
906854795 1:49292552-49292574 GGGGATGACTAGCTGCAGAGAGG + Intronic
906854801 1:49292622-49292644 TGTGATGACCAGCTGCAAAGAGG + Intronic
906854811 1:49292690-49292712 CAGGATTACCTGCTGCAGAGAGG + Intronic
906938669 1:50236680-50236702 ATGGATAACCAGCCACAGAGAGG - Intergenic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907152993 1:52306324-52306346 TGAGATGACCAGCTGTAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907369612 1:53992482-53992504 TGGGATGACCAGTTGAAGAGAGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
908259289 1:62327245-62327267 CCGGACTACCAGCTGCAGACAGG - Intergenic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
909282340 1:73771036-73771058 TGGGATAACCAGCTGCAGAGAGG + Intergenic
909815986 1:79994378-79994400 ATGGATGAGGAGCTGCAAAGGGG + Intergenic
910259901 1:85284505-85284527 TGGGACTACCAGCTGCAGAGAGG + Intergenic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
910654925 1:89609846-89609868 TGGGATGACCCGCTACAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
911025063 1:93427219-93427241 TGGGATAACCAGCTGCAGAAAGG + Intergenic
911118623 1:94272447-94272469 CTGGATAACCAGGTGCAAGGAGG + Intronic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
912077557 1:105894590-105894612 CTGGATCTCCAGATTCAGAGAGG - Intergenic
912740180 1:112187204-112187226 CTTGAAGACCAACTGCAGAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
914392717 1:147236741-147236763 TGGGATAACCAGCCGCAGAGAGG - Intronic
915138962 1:153754397-153754419 CTGGAAGACCAGCAGAAGACAGG + Intronic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
915185075 1:154098598-154098620 TTGGGCAACCAGCTGCAGAGAGG - Intronic
915511670 1:156390123-156390145 CTGGATGAGGAGCTGCAGAAAGG - Intergenic
916030802 1:160876056-160876078 CTGAATGAGCACCTGCAGATGGG + Intergenic
916202301 1:162283731-162283753 CTGGAACACCACCTGCAGACTGG - Intronic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
916850278 1:168696228-168696250 CTGGAGCACCAGCTGCAGCCTGG - Exonic
917817632 1:178725943-178725965 CAGGGTGACCTGTTGCAGAGCGG + Intronic
918163843 1:181925607-181925629 CTTGATGAGCAGCCTCAGAGTGG - Intergenic
918963193 1:191306580-191306602 TAGGACGACCAACTGCAGAGAGG - Intergenic
919083218 1:192891235-192891257 TGGGACTACCAGCTGCAGAGAGG - Intergenic
919083224 1:192891301-192891323 TGGGATGATCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919313954 1:195948184-195948206 CAGGACGACGAGTTGCAGAGAGG - Intergenic
919834183 1:201562491-201562513 CAGGAGGCCCAGCTGCTGAGGGG - Intergenic
920317885 1:205092216-205092238 TTTATTGACCAGCTGCAGAGTGG - Intronic
920543383 1:206796026-206796048 CTGGGTCTCCAGCTGCAGACAGG - Intergenic
920819579 1:209367898-209367920 CTAGATGACCAGATGGAGAATGG + Intergenic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097849 1:211902185-211902207 TGGGACAACCAGCTGCAGAGAGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922132774 1:222795661-222795683 TGGGATGAACAGCTGCAGAGAGG + Intergenic
922419515 1:225450061-225450083 CTGGATCATCAGCTGCTGCGGGG - Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923514584 1:234683976-234683998 CTGGTCAGCCAGCTGCAGAGGGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
924412086 1:243817065-243817087 CAGGATGACCTGCTAGAGAGAGG + Intronic
924679924 1:246220858-246220880 TGGGACAACCAGCTGCAGAGAGG + Intronic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
1062770014 10:91964-91986 TAGGACAACCAGCTGCAGAGAGG - Intergenic
1063095139 10:2902586-2902608 CAGAATGACCAGCTCTAGAGTGG + Intergenic
1063714533 10:8514043-8514065 CTGCTTGACCCGCTGCAGGGCGG + Intergenic
1065079255 10:22111407-22111429 CTGGAAGACGAGCTGGGGAGGGG + Intergenic
1065300128 10:24313590-24313612 CGGGATGTCCTTCTGCAGAGGGG + Intronic
1067018079 10:42772315-42772337 CATGATGACCAGCTGCAGGGAGG + Intergenic
1067421838 10:46158959-46158981 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1067507144 10:46865048-46865070 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1067715796 10:48690614-48690636 AGGGACAACCAGCTGCAGAGAGG - Intronic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068279866 10:54854667-54854689 CCTGATGATCAGCTGCAGAGAGG - Intronic
1068283652 10:54908931-54908953 CAGGATGACCAGCTGCAACAAGG - Intronic
1068348499 10:55814011-55814033 CGGGATGCCCAGCTGCAGAATGG + Intergenic
1068858434 10:61821597-61821619 CTGGATCACAAGCTGCTGAACGG + Intergenic
1069156293 10:65034808-65034830 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1069156301 10:65034876-65034898 TGGGATGACCAGGTACAGAGAGG + Intergenic
1069684517 10:70309134-70309156 CTGGGTGATCAGGGGCAGAGGGG - Intronic
1070859318 10:79638095-79638117 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071060863 10:81570197-81570219 TGGGATGACCAGCTGCAGAAAGG - Intergenic
1071886015 10:89951552-89951574 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1072335525 10:94395094-94395116 CAAGATGACCAGCTTCAGAGAGG - Intergenic
1072622607 10:97090051-97090073 CTGGATGAACAGCAGCGGCGAGG - Intronic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1072753363 10:97999965-97999987 TGGAATGACCAGCTGCAGAGAGG + Intronic
1073262487 10:102201089-102201111 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1073309925 10:102533088-102533110 CTGTCTGACCAGCTGCACATGGG + Intronic
1073670223 10:105579705-105579727 CAGTACAACCAGCTGCAGAGAGG - Intergenic
1073733609 10:106320476-106320498 CAGGACAACCAGCTACAGAGAGG + Intergenic
1074028794 10:109663913-109663935 TGGGATGACCAGCTACAGAGAGG + Intergenic
1074028820 10:109664098-109664120 TAGGATGACCAACTGCAGGGAGG + Intergenic
1074247910 10:111713477-111713499 CAGGATGACCAGCTCCAGAGAGG - Intergenic
1074247921 10:111713591-111713613 TGGGATGACCAGCTGTAGAGAGG - Intergenic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1074991520 10:118712754-118712776 TGAGATGACCAGCTGCAGAGAGG - Intronic
1075007827 10:118842996-118843018 TGGGATGACCAGCTGCAGGGAGG + Intergenic
1075007837 10:118843066-118843088 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1075222470 10:120597128-120597150 CAGGATAACCAGCTGAAGATTGG - Intergenic
1075442933 10:122493956-122493978 CTGCATGAGGAGCTGGAGAGGGG - Intronic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1077171590 11:1168726-1168748 CTGCATGAACAGCTGCATGGTGG - Exonic
1077555664 11:3224907-3224929 CATGATGCCCAGCTGGAGAGAGG - Intergenic
1077844674 11:6012385-6012407 TGGGATGACCAGGTGCAGAGAGG - Intergenic
1077844699 11:6012558-6012580 TGAGATGACCAGCTGCAGGGAGG - Intergenic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078042755 11:7883909-7883931 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1078836394 11:15034861-15034883 ACGAAGGACCAGCTGCAGAGAGG - Intronic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1079487305 11:20948697-20948719 TTGGGTGAGAAGCTGCAGAGAGG - Intronic
1079710672 11:23679698-23679720 AGGGATGACCAGCTGCGGAGAGG - Intergenic
