ID: 946200796

View in Genome Browser
Species Human (GRCh38)
Location 2:218069701-218069723
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 2, 1: 0, 2: 2, 3: 43, 4: 463}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946200796_946200809 20 Left 946200796 2:218069701-218069723 CCCTCCACTGTGTCCCACTGCTG 0: 2
1: 0
2: 2
3: 43
4: 463
Right 946200809 2:218069744-218069766 AAACTCCAACAGCCACAGCCCGG 0: 1
1: 1
2: 3
3: 42
4: 494
946200796_946200810 21 Left 946200796 2:218069701-218069723 CCCTCCACTGTGTCCCACTGCTG 0: 2
1: 0
2: 2
3: 43
4: 463
Right 946200810 2:218069745-218069767 AACTCCAACAGCCACAGCCCGGG 0: 1
1: 1
2: 4
3: 34
4: 321
946200796_946200811 24 Left 946200796 2:218069701-218069723 CCCTCCACTGTGTCCCACTGCTG 0: 2
1: 0
2: 2
3: 43
4: 463
Right 946200811 2:218069748-218069770 TCCAACAGCCACAGCCCGGGAGG 0: 1
1: 1
2: 0
3: 12
4: 160
946200796_946200813 28 Left 946200796 2:218069701-218069723 CCCTCCACTGTGTCCCACTGCTG 0: 2
1: 0
2: 2
3: 43
4: 463
Right 946200813 2:218069752-218069774 ACAGCCACAGCCCGGGAGGCAGG 0: 1
1: 1
2: 4
3: 43
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946200796 Original CRISPR CAGCAGTGGGACACAGTGGA GGG (reversed) Intronic
900712829 1:4125251-4125273 CAGCTGGGTGACACTGTGGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904248227 1:29203376-29203398 GAACAGTGAGAAACAGTGGAAGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905493383 1:38362881-38362903 CATGAGAGGGACCCAGTGGAAGG - Intergenic
905986756 1:42292005-42292027 CAGGAGTGGGAGCCAGGGGATGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907246745 1:53113829-53113851 CATCAGTGTGACACAGCAGAAGG - Intronic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910666162 1:89727827-89727849 CAGCAGTGGGAAACTGGGGAAGG + Intronic
911152539 1:94609221-94609243 CAGCTCTGAGACACAGTGGGAGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913565896 1:120071598-120071620 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
913632237 1:120721955-120721977 CGGCAGTGGAAGACAGTGGAGGG + Intergenic
913646290 1:120858336-120858358 CAGCAGTGGGACATGATGAATGG + Intergenic
913990895 1:143610669-143610691 CAGGAGTGAGCCACAGTGCATGG + Intergenic
913991872 1:143620544-143620566 AAGCTGTGGGAAGCAGTGGAGGG - Intergenic
914004139 1:143717778-143717800 CCGCACTGGGACACAGAGCAGGG + Intergenic
914080355 1:144404544-144404566 CAGCAGTGGGACATGATGAACGG - Intergenic
914175262 1:145273068-145273090 CAGCAGTGGGACATGATGAACGG - Intergenic
914286482 1:146230962-146230984 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
914529988 1:148514551-148514573 CAGCAGTGGGACATGATGAACGG - Intergenic
914547513 1:148681704-148681726 CGGCAGTGGAAGACAGTGGAGGG - Intergenic
914618999 1:149388649-149388671 CGGCAGTGGAAGACAGTGGAGGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915259889 1:154669831-154669853 CAGAAGTGAGACACAGTGCATGG - Intergenic
916689790 1:167179334-167179356 AACCAGTGGAACACAGTAGAAGG + Intergenic
916961606 1:169894630-169894652 CAAGGGTGGGACAGAGTGGATGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917760473 1:178151728-178151750 CAGCAATAGAATACAGTGGATGG + Intronic
918685757 1:187413143-187413165 TAGCAGAGGGACACAGTATATGG - Intergenic
919774800 1:201187499-201187521 CAGCTGGGGGGCAGAGTGGATGG + Intergenic
919866751 1:201788460-201788482 CCGCAGTGGGACTCACTGGAAGG - Exonic
920285413 1:204875330-204875352 GACCAGTGGAAAACAGTGGAAGG - Intronic
921326492 1:213989635-213989657 CAGGAGGGGGACGCAGTGGGCGG + Intronic
921412198 1:214847792-214847814 CAGCACTGGCACGCAGTGAATGG + Intergenic
921463796 1:215461433-215461455 TTGCTGTGGGACACAGTGGTTGG - Intergenic
921960557 1:221029289-221029311 CAGTACTGATACACAGTGGATGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923447048 1:234081508-234081530 CAGCAGTGGGTCACTGTGGATGG + Intronic
923459345 1:234195160-234195182 AAGAAATGGGAGACAGTGGAAGG - Intronic
923790309 1:237106027-237106049 CAGGACTGGGGCACAGTGGTGGG + Intronic
923904605 1:238369906-238369928 CATGAGAGGGACCCAGTGGAAGG - Intergenic
924021882 1:239792058-239792080 CAGCAATGAGACACACTGCAGGG - Intronic
924025206 1:239825051-239825073 CAGCACTGGGTTACAGTGGTGGG + Intronic
924078915 1:240371846-240371868 CAGATGTGTCACACAGTGGAGGG + Intronic
1062790526 10:301436-301458 CTGCAGCGGGTCACAGTGGGTGG + Intronic
1062961949 10:1578928-1578950 CTGGGGTGGGACACAGAGGAAGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064288221 10:14011303-14011325 CAGGAGTTGGGCACAGGGGACGG + Intronic
1064615709 10:17153273-17153295 CAGTAGTGGGTCACAGAGGTTGG - Intronic
1065414643 10:25471146-25471168 GAACAGTTGGACACAGGGGAGGG - Intronic
1065683182 10:28258184-28258206 CAGGAGTGTGACGAAGTGGAAGG - Intronic
1065861077 10:29872860-29872882 CAGGAGGGGGACACTGTGTAAGG - Intergenic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1071353617 10:84770985-84771007 CAGCAAGGGGACACTGTGGTTGG + Intergenic
1071686202 10:87760360-87760382 CAGGAGTGGGAGAGAGTGAAGGG - Intronic
1071790527 10:88949046-88949068 TAGCACTAGGACACAGAGGAGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074618773 10:115095064-115095086 AAGCAATGGGTCACAGTGTAGGG + Intronic
1074851412 10:117442389-117442411 CAGCAGGGGGACACAGTGTCTGG - Intergenic
1075002467 10:118808698-118808720 CAGCAGAGGGGCAGGGTGGAGGG - Intergenic
1075650982 10:124128261-124128283 CAGCAGTGGGACCCTGGGGGAGG + Intergenic
1075882122 10:125861761-125861783 CAGCAAAGGGAAATAGTGGATGG - Intronic
1077674636 11:4185385-4185407 AAGCAGGGGAATACAGTGGAGGG + Intergenic
1077863588 11:6204565-6204587 GAGCAGTGTGACAATGTGGAGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078450801 11:11439256-11439278 CAGAAGTGGGGCAAAGAGGATGG + Intronic
1078757868 11:14228424-14228446 CAGCTGTGGGAGGCAGGGGAAGG + Intronic
1079131841 11:17751370-17751392 CAGCTGGGTGACTCAGTGGATGG + Intronic
1080773473 11:35364012-35364034 CAGCAATGGAAAACAGTGCAGGG - Intronic
1081557159 11:44175451-44175473 AAGCAGGGGCACACAGAGGAAGG - Intronic
1081881100 11:46453091-46453113 CAGGAGTGGGACAGAGTAAAAGG - Intronic
1083554209 11:63613538-63613560 CAGCAGAGGGATTCAGAGGATGG - Intronic
1085009396 11:73127419-73127441 CAGCAGTGGGACAAAGGACAGGG + Intronic