1079710700 11:23679859-23679881 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079803173 11:24896431-24896453 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081759640 11:45568244-45568266 CTGGTAAAGCAGCTGCAGAGGGG - Intergenic
1082854776 11:57796681-57796703 CTGGATAACCATCTTCATAGTGG - Exonic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083145946 11:60758839-60758861 CTGGAAGAGCAGCTACAGTGTGG + Intronic
1083235678 11:61349371-61349393 CTGCATGGTGAGCTGCAGAGTGG + Exonic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1084375384 11:68773280-68773302 CTGGAGGGCCAGCTGCACAAAGG + Exonic
1084469457 11:69348590-69348612 CAGGATGACCAGCTGCAGCTGGG - Intronic
1084483554 11:69435352-69435374 CTGGATGCCCAGGCTCAGAGAGG - Intergenic
1084991159 11:72926378-72926400 TGGCATGACCAGTTGCAGAGAGG + Intronic
1084991165 11:72926431-72926453 TGGGATGGCCAGCTGCAGAGAGG + Intronic
1085100647 11:73797112-73797134 CGGGACAACCGGCTGCAGAGAGG + Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1088019797 11:105105480-105105502 TTGGATTACCAGCTTCAGGGTGG - Intergenic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1088513304 11:110599744-110599766 CCTGACAACCAGCTGCAGAGAGG + Intronic
1088623947 11:111715146-111715168 GTGGGTGACCAGCTCCAGCGTGG - Intronic
1088704254 11:112447754-112447776 CCTAATGACCAGCTGCAGAGAGG - Intergenic
1089398009 11:118148424-118148446 CAGGATGACCAAGTCCAGAGAGG + Intronic
1089505747 11:118961092-118961114 TTTGACGACCAGCTGCAGAAAGG - Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1089813310 11:121149237-121149259 CTGGTTGACCAGGCTCAGAGAGG - Intronic
1089822505 11:121241314-121241336 CCAGACCACCAGCTGCAGAGAGG - Intergenic
1089823201 11:121246798-121246820 TGGGATGACCCGCTGCAGAGAGG + Intergenic
1090124869 11:124075343-124075365 TGGGATGACCTGCTGCAGAGAGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1090137010 11:124209581-124209603 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1091220456 11:133927360-133927382 ATGGATTACCAGCTGCATTGTGG + Intronic
1091981346 12:4866622-4866644 CTGCCTGTCCAGGTGCAGAGTGG + Intergenic
1092074150 12:5659393-5659415 CTGGAGGCTCAGCTCCAGAGAGG - Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092447070 12:8567850-8567872 CTGGACAACCAGCTGCAAAGAGG - Intergenic
1092501424 12:9051201-9051223 TGGGAAGACCAGCTGCAGAAAGG + Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092501450 12:9051393-9051415 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1093281833 12:17204343-17204365 TGGGATGACCAGCTACAGAGGGG + Intergenic
1093492987 12:19725956-19725978 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1093726589 12:22518972-22518994 CTCGAAGTCCAGCTGCAGTGAGG - Intronic
1093914917 12:24790584-24790606 CTGGTAAACCAGCTGCAGTGAGG + Intergenic
1094018115 12:25885136-25885158 CGGGATTACCAGCTGCAGAAAGG + Intergenic
1094144506 12:27214421-27214443 CAGGAGGACTAGCTGCAGAGAGG + Intergenic
1094427340 12:30328589-30328611 TGGGATGACCAGCTGTATAGAGG + Intergenic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1095603236 12:44037908-44037930 TGGGAGTACCAGCTGCAGAGAGG + Intronic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602157 12:52737021-52737043 AAGGAGGACCAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1096944667 12:55391869-55391891 CTAGAGGACCAGCTGAAGAGAGG - Intergenic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097298947 12:57997867-57997889 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1097298971 12:57998031-57998053 CAGGAGGACCAGCTTCAGAGTGG - Intergenic
1097491967 12:60282325-60282347 CAGGATGATCAGCTGCGGAGAGG - Intergenic
1098143858 12:67478280-67478302 CTGAATAACCAGCTGAAGAGGGG - Intergenic
1098465606 12:70783433-70783455 CAGAATGATCAGCTACAGAGAGG - Intronic
1099574597 12:84362975-84362997 TGGGGTGACCAGCTGCAGAAAGG + Intergenic
1100847930 12:98679206-98679228 TGGGACAACCAGCTGCAGAGAGG + Intronic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1103920107 12:124394975-124394997 CTGGAGGATGAGCAGCAGAGGGG - Intronic
1104534611 12:129607371-129607393 CTGCATGCCAAGCTCCAGAGGGG - Intronic
1104732201 12:131113667-131113689 CTGCATGACCAGCCGCAGTCTGG - Intronic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107147087 13:37070552-37070574 TGGGAGGAACAGCTGCAGAGAGG + Intergenic
1107853482 13:44592297-44592319 CAGGAGGACCAGCTGCAAAGAGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108016982 13:46086478-46086500 GGGGAGGACCAGCTGTAGAGAGG - Intronic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1108686734 13:52826400-52826422 CCGGACCAGCAGCTGCAGAGGGG + Intergenic
1109416450 13:62046759-62046781 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109525274 13:63566709-63566731 CCAGACGACCAGCTGCAGAGAGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1109622177 13:64925229-64925251 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1109633681 13:65085722-65085744 CTGGACAACCAACTGCGGAGAGG - Intergenic
1109982307 13:69924425-69924447 TTGGATGGCCAGCTGCAGAAAGG + Intronic
1110286843 13:73759659-73759681 CTGGATGAACAGGCACAGAGAGG + Intronic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1110939472 13:81330944-81330966 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1110939478 13:81331006-81331028 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1111237814 13:85431537-85431559 CAGAATGACCAGCTGAGGAGAGG + Intergenic
1111333569 13:86792396-86792418 CTGGGCGAGCAGCTGCAGAGGGG + Intergenic
1111337202 13:86839836-86839858 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1111337213 13:86839946-86839968 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1111337226 13:86840056-86840078 CATGATGACCAGCTGTAGAGAGG - Intergenic
1111512646 13:89287156-89287178 TGGGATGAGCAGCTGCAGAGAGG - Intergenic
1111512658 13:89287226-89287248 CAGGACTACTAGCTGCAGAGAGG - Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1113581613 13:111434056-111434078 GTGGATGACCATCTGTAGGGTGG + Intergenic
1113779082 13:112965729-112965751 CTGGATGATCAGCCACAAAGCGG - Intronic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1114349550 14:21835448-21835470 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116131431 14:40859437-40859459 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1116541487 14:46107429-46107451 CAGAATGACCAGCTGTGGAGAGG - Intergenic
1116868489 14:50050372-50050394 CTGGAGGACGAGCTGCTGGGTGG - Intergenic
1117285461 14:54282432-54282454 CCAGATGACCAGCTGTGGAGAGG - Intergenic
1118200077 14:63663507-63663529 CAGGATGACCAGCTATGGAGAGG - Intergenic
1118410063 14:65469762-65469784 CCAGATGACTAGCTGCAGAGAGG - Intronic
1118946990 14:70398115-70398137 TGGGATGACCAGCTCCAGAGAGG - Intronic
1119036212 14:71231977-71231999 CACGCCGACCAGCTGCAGAGAGG + Intergenic
1119342730 14:73894243-73894265 TTGGATGAACATCAGCAGAGTGG + Intronic
1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG + Intronic
1119485061 14:74981598-74981620 CTGGAGGGCCACGTGCAGAGGGG - Intergenic
1119618223 14:76112384-76112406 TGGGTTGGCCAGCTGCAGAGAGG + Intergenic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120590063 14:86364270-86364292 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1120745529 14:88147631-88147653 GAGGAGGACCAGCTGCAGAGAGG + Intergenic
1120829322 14:88984143-88984165 CAGGATCACCAGCTGCTCAGTGG - Intergenic
1120981391 14:90292399-90292421 CTGGAAGACAATCTCCAGAGGGG + Intronic
1121625619 14:95383718-95383740 TTGGAGGACAAGCTGGAGAGGGG - Intergenic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1122439419 14:101719790-101719812 CTGGATAAACACCTGAAGAGGGG + Intergenic
1122604041 14:102936574-102936596 CTGGCTGCCCAGGTGCTGAGGGG + Intronic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216608 14:106813901-106813923 CAGGACGACCGGCTGCAGGGAGG + Intergenic
1124650206 15:31468890-31468912 TGGGATGACCAACTGCAGAGAGG - Intergenic
1124651361 15:31476633-31476655 CTGGCTGGACAGCTGCAGAGAGG + Exonic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1124820913 15:33044773-33044795 CAGGATGACCAGCTGTACAGAGG + Intronic
1124937617 15:34187122-34187144 TGGGACCACCAGCTGCAGAGAGG + Intronic
1125381551 15:39092188-39092210 TGGGATTACCAGCTGCAGAGAGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125436081 15:39646169-39646191 TGGGAAGACCAGCTGCAGAGAGG + Intronic
1125752398 15:42037370-42037392 CAGGATGACCAGCTGCTGAGAGG + Intronic
1126156856 15:45574042-45574064 CAGGATGGCCAGCTGCATAGAGG - Intergenic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1127918724 15:63476524-63476546 CTGGAAGACCAGGAGCAGGGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128521700 15:68379588-68379610 CTGGTTGTCCACCTGCAGATGGG - Intronic
1128552887 15:68609606-68609628 CTGGGAGACCAGCAGCAAAGAGG - Intronic
1128790675 15:70431637-70431659 TGGAATGACCAGCTGCAGATAGG - Intergenic
1128847878 15:70917436-70917458 TGGGATAACCAGCTGTAGAGAGG + Intronic
1128847887 15:70917506-70917528 TGGGATGACCATCTGCAGAGAGG + Intronic
1128847894 15:70917576-70917598 TGGGATGACCAGTTGCAAAGAGG + Intronic
1128890075 15:71323515-71323537 CTGGTTGAAGAGCTGCAGGGGGG + Intronic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1129377708 15:75144733-75144755 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1129507853 15:76098334-76098356 CTAGCAGACCAGCAGCAGAGGGG - Intronic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1130183193 15:81651906-81651928 CAGGATGACCTGCTGCAGAAAGG + Intergenic
1130756123 15:86765466-86765488 CTGAAACACCAGCTGCAAAGTGG - Intronic
1131686723 15:94775970-94775992 CTGGATGGCTATCTGAAGAGGGG - Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1134414003 16:14028364-14028386 CTGGATGGGCAGGTGCAGAAAGG + Intergenic
1136553835 16:30996708-30996730 CTGGAAGACATGCTGGAGAGCGG - Exonic
1136872797 16:33824122-33824144 CAGGACGACTAGCTGCAGGGAGG - Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1138033513 16:53579988-53580010 TGGGATGACCAGCTACAGAGAGG - Intergenic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1139625805 16:68187679-68187701 CAGGATGACCAGCTGTGGAGAGG - Intronic
1141474218 16:84261508-84261530 AAGGATGCCAAGCTGCAGAGAGG + Intergenic
1141503813 16:84462085-84462107 CTGGAAGACCCTCTGCAGCGGGG - Exonic
1142198907 16:88751826-88751848 CTGGCTGGACAGGTGCAGAGGGG - Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1143029463 17:3959819-3959841 CTGCAGGCCCCGCTGCAGAGCGG - Intronic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1144060905 17:11582929-11582951 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1144073361 17:11694453-11694475 CTGGAGGAGCATCTGCAGAAAGG + Intronic
1144386297 17:14751620-14751642 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1144714533 17:17424728-17424750 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
1146093524 17:29905872-29905894 CTGGATGACTAACTGCAGAAAGG + Intronic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146459478 17:33033986-33034008 TGAGATGATCAGCTGCAGAGAGG + Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1146761540 17:35483028-35483050 CAGGACAACCAGCCGCAGAGTGG + Intronic
1147248095 17:39135273-39135295 CTCGATGTGTAGCTGCAGAGGGG + Intronic
1148386252 17:47237256-47237278 GGAGATGACCAGCTGCAGAGAGG - Intergenic
1148386269 17:47237336-47237358 GGTGATGACCAGCTGCAGAGAGG - Intergenic
1148640379 17:49183333-49183355 CAGGGCAACCAGCTGCAGAGAGG - Intergenic
1148640390 17:49183403-49183425 CAGGACGAACAGCTGCAGAGAGG - Intergenic
1148680750 17:49472323-49472345 CTAGCTGTCCAGCTGCAGGGAGG - Intronic
1148975635 17:51525893-51525915 CTGGATGGTCAGATGCATAGAGG + Intergenic
1148984507 17:51609923-51609945 CTTGCTGTCCAGCTGCTGAGGGG + Intergenic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1150529172 17:65958955-65958977 GGGGACAACCAGCTGCAGAGGGG + Intronic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150529193 17:65959093-65959115 CGGGACCACCAGCTGCAGATAGG + Intronic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1150951010 17:69802083-69802105 TGGGATGACCAGCTGGAGAGAGG + Intergenic
1150952830 17:69821933-69821955 TGGGATGATCAGCTGCAGGGAGG + Intergenic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151010010 17:70483661-70483683 CAGGATGGCCAGCTGTGGAGAGG - Intergenic
1151010036 17:70483797-70483819 CTGGACGACCAGCTGCAAAGAGG - Intergenic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1151541493 17:74767193-74767215 CAGGATGGCGGGCTGCAGAGGGG - Intronic
1151773115 17:76177743-76177765 TGGGACCACCAGCTGCAGAGAGG + Intronic
1151773123 17:76177813-76177835 CCATAAGACCAGCTGCAGAGAGG + Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152530395 17:80915109-80915131 TGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530412 17:80915247-80915269 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530449 17:80915527-80915549 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530460 17:80915597-80915619 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530481 17:80915737-80915759 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530492 17:80915807-80915829 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1153139324 18:1954321-1954343 TGGGATGACCACTTGCAGAGAGG - Intergenic
1154096091 18:11416546-11416568 GAGGCTGAGCAGCTGCAGAGAGG - Intergenic
1154507968 18:15061087-15061109 GCAGATAACCAGCTGCAGAGAGG + Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155120660 18:22816187-22816209 TGGGATGACCAGTTGCAGAGAGG - Intronic
1155120664 18:22816241-22816263 TGGGACGACCAGCTGTAGAGAGG - Intronic
1155830854 18:30513630-30513652 AGGGATGACCTGCTACAGAGAGG - Intergenic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1156160386 18:34351308-34351330 TGGGAGGACCAGCTTCAGAGAGG + Intergenic