1085263976 11:75225466-75225488 CAGCTGCAGGACACAGTGGGGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085844334 11:80048513-80048535 TAGCTGTGGGAGACAGGGGATGG + Intergenic
1086051536 11:82597458-82597480 CAGTAATGGGAGAGAGTGGAAGG + Intergenic
1087240290 11:95767497-95767519 AAGCAGAGGGAATCAGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088061955 11:105664348-105664370 CAGCAGTAGGACAGAGTAGCTGG + Intronic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088652902 11:111974147-111974169 CAGCAGTGGCACAGTGTGGTCGG - Exonic
1088816764 11:113426581-113426603 CAGCAATGGGTCAGAGAGGATGG + Intronic
1089077725 11:115751792-115751814 CAGCAGTGGAACACAGAAAACGG - Intergenic
1089110365 11:116051027-116051049 CAGCAGTGGGATATGGTGTATGG - Intergenic
1089353822 11:117837047-117837069 CAGCAATGGGTCACAGCGCACGG + Exonic
1089602618 11:119624721-119624743 CAGCAGTGGAACATATTGGGTGG - Intronic
1090570359 11:128038226-128038248 CAGCAGAGGGGCTCTGTGGAAGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091420813 12:338508-338530 CAGCAAAGGGAAACAGTGCATGG - Intronic
1091530490 12:1350273-1350295 CAGCACTGAGACACAGTGGTGGG + Intronic
1091697231 12:2636086-2636108 CAGCCGTGGGAGACACTGCAGGG + Intronic
1091796869 12:3302341-3302363 CAGCAGGGGGACTGGGTGGAAGG + Intergenic
1091854077 12:3724838-3724860 TAGCAGTGGGAACCAGTGAAGGG - Intronic
1092165031 12:6337161-6337183 CAGCAGTGGTGCCCAGTGGTGGG - Intronic
1092382501 12:8009023-8009045 GAGAGGTGGGACACAGTGGCAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093548893 12:20383422-20383444 CAGCTGTGGCCCTCAGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096104537 12:48989170-48989192 CAACAGTGGGATACAGGGAAGGG - Intergenic
1096180266 12:49546778-49546800 AAGCAGCAGGACACAGGGGAGGG - Intronic
1097197070 12:57248846-57248868 CAGCAGTGGTACAAAGGGAAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098811410 12:75098479-75098501 CAGGAGTGAGACACAGTGCCTGG - Intronic
1099394534 12:82121354-82121376 CAGCAGTGGGACAGGGAGAAGGG - Intergenic
1099544222 12:83956133-83956155 CAGAGGAGGGACCCAGTGGAAGG - Intergenic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1100594255 12:96058258-96058280 CAGCTGCAGGACTCAGTGGAAGG + Intergenic
1100793318 12:98154029-98154051 CTGCAGTTTGACACATTGGAGGG - Intergenic
1101929968 12:109005917-109005939 GACCAGTGGGACACCATGGAAGG + Intronic
1102145060 12:110648906-110648928 CAGCTGGGGCACACAGAGGAGGG + Exonic
1103221188 12:119247095-119247117 CAGCAGTGGGCCAGAGTCAAGGG - Intergenic
1103559419 12:121785183-121785205 CAGCAGGGATACACAGAGGAAGG + Intronic
1103844460 12:123891836-123891858 CAGCAGAGGGAAAAAGTGCATGG + Intronic
1104188456 12:126455057-126455079 GAGCAGTGGGGCTCAGGGGAGGG - Intergenic
1104437762 12:128769365-128769387 GACCAGTGGGGTACAGTGGAAGG - Intergenic
1104962684 12:132495688-132495710 CAGCTGTGGGACTCTGTGGGAGG - Intronic
1105633458 13:22194758-22194780 CAGGAGAGGGACCCTGTGGAAGG - Intergenic
1105710358 13:23002196-23002218 CAGAAGTGTGACAGTGTGGAAGG - Intergenic
1106068250 13:26380051-26380073 GAGCAGTGGGATGCAGGGGAAGG + Intronic
1106172434 13:27299520-27299542 GAGCAATGGGACCCAGTGGGAGG - Intergenic