1156298756 18:35817593-35817615 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1156684388 18:39627219-39627241 CTAGATGTAAAGCTGCAGAGGGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157509898 18:48263414-48263436 CTGGACGAGTGGCTGCAGAGTGG - Intronic
1159186702 18:64984178-64984200 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1159519055 18:69495476-69495498 TGGGACAACCAGCTGCAGAGAGG - Intronic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160292865 18:77609707-77609729 TGGGACGGCCAGCTGCAGAGAGG + Intergenic
1160313845 18:77822016-77822038 CTGGGGGCCCAGCTGCAGAGAGG - Intergenic
1161168923 19:2803503-2803525 CTGGAAGAGAAGCTGCAAAGTGG - Intronic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1161824129 19:6551234-6551256 CCTGACGACCAGCTGCAGAAAGG - Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1161998646 19:7730008-7730030 CTGGATGAGCAGGTGCGCAGGGG - Exonic
1165022656 19:32936643-32936665 TGAGATGACCAGCTGCAGAGAGG + Intronic
1165026920 19:32969155-32969177 TGGGGTGACCAGCTACAGAGAGG - Intronic
1166007738 19:39918631-39918653 CTGGTTGTCAACCTGCAGAGTGG + Exonic
1166571575 19:43800023-43800045 CTGGACTGTCAGCTGCAGAGAGG - Intronic
1166748309 19:45152395-45152417 CTGGAGGACCGGCAGCAGACCGG - Exonic
1166897511 19:46033057-46033079 TGGGACAACCAGCTGCAGAGCGG + Intergenic
1166897518 19:46033114-46033136 TGGGATGACCAGCTCCAGGGAGG + Intergenic
1166898166 19:46036884-46036906 CTGAATGACCAGCTGAGAAGAGG + Intergenic
1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG + Intergenic
1167109117 19:47448410-47448432 CTGGAGGAAGGGCTGCAGAGCGG + Intronic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
1167510077 19:49891165-49891187 CAGGAGGCCCAGCTGCGGAGGGG - Intronic
1168551760 19:57302194-57302216 CTGGATAACCAGCTGCCAGGGGG - Intergenic
924963907 2:58157-58179 TGGGATGACCAGCTGCAGGGAGG + Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925067987 2:943987-944009 CAGGAGGAACTGCTGCAGAGAGG - Intergenic
925515334 2:4674917-4674939 CAGGATGACCCGCTGTGGAGAGG + Intergenic
925917159 2:8614959-8614981 CTGGATGACCAGGTGAATGGTGG + Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
926958817 2:18332198-18332220 TGGGATGACCAGCCGTAGAGAGG - Intronic
927072942 2:19548717-19548739 TGGGATGACCAGCTGCAGAAAGG + Intergenic
927226212 2:20767838-20767860 TGGGATGACCTGCTGCAGAAAGG + Intronic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927533827 2:23836785-23836807 CAGGAGGACCAACTTCAGAGAGG - Intronic
927613538 2:24566298-24566320 TGGGATGACCAGCTGCGGAGAGG - Intronic
927613560 2:24566438-24566460 TAGGATGACCAGCTGTGGAGAGG - Intronic
927743155 2:25590569-25590591 TGGGACAACCAGCTGCAGAGAGG - Intronic
927859250 2:26550345-26550367 CTGGATGGCTGGCTGCAGGGGGG + Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930592700 2:53348182-53348204 CTGGATGTCCATATGCAGAAGGG - Intergenic
930612046 2:53554404-53554426 TGGGATGACCAGCTGCAAAGAGG + Intronic
930612060 2:53554518-53554540 TGGGATGACCAGCTGCAGAAAGG + Intronic
930800586 2:55438657-55438679 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
930800595 2:55438725-55438747 TGGAATGACCAGCTACAGAGAGG + Intergenic
930946615 2:57084112-57084134 TGGGACGACCAACTGCAGAGAGG - Intergenic
930957289 2:57217698-57217720 CAGGATGACCAGCTGTGGAGAGG + Intergenic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
932187240 2:69708693-69708715 TTGGAGGACCATCTTCAGAGAGG - Intronic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
933093325 2:78146924-78146946 TGGGATGACTAGCTGCAGAGAGG + Intergenic
933219248 2:79669730-79669752 ATCCTTGACCAGCTGCAGAGAGG - Intronic
933383759 2:81583871-81583893 CGGGAAGGCCAGATGCAGAGAGG + Intergenic
933547181 2:83729486-83729508 CTGGATCACCAGCTGTTCAGTGG + Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935250995 2:101260548-101260570 CTGGGTGGCTAGCTCCAGAGTGG - Intronic
935514983 2:104024910-104024932 CTTGATAACCTGCTGGAGAGGGG - Intergenic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
936355551 2:111746795-111746817 ATGGATGGGCAGCTGGAGAGGGG - Intergenic
936554952 2:113488037-113488059 CTGGTTGGCCTGCTGCAGGGAGG - Intronic
936747562 2:115596959-115596981 TTAGATGACTAGCTTCAGAGTGG + Intronic
937152743 2:119697043-119697065 CTGGCTGACCAGCTGCAGGCTGG + Intergenic
937163988 2:119794978-119795000 TGGGATAGCCAGCTGCAGAGTGG - Intronic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
938180631 2:129179088-129179110 CAGGATGACCAGCTTCAGAGGGG - Intergenic
940396247 2:153195931-153195953 TGGGATGATCAGATGCAGAGAGG - Intergenic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
940612174 2:156006254-156006276 TGGGACAACCAGCTGCAGAGAGG - Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
942598661 2:177618277-177618299 CTGGTGGAGCAGCTGCTGAGTGG - Exonic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943426968 2:187749729-187749751 CAGGATGACCAGATGTGGAGAGG - Intergenic
943426975 2:187749800-187749822 CAGGACAAACAGCTGCAGAGAGG - Intergenic
943526307 2:189021053-189021075 CAGGACAACCAACTGCAGAGAGG + Intergenic
943820368 2:192314454-192314476 CGGGAAGAACAGCTGGAGAGAGG - Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944335463 2:198528533-198528555 CTGAATGACCTGCAGCAGACTGG + Intronic
944483855 2:200182669-200182691 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
944483861 2:200182735-200182757 CGGTACTACCAGCTGCAGAGAGG + Intergenic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
945330092 2:208529633-208529655 TGGAATGACCAGCTACAGAGAGG - Intronic
945330099 2:208529701-208529723 CAGGATGACTAGCTTCAAAGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946197412 2:218043391-218043413 TGGGATGAACAGCTGCAGAAAGG - Intronic
946197422 2:218043503-218043525 TGGGTTGACCAGCTGCAGAGAGG - Intronic
946197432 2:218043571-218043593 GGGGATGACCAGTTGCAGAAAGG - Intronic
946414911 2:219535098-219535120 GTGGCCCACCAGCTGCAGAGAGG - Intronic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947316719 2:228866690-228866712 TGGGACAACCAGCTGCAGAGAGG + Intronic
947327241 2:228992322-228992344 TGGGATGATCAGCTACAGAGAGG - Intronic
948449623 2:238061027-238061049 CTGGATGCCCGGCAGCAGTGGGG + Exonic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948575368 2:238946522-238946544 ATGGATGACTAGCTGCAAAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
948923844 2:241081576-241081598 CTTGATGACCTGATGCAGGGTGG - Intronic
1169224550 20:3847794-3847816 GTGTATGACCAGTTGCAGTGAGG + Intronic
1170319576 20:15080179-15080201 CTGGAAGAGTAGCTGAAGAGGGG - Intronic
1170495046 20:16915732-16915754 CTGGACAACCAGCTACAGAGAGG + Intergenic
1171055758 20:21904645-21904667 CTTGAAGGACAGCTGCAGAGTGG + Intergenic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1171242316 20:23581838-23581860 CTGATTGGCCATCTGCAGAGAGG + Intergenic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1172940966 20:38654413-38654435 CTGGATGACAGGATGCAGTGTGG + Intergenic
1173269252 20:41516962-41516984 CTGGATGACCTGGCTCAGAGGGG + Intronic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1173884535 20:46445804-46445826 TAGGATGACCAACAGCAGAGAGG - Intergenic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175959884 20:62630672-62630694 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1176408436 21:6434443-6434465 TGGGATGACCACCTGCAGACAGG + Intergenic
1176408452 21:6434535-6434557 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1176790113 21:13310710-13310732 GCAGATAACCAGCTGCAGAGAGG - Intergenic
1176976528 21:15327309-15327331 CAGGACAACAAGCTGCAGAGAGG + Intergenic
1176976543 21:15327434-15327456 TGGGATGATCAGCTGCAGAGAGG + Intergenic
1177357804 21:20031551-20031573 CGGGACAACCAGCTGCTGAGAGG - Intergenic
1177396067 21:20537985-20538007 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1177989293 21:28018912-28018934 GCAGATAACCAGCTGCAGAGAGG - Intergenic
1178244423 21:30936896-30936918 CGGGATGACCAATGGCAGAGAGG + Intergenic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1178640339 21:34340203-34340225 CTGGAACACCATCTGCAGTGTGG + Intergenic
1178801719 21:35801589-35801611 CTGGTTGGCCACCTGCTGAGAGG - Intronic
1178915641 21:36704429-36704451 CTGGATCCCCAGCTGCAGCCTGG - Intronic
1179683929 21:43042769-43042791 TGGGATGACCACCTGCAGACAGG + Intergenic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1179720277 21:43312545-43312567 CAGGAAGCCCAGCTCCAGAGTGG - Intergenic
1179818142 21:43921210-43921232 CTGACTGACCAGCTACAGGGTGG - Intronic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1180178914 21:46109277-46109299 TGGCACGACCAGCTGCAGAGAGG - Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182667625 22:31971011-31971033 CAGGATGACCAGCTGCACTGGGG - Intergenic
1183533857 22:38383261-38383283 CAGGCTGACCACCTGCACAGTGG - Intronic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184069349 22:42138422-42138444 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184279673 22:43429834-43429856 GTGGAGGACCAGCTGCACTGTGG + Intronic
1184560872 22:45262338-45262360 TCGGATGACCAGCTGTAGTGAGG - Intergenic
1184613632 22:45622671-45622693 CAGGATGACCAGTTACAGAGAGG + Intergenic
1184826666 22:46957183-46957205 CTGTATGCCCAGGTGAAGAGGGG - Intronic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
1185334978 22:50267378-50267400 CTGGTTTACCAGCTGCTGCGCGG - Exonic
949218531 3:1600966-1600988 CGGGACAACCAGCTGCAGAATGG - Intergenic
949507101 3:4738516-4738538 CGGGATGACCAGGTGCACAAAGG + Intronic
949508545 3:4748787-4748809 CTCGGTTATCAGCTGCAGAGCGG + Intronic
950272448 3:11628995-11629017 CTTAATGACCAACTACAGAGAGG + Intronic
950433315 3:12964144-12964166 CTGCATGAGCTGCTGCAGAGAGG - Intronic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951136205 3:19107182-19107204 CAGGATGACCACCTGTAGAGAGG - Intergenic
951182250 3:19672142-19672164 GGGGACAACCAGCTGCAGAGAGG - Intergenic
951562414 3:23981992-23982014 AGGGATGGCCAGCTGTAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
952016154 3:28959286-28959308 CAGGATGTCCAACTGCAGAGAGG + Intergenic
952016162 3:28959340-28959362 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
952269336 3:31816959-31816981 TGGGATGATGAGCTGCAGAGTGG - Intronic
952793372 3:37217822-37217844 TGGGACGACTAGCTGCAGAGAGG + Intergenic
953054228 3:39374962-39374984 CTGGATGTCGTGCTGCAGAGAGG + Intergenic
953930915 3:47005296-47005318 CTGCACGTCCAGCTGCAAAGTGG + Exonic
954035687 3:47849798-47849820 CCGGAGGAGCAGCTGCAGAGCGG - Intronic
954099334 3:48357515-48357537 CAGGATGACTAGCTGCAGATTGG - Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954498065 3:50983484-50983506 TGGGATGACCAGTTGCAGAGAGG + Intronic
954650864 3:52162091-52162113 TGGGATGATCAGCTACAGAGAGG - Intergenic
954737052 3:52715255-52715277 TGGGACGGCCAGCTGCAGAGAGG + Intronic
955241490 3:57182578-57182600 AGGAATGACCAGCTGCAGAGAGG - Intergenic
955678499 3:61475129-61475151 CTTGCTGACCAGCTGCAGGAGGG + Intergenic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956462280 3:69484744-69484766 TGAGAGGACCAGCTGCAGAGAGG - Intronic
956592102 3:70925804-70925826 ATGGGTGTCCAGATGCAGAGAGG + Intergenic
956805738 3:72809205-72809227 GTGGGTGACCAGCGGCAGGGAGG - Intronic
957625868 3:82651093-82651115 CGGGACTACCAGCTGCAGAAAGG + Intergenic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957845142 3:85722068-85722090 CAGGAAGACGAGCTGCAGAAAGG - Intronic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959444985 3:106427773-106427795 CTGGAAGTCCAGAGGCAGAGTGG - Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
959991632 3:112638326-112638348 CTGGAGGACGAGCTGCAGGTGGG - Exonic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
960690624 3:120342406-120342428 TGGGGTGACCAGCTGCAGAGAGG + Intronic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
961932318 3:130547280-130547302 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
961942942 3:130656443-130656465 CCAGTTGACCAGCTGCAGAGAGG - Intronic
962105214 3:132382784-132382806 TGGGGTGACCAGCTGCAGAAAGG - Intergenic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
963454232 3:145523006-145523028 TGTGATGACAAGCTGCAGAGAGG - Intergenic
963483378 3:145904447-145904469 CAGAATGACCGACTGCAGAGAGG + Intergenic
963483390 3:145904517-145904539 TGGGATAACCAGCTGTAGAGAGG + Intergenic
963583336 3:147154226-147154248 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
963805187 3:149714920-149714942 GGTGATGACCAGCTGCAGAGAGG + Intronic
963805195 3:149714957-149714979 TGGGAGGACTAGCTGCAGAGAGG + Intronic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964523599 3:157593543-157593565 TTGGATGAAACGCTGCAGAGTGG + Intronic
965309863 3:167115424-167115446 GGGGAGGACAAGCTGCAGAGAGG - Intergenic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966256133 3:177918061-177918083 CTGGACCAGCAGCTACAGAGAGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966491518 3:180532310-180532332 CAGGACAACCAGCTGTAGAGAGG + Intergenic
966840179 3:184081713-184081735 CAGAATGACCGGCTGCAGAGAGG + Intergenic
966840189 3:184081781-184081803 CAGGACGACCAGCTGCATAGAGG + Intergenic
967444805 3:189554704-189554726 GAGGATGGCCAGCTGTAGAGAGG - Intergenic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
968044447 3:195616197-195616219 CTGGATGCCCAGAAGCACAGTGG - Intergenic
968060237 3:195722248-195722270 CTGGATGCCCAGAAGCACAGTGG - Intronic
968067501 3:195766835-195766857 CTGGTTGACCAGCTGCTGACCGG - Intronic
968131655 3:196195908-196195930 CTGCATCACCAGCGGTAGAGAGG + Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
971714074 4:30153332-30153354 AGGGAAGAACAGCTGCAGAGAGG - Intergenic
971876810 4:32318717-32318739 CAGGAATACCAGCTGCAGAAAGG - Intergenic
971938779 4:33188547-33188569 TGGGATGACTAGCTGCAGAGAGG - Intergenic
972072596 4:35039181-35039203 CCGGACGACCAGCTGCAGAAAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972358244 4:38303029-38303051 CAGGACAACCCGCTGCAGAGAGG - Intergenic