1107316494 13:39138094-39138116 CAGCAATTGGATACAGTGGTTGG - Intergenic
1107799066 13:44087197-44087219 GAGCAGTGGGACACAGAGAGAGG + Intergenic
1107939179 13:45369347-45369369 CAGAGGTGGGAGACAGTGCAAGG - Intergenic
1108484110 13:50907583-50907605 CAGCAGTTTGACACAGTGATTGG - Intergenic
1112527051 13:100159828-100159850 CAGCAGTTAGACACGGTGGGTGG - Intronic
1113610559 13:111642094-111642116 CAGCGGTGGGGTTCAGTGGAAGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113869634 13:113551257-113551279 CAGCACAGGGACACAGTGATAGG - Intronic
1114182558 14:20378516-20378538 CAGCTGTGGGACACAGTCCGTGG - Exonic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114804606 14:25820518-25820540 CATCAGTGGGACTCAGAGGCTGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118294154 14:64553668-64553690 TAGCAGTGGGAGACAGTATAAGG + Intronic
1119962409 14:78874676-78874698 AAGCAGTGGCACAGAGTGAATGG - Intronic
1120788783 14:88560620-88560642 CTGCACTGGGATACAGTGGTAGG - Intergenic
1121608245 14:95257009-95257031 CAGGAGGGGGACACAGAGGAGGG + Intronic
1121928074 14:97947429-97947451 CAGCAATGGGGAACAGGGGATGG - Intronic
1122536321 14:102466022-102466044 CAGCAGTGGGGCAGGGGGGATGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1124700002 15:31904428-31904450 CTGCAGAGAGGCACAGTGGAGGG - Intergenic
1124841229 15:33244006-33244028 CTGCAGTGGATCAAAGTGGAGGG - Intergenic
1125533256 15:40427835-40427857 CACCAGTGGCCCAGAGTGGAAGG + Intronic
1125921836 15:43529573-43529595 CAGGAGTGGGACAGAGGGGAAGG + Intronic
1125990340 15:44100655-44100677 CATCAATGAGACACAGTGCAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126847073 15:52770163-52770185 CTGCAGTGGGAGAGACTGGAAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127995169 15:64149752-64149774 GTGCAGTGGGAAACATTGGAAGG + Intergenic
1128926142 15:71658058-71658080 CAGGAGAGGGACTCACTGGACGG + Intronic
1129701074 15:77769015-77769037 CAGCAGTGGGAGCCATTGAAGGG - Intronic
1130048331 15:80463244-80463266 CATGTGTGGGACACACTGGATGG + Intronic
1130800817 15:87261725-87261747 CAGCAATGGAACAAACTGGATGG - Intergenic
1130906467 15:88244072-88244094 CAGCAGTGACACCCAGTGGCTGG - Intronic
1132407126 15:101550010-101550032 AAGCAGTGGGGGACAGTGAAAGG + Intergenic
1133318585 16:4899121-4899143 CTGCAGTGGGGGGCAGTGGAGGG + Intronic
1133352541 16:5111310-5111332 CAGCAACGAGACAGAGTGGAGGG - Intergenic
1133693274 16:8236573-8236595 CATGAGAGGGACCCAGTGGACGG - Intergenic
1134628357 16:15739077-15739099 CAGCAGTGGGGGATAGAGGAAGG - Intronic
1135249852 16:20891733-20891755 GAGCACAGGGACACAGTGGCTGG - Intronic
1135668432 16:24354860-24354882 CAGCAGCGTGACACTGAGGATGG - Exonic
1136006452 16:27333491-27333513 CAGCTGTGGGACCTGGTGGATGG + Intronic
1136074700 16:27808939-27808961 CATCAGTGGGACGCAGGTGAAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136682838 16:31977984-31978006 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1136705255 16:32182575-32182597 AAGCATTGGGACTCAATGGATGG - Intergenic
1136762658 16:32746832-32746854 AAGCATTGGGACTCAATGGATGG + Intergenic