972931029 4:44071908-44071930 TGGGAAGACCAGCTGCAGAGAGG - Intergenic
973045386 4:45530596-45530618 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
974972976 4:68853897-68853919 CGGGACAACAAGCTGCAGAGAGG - Intergenic
974972983 4:68853963-68853985 CAATATGACCAGCTGCAGAGAGG - Intergenic
974974665 4:68875207-68875229 CTGGATGACCAGAGGCTAAGTGG + Intergenic
975253795 4:72211902-72211924 TTTGAAGACCAGCTGCAGAGAGG - Intergenic
975254329 4:72216111-72216133 CAAGATGACCAGCTGCAGGGAGG - Intergenic
975321365 4:73012334-73012356 AGGGATGACCAACTGCAGAGAGG + Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
975913700 4:79298030-79298052 TGGGAAGAGCAGCTGCAGAGAGG + Intronic
976255572 4:83097140-83097162 TTGGATGACCGGCTTCAGGGTGG - Intronic
976390716 4:84501323-84501345 CTGGAGGGCCAGGCGCAGAGTGG - Intergenic
976734487 4:88296333-88296355 TAGGACGACCAGCTGCAGACAGG - Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976775997 4:88706794-88706816 CTGGATGACAATCTGCAGACTGG - Exonic
976815814 4:89148062-89148084 TGGGACAACCAGCTGCAGAGAGG - Intergenic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977471882 4:97452626-97452648 CAAGATGACCAACAGCAGAGAGG + Intronic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978219705 4:106256030-106256052 ATGGATGGCCAGCTGTAGAGAGG - Intronic
978229865 4:106385594-106385616 TGGGATAACCAGCTGCAGAGAGG - Intergenic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
978466256 4:109012617-109012639 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
978514611 4:109557544-109557566 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
978546819 4:109879431-109879453 CTGGTTCACCAGCTGCACTGAGG - Intergenic
978663402 4:111154468-111154490 CAAGACTACCAGCTGCAGAGAGG - Intergenic
979145397 4:117240119-117240141 CTGGAAGACCAGCTGCTGAGAGG + Intergenic
979145405 4:117240172-117240194 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
979417557 4:120461545-120461567 CTGGCAGACCTGCAGCAGAGGGG + Intergenic
979448179 4:120839492-120839514 TGGAATGACCAGCTGCAGAGAGG - Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979678613 4:123435590-123435612 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
980007624 4:127559582-127559604 TGGGGTGACCAGCTGCAGAGAGG + Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980306239 4:131064787-131064809 TGGGATGATCAGCTGCAGAGAGG - Intergenic
980701967 4:136442761-136442783 TCAGATGACCAGCAGCAGAGAGG + Intergenic
980750050 4:137076888-137076910 TAGGCTGACCAGCTGAAGAGAGG - Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982392279 4:154877615-154877637 CTGCAGAACCAGCTGCTGAGAGG + Intergenic
982435817 4:155383037-155383059 CTGCCTGAACAGCTGCAGAGAGG - Intergenic
982545239 4:156724860-156724882 TGGGATGACCAGCTGTGGAGAGG + Intergenic
983491929 4:168398795-168398817 CAGGATTACCAGCTACGGAGGGG + Intronic
983651497 4:170040727-170040749 TGGGACCACCAGCTGCAGAGAGG + Intergenic
983715457 4:170776469-170776491 CCTGATGACCAGCTGTGGAGAGG + Intergenic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
984325235 4:178242244-178242266 CAAGATGACCATTTGCAGAGAGG + Intergenic
984591062 4:181618308-181618330 CTGAATGAAGTGCTGCAGAGCGG - Intergenic
985799586 5:1995795-1995817 CTAGACCCCCAGCTGCAGAGAGG + Intergenic
987467974 5:18295348-18295370 CCATGTGACCAGCTGCAGAGAGG - Intergenic
987614798 5:20259726-20259748 GTGGATGTTCAGCTGCACAGAGG + Intronic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
987999627 5:25331340-25331362 TGGGATGACCAGCTGCAGAAAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988143056 5:27267418-27267440 CCAGGTCACCAGCTGCAGAGGGG - Intergenic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
989279149 5:39621717-39621739 TGGGATGGCCAGCTGCAGAGAGG - Intergenic
989520696 5:42396773-42396795 CGGGATGACCAGCTACAGAGAGG + Intergenic
989730426 5:44641610-44641632 CAGGAAGACCTGCTGCAGAAAGG - Intergenic
990023769 5:51160188-51160210 CAGGAGGACCAGCTAGAGAGAGG + Intergenic
990923441 5:60993634-60993656 TGGGATGACCACCCGCAGAGAGG - Intronic
990923450 5:60993702-60993724 CGGGGTGATCAGCTGCAGAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
992547227 5:77825112-77825134 CTGCATGTCCTGCTGCTGAGAGG - Intronic
992748479 5:79841134-79841156 CAGGAAGACCAGTTGCATAGTGG + Intergenic
993203670 5:84849556-84849578 CCGCGTGACCAGTTGCAGAGAGG + Intergenic
993703314 5:91143473-91143495 AGGGACGACCAGCTGCGGAGAGG - Intronic
994063510 5:95508403-95508425 TGGAATGACCAGCTGGAGAGTGG - Intronic
994449922 5:99929317-99929339 TGGGATGACCAGCCGCAGAGGGG - Intergenic
994641030 5:102410241-102410263 GGGGATGACCAGTTGCAGAGAGG - Intronic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
994648305 5:102497463-102497485 CCAGATAGCCAGCTGCAGAGAGG - Intronic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995744941 5:115393532-115393554 CAGGACGACCAGCTGCAGATAGG - Intergenic
995744952 5:115393602-115393624 TGGGACCACCAGCTGCAGAGAGG - Intergenic
995744959 5:115393668-115393690 TGGAATTACCAGCTGCAGAGAGG - Intergenic
996234419 5:121108591-121108613 CCGGCGGACCAGCAGCAGAGAGG - Intergenic
996747092 5:126854748-126854770 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
996923808 5:128799827-128799849 CAGGACAACCAGCTGCACAGAGG - Intronic
997457909 5:134031097-134031119 CTGGATGACCACCTGGTGTGGGG + Intergenic
997812641 5:136987076-136987098 CTGGATGACCATCTCCAGGGAGG + Intronic
998792307 5:145778243-145778265 TAGGATTATCAGCTGCAGAGGGG + Intronic
999799383 5:155019393-155019415 GGGGACAACCAGCTGCAGAGCGG - Intergenic
999859951 5:155634040-155634062 TGGGATGACCAGCCGCAGAGAGG + Intergenic
999859966 5:155634152-155634174 TGGGATGAACAGTTGCAGAGAGG + Intergenic
999875507 5:155801291-155801313 GTGGAAGACCAGATGCAGAGGGG - Intergenic
1000426229 5:161093897-161093919 TGGGATGGCCAGCAGCAGAGAGG + Intergenic
1000426238 5:161093977-161093999 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1000847836 5:166303855-166303877 CTGACTGACCAGCTGCAAACTGG + Intergenic
1001936386 5:175708814-175708836 CTTGATGACAAGCACCAGAGAGG - Intergenic
1002072385 5:176688001-176688023 TGGGATGACTAGCAGCAGAGAGG - Intergenic
1002689074 5:181037709-181037731 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1002986247 6:2192043-2192065 TGAGATGACCAGATGCAGAGAGG + Intronic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004304541 6:14487972-14487994 CAGGAAGACCAGCTACAGGGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005021433 6:21423172-21423194 AAGGATGACTAGCTGCAGAGAGG - Intergenic
1005043451 6:21620309-21620331 TAGGATGACCAGCTACAGAGAGG - Intergenic
1005433422 6:25782473-25782495 ATGAATGAACAGCTCCAGAGTGG + Intergenic
1005775871 6:29130209-29130231 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006669361 6:35720125-35720147 CCGGAAGACCAGCTGCAGCTGGG - Intronic
1006753781 6:36396785-36396807 TGGAATGATCAGCTGCAGAGAGG + Intronic
1006867578 6:37221978-37222000 TGGGAGGACCAGCTACAGAGAGG - Intronic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1007197527 6:40075513-40075535 CAGGAAGACCAACTGCAGATGGG + Intergenic
1007649978 6:43413228-43413250 CCAGGTGACCAGCAGCAGAGAGG + Intergenic
1008188289 6:48422764-48422786 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1009196751 6:60695573-60695595 CCTGATGACCAGCTGCAGAAAGG + Intergenic
1009530177 6:64803311-64803333 CTGGATGACCAGCTGTGGAAAGG - Intronic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009846878 6:69145845-69145867 CGGGATGAACAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052234 6:94361092-94361114 ACGAATGACCAGCTGTAGAGAGG - Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012141987 6:95636276-95636298 CAGGTCAACCAGCTGCAGAGAGG - Intergenic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013086340 6:106861148-106861170 CAGGTTGACCAGCTGCAGAAAGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013234594 6:108186211-108186233 CTTCATGACCACCTGCAGATAGG - Intronic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1013375564 6:109510374-109510396 CAGGACGACCAACTGCAGAGAGG + Intronic
1013693099 6:112668209-112668231 TAGGATGACCAGTTGCAGATAGG + Intergenic
1013693130 6:112668350-112668372 TGGGATGACCAGTTACAGAGAGG + Intergenic
1013836748 6:114343003-114343025 CCTGGCGACCAGCTGCAGAGTGG + Exonic
1013941531 6:115668861-115668883 CTGGCTGGTCAGCTGCAGATAGG + Intergenic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1014289307 6:119539897-119539919 TGGGATGACCAACTACAGAGAGG + Intergenic
1014289317 6:119539977-119539999 CTGGACTACCAACTGCAGAGAGG + Intergenic
1015143326 6:129959007-129959029 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1015143336 6:129959077-129959099 CAGAATGACCAGCTGCAGATGGG + Intergenic
1015407893 6:132857692-132857714 GTGGCTGACCAGGTCCAGAGAGG - Intergenic
1015549095 6:134393437-134393459 CAGGAGGGCCAGCTGCAAAGGGG + Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1016502461 6:144736935-144736957 CAGGATGACCAGCAGCTGCGTGG - Intronic
1016758831 6:147715846-147715868 ATGGATGACCAGCTGTGGAGAGG - Intronic
1017740959 6:157406225-157406247 CTGGAGGACCGGGTGCTGAGAGG + Intronic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018568580 6:165183806-165183828 CTGGATCACCCTCTGTAGAGGGG - Intergenic
1018659933 6:166076640-166076662 GGGAATGACCAGCTGCAGAGAGG - Intergenic
1019897904 7:3997595-3997617 CAGGAGGACCAGCTGTAAAGAGG - Intronic
1020041804 7:5009247-5009269 CTGGAGGACCATCTTCAGAGAGG - Intronic
1020463581 7:8451052-8451074 CTGGATGAACATCTGCACTGTGG + Intronic
1020649299 7:10855189-10855211 AGGGATGACCAGGGGCAGAGAGG + Intergenic
1020761265 7:12270052-12270074 GGAGATGACCAACTGCAGAGAGG + Intergenic
1020812415 7:12863848-12863870 CAGGATAACCAGCAGCATAGAGG - Intergenic
1020812425 7:12863918-12863940 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1021021113 7:15599795-15599817 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1021540358 7:21750711-21750733 CAGGATGACCAGCTCCAGTGAGG - Intronic
1021561366 7:21971899-21971921 TGGGATGACCAGCTACAGAGAGG - Intergenic
1022423406 7:30245787-30245809 CCAGACAACCAGCTGCAGAGAGG - Intergenic
1023789159 7:43737931-43737953 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1023790412 7:43749533-43749555 CAGGACGATCAGCTGCAGAGAGG - Intergenic
1024038950 7:45534538-45534560 GTGCAGGACCAACTGCAGAGTGG + Intergenic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1026846920 7:73703780-73703802 CTGGAGGACATGCTGGAGAGTGG - Exonic
1027128375 7:75573194-75573216 TGGGACGACCAGCTACAGAGAGG + Intronic
1027128382 7:75573259-75573281 TAGGATAATCAGCTGCAGAGAGG + Intronic
1027779814 7:82507467-82507489 CAAGATGACCAGCAACAGAGAGG - Intergenic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1028816858 7:95156755-95156777 CGAGACTACCAGCTGCAGAGTGG - Intronic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1029973736 7:104814228-104814250 TGGGACAACCAGCTGCAGAGAGG - Intronic
1030514027 7:110519198-110519220 TCAGATGACCAGCTGCAGAGAGG - Intergenic
1030538312 7:110796299-110796321 CTGGATGCCAAGCTTCAGAGAGG + Intronic
1031243316 7:119273006-119273028 CAAATTGACCAGCTGCAGAGTGG - Intergenic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031786608 7:126041069-126041091 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1031786618 7:126041139-126041161 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1031836498 7:126686113-126686135 TGGGATGACCAAATGCAGAGAGG + Intronic
1032322009 7:130894329-130894351 CTGGAGGACCACCTGCTGCGTGG + Intergenic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1032858580 7:135857820-135857842 ATGGATAGCCAGCTGCCGAGAGG - Intergenic
1033291938 7:140092864-140092886 CTTTATGACCAGCTACAGTGAGG + Intronic
1034170201 7:149056912-149056934 CCGCATGACCAGCTGCAAAAAGG + Intergenic
1034210377 7:149358015-149358037 CGGGACAACCAGCTGCAGAAGGG - Intergenic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034447034 7:151119008-151119030 CTGGAATACCAGCTGCAGCCAGG - Intronic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034481251 7:151321581-151321603 TGGGATGACCAGCTGCAAAGAGG + Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1034787881 7:153942051-153942073 CTGGATGAGCTGCTCCAGTGTGG + Intronic
1034796513 7:154018421-154018443 CTGGGAGACTAGTTGCAGAGTGG - Intronic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1036228826 8:6982583-6982605 ATGGAGGGCCAGCTGCAAAGTGG + Intergenic
1036231278 8:7001693-7001715 ATGGAGGGCCAGCTGCAAAGTGG + Intronic
1036706200 8:11048932-11048954 CTGGCTGCCCAGGTGCACAGTGG + Intronic
1036813668 8:11885603-11885625 CTGGAAGAGCCTCTGCAGAGAGG - Intergenic
1037766635 8:21776199-21776221 CTGGGTGACCACATGCAGTGGGG - Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037890055 8:22619318-22619340 CTGGATCTCCAGCTGCAGGGGGG - Exonic
1037985706 8:23289276-23289298 CTGGCTGAGCAGCTGCAGCTAGG - Intronic
1038149351 8:24928404-24928426 CAGGACAACCAGCTGCAAAGAGG + Intergenic
1039182293 8:34880328-34880350 TGGGTTGACCAGCTGCAGAGAGG - Intergenic
1039372925 8:37004859-37004881 CTTGATGACCTGGTGCAGATGGG - Intergenic
1040003698 8:42600286-42600308 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1040661886 8:49583484-49583506 TGGGAGGACCAGCTACAGAGAGG + Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1040965572 8:53077847-53077869 CTGGACCAGCAGCTGCATAGGGG - Intergenic
1041260481 8:56017152-56017174 CTGGATGTCCAGGTGCTGAGCGG + Intergenic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1042196806 8:66238118-66238140 CCAGATGACCAGTAGCAGAGGGG - Intergenic
1042687834 8:71461924-71461946 TGGGACAACCAGCTGCAGAGAGG - Intronic
1043087146 8:75849332-75849354 CAGGATGACCAGGTACAGAGAGG - Intergenic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043745594 8:83869785-83869807 TGGGATGACCAGCTGCAGTGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044962379 8:97543151-97543173 CAGGTGGACCAGCTGCAGAGAGG + Intergenic
1046260321 8:111758975-111758997 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1046459705 8:114517982-114518004 GGGGATGACCGGTTGCAGAGAGG - Intergenic
1047215609 8:122873497-122873519 CTGGTTGAGCAGCATCAGAGCGG + Intronic
1048421670 8:134283884-134283906 TGGGATGATCAGCTTCAGAGAGG - Intergenic
1048421680 8:134283954-134283976 CAGAATGATCAACTGCAGAGAGG - Intergenic
1049021784 8:139961960-139961982 TGGGACAACCAGCTGCAGAGAGG + Intronic
1049294569 8:141824887-141824909 CAGGATGGCCGGCCGCAGAGCGG - Intergenic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1049695746 8:143983606-143983628 GTGGAGGGCCAGCTGCAGAGCGG + Exonic
1049824024 8:144655335-144655357 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1049824044 8:144655471-144655493 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1049898054 9:129147-129169 CTGGTTGGCCTGCTGCAGGGAGG + Intronic
1050130518 9:2407002-2407024 CAAGATGACCAACAGCAGAGAGG + Intergenic
1050130526 9:2407082-2407104 CGGGACTACCAGCTGCAGAAAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050483998 9:6114773-6114795 CAGGATGACTGGTTGCAGAGAGG + Intergenic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1051001777 9:12290838-12290860 AGAGATGATCAGCTGCAGAGAGG + Intergenic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052652358 9:31321212-31321234 CAGGATGACCAGTTGTAGAGAGG - Intergenic
1052654215 9:31334889-31334911 CAGGATGACTGGCTGCAGAAAGG - Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1053019877 9:34687449-34687471 CTGGATCTCCGGGTGCAGAGTGG + Intergenic
1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1053128216 9:35599719-35599741 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1053150390 9:35739473-35739495 CTAGAGGACAAGCTACAGAGGGG - Intronic
1053440201 9:38109719-38109741 CTGGAGGACAGGCTGAAGAGAGG + Intergenic
1053480149 9:38410595-38410617 CTGGAGGAACAGCTCCAGTGTGG - Intronic
1053741132 9:41139445-41139467 CTGGTTGGCCTGCTGCAGGGAGG + Intronic
1054346342 9:63968934-63968956 CTGGTTGGCCTGCTGCAGGGAGG + Intergenic
1054444118 9:65295584-65295606 CTGGTTGGCCTGCTGCAGGGAGG + Intergenic
1054486154 9:65725921-65725943 CTGGTTGGCCTGCTGCAGGGAGG - Intronic
1054687217 9:68291852-68291874 CTGGTTGGCCTGCTGCAGGGAGG - Intronic
1055887126 9:81076639-81076661 CAGGCTGAACAGCTGCAGAAGGG - Intergenic
1056192011 9:84194286-84194308 CAGGACCACCAGCTACAGAGAGG - Intergenic
1056879716 9:90379665-90379687 CAGGATGACATGCTGCAGGGGGG - Intergenic
1056986137 9:91364782-91364804 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1056986154 9:91364918-91364940 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057531222 9:95847928-95847950 CCGGAAGACCAGTTGCAGAGAGG + Intergenic
1058037520 9:100269210-100269232 ATGGATGAACAGCTCCAGAGAGG - Intronic
1058091950 9:100814564-100814586 TGGGAAGACCAGCTGTAGAGAGG + Intergenic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1058091970 9:100814700-100814722 CAGGCTGATCAGCTACAGAGAGG + Intergenic
1058510804 9:105713948-105713970 GGGGATGACCAGCTGCAGGGAGG + Intronic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1058546435 9:106065203-106065225 CTGGATTATAAGCTGCAGATGGG - Intergenic
1059566359 9:115386073-115386095 GGAGATGACCAGCTGCAGAGAGG + Intronic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1061709648 9:132478844-132478866 ATGAATGACAAGCTGCAGAGCGG - Intronic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1062449428 9:136609321-136609343 CTGGAGGGGCAGCTGCAGGGAGG - Intergenic
1186805870 X:13139600-13139622 CAGGATGACCAGCTGCATAGAGG + Intergenic
1188756539 X:33969561-33969583 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1188756553 X:33969653-33969675 ATGGCCGACCAGCTTCAGAGAGG + Intergenic
1188848308 X:35101361-35101383 CTGGATTACAAGCTCCACAGGGG - Intergenic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189083608 X:37997940-37997962 TGGGACCACCAGCTGCAGAGAGG + Intronic
1189360220 X:40344123-40344145 CAGGAGGATCAGCTGCAGAGAGG + Intergenic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190444835 X:50514461-50514483 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1190444843 X:50514513-50514535 TGGGATGACCAGATGCAGAGAGG - Intergenic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190620659 X:52284422-52284444 CAGGACGACCAGTTGCAGAGGGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1190998859 X:55637836-55637858 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1191221273 X:57990296-57990318 TGGAATGATCAGCTGCAGAGAGG + Intergenic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1193108395 X:77704002-77704024 CGGGATAATCAGCTGCTGAGAGG - Intronic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467612 X:81867960-81867982 TAGGATGATCAGCAGCAGAGAGG - Intergenic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1193554176 X:82932789-82932811 TGGGATGACCAGCTGTGGAGAGG + Intergenic
1193919338 X:87406721-87406743 TGAGAGGACCAGCTGCAGAGAGG - Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195126550 X:101814149-101814171 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1195173000 X:102286852-102286874 ATGGCTGACCAGATGCAGACAGG - Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195178527 X:102334101-102334123 TGGGACGACCAGCTGCGGAGAGG - Intergenic
1195179045 X:102339338-102339360 CAGGCTGAACAGCTGCAGAGAGG - Intergenic
1195180337 X:102352982-102353004 TGGGACGACCAGCTGCGGAGAGG + Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195185866 X:102400243-102400265 ATGGCTGACCAGATGCAGACAGG + Intronic
1195454240 X:105050906-105050928 CTGGATGACCAGCTGCACAAAGG - Intronic
1195579134 X:106481935-106481957 CTGGAAGACCTCCTGCAGTGAGG - Intergenic
1195890928 X:109694374-109694396 CTGGTTCACAAGCTGCTGAGTGG + Intronic
1196460101 X:115920742-115920764 CTGGAGGATCAGCTGCTTAGTGG - Intergenic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1197378446 X:125710117-125710139 ATGGATGACCAGCTGTGGAGAGG + Intergenic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1197501217 X:127244325-127244347 CAGGATGATGAGCTGCAGAAAGG - Intergenic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1198699439 X:139381995-139382017 GGGGATGACCAGCTACAGAGAGG - Intergenic
1198699450 X:139382068-139382090 GGGGATGACCAGCTGTAGAGAGG - Intergenic
1199103826 X:143838132-143838154 CAGGACAACCACCTGCAGAGAGG + Intergenic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199614812 X:149647974-149647996 CGGGACAACCAGCTTCAGAGAGG + Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1200955319 Y:8938473-8938495 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1201935381 Y:19406314-19406336 CCACATGACCAGCTGCAGAGAGG - Intergenic
1201939760 Y:19447284-19447306 CAGGAAGAATAGCTGCAGAGTGG - Intergenic
1202593588 Y:26512746-26512768 CAGGCTGACCACCTGCACAGTGG + Intergenic