1136783476 16:32921550-32921572 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1136805442 16:33123554-33123576 AAGCATTGGGACTCAATGGATGG - Intergenic
1136886312 16:33932299-33932321 CAAAACTGGGAGACAGTGGAGGG - Intergenic
1138023192 16:53502998-53503020 CCGCAGTGGGACACGGAGGCGGG - Intronic
1138471601 16:57242678-57242700 GATCAGTGGAACACAGTGGAAGG + Intergenic
1139268014 16:65657700-65657722 CAGCAGTGCGGCAAAGTGAATGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140040822 16:71406510-71406532 GAGCCCTGGGACAAAGTGGAGGG - Intergenic
1140586200 16:76295160-76295182 GAGCAGTGGGAGTCAGTGAAAGG + Intronic
1141132088 16:81444189-81444211 CCGCAGTGGGAGACAGGGCAGGG + Intergenic
1142054174 16:87982240-87982262 CAACAGTGGGACAAGGAGGAAGG - Intronic
1203064814 16_KI270728v1_random:1007151-1007173 AAGCATTGGGACTCAATGGATGG + Intergenic
1203086126 16_KI270728v1_random:1185534-1185556 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143366593 17:6412771-6412793 CAGATCTGGGGCACAGTGGACGG + Intronic
1143575133 17:7787902-7787924 CCGCAGCGGGATACAGTGGCCGG - Exonic
1143982868 17:10885051-10885073 CAGCTGTGGGGCACAGCGGCAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146245188 17:31275318-31275340 CAGCACTGTGACACAGTGCTAGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146501414 17:33368150-33368172 GATCAATGGGATACAGTGGAAGG + Intronic
1146529047 17:33592250-33592272 CAGCACTGGGACACAGAGCAGGG - Intronic
1146629718 17:34461015-34461037 CAGCAGTGTGACACAGCAGCAGG - Intergenic
1146768155 17:35542714-35542736 CAGCTGTGAGCCACAGTGGTCGG + Intergenic
1147143748 17:38473743-38473765 CAAAACTGGGAGACAGTGGAGGG + Intronic
1147213658 17:38886676-38886698 GAGCAGAGGGACACAGTGTGGGG + Intronic
1147453033 17:40518037-40518059 CAGCAGTGAGCCACAGTGCCCGG + Intergenic
1147671722 17:42180515-42180537 CAGAAGTGGGGCAAAGTGGCCGG - Intronic
1147927968 17:43956817-43956839 GAGCAGTGCCACACAGTGCATGG - Intronic
1148137742 17:45305831-45305853 AAGCAGAGGGACAGAGTGGTCGG + Intronic
1149370087 17:55985355-55985377 CATGGGAGGGACACAGTGGAAGG - Intergenic
1150244583 17:63664821-63664843 CAGAAGTGGGAAAAAGAGGAAGG - Intronic
1150245661 17:63672998-63673020 CAACAGAGGAACCCAGTGGAAGG - Intronic
1150661195 17:67081162-67081184 GGACAGTGGGACACAGTAGAAGG + Intronic
1151195680 17:72429858-72429880 GAGCAGTGGGACACTGGAGAGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152309826 17:79543372-79543394 CATCAGTGGTGCACAGTGAAAGG + Intergenic
1152471019 17:80490055-80490077 GAGAAGATGGACACAGTGGAGGG + Intergenic
1153057306 18:958854-958876 CAGCAGTGGGTGACAGATGATGG + Intergenic
1154396406 18:13994153-13994175 CAGCAAAGTGACACAGTAGATGG + Intergenic
1155119124 18:22800446-22800468 CAGTTGTGGGAAACAGTGAAAGG + Intronic
1156498317 18:37540585-37540607 CAGCAGTGGGGCAGGGAGGAGGG + Intronic
1157978510 18:52353434-52353456 CAGACTTGGGACACAGAGGAGGG - Intronic
1158652853 18:59303170-59303192 CAGCAGTGGGGCACAGCAGAAGG - Intronic
1159714404 18:71804079-71804101 CAGCAGTGAGAAAGAGGGGAAGG + Intergenic
1161052483 19:2171751-2171773 CCTCAGGGGGACACAGTGGGCGG - Intronic
1162121944 19:8476036-8476058 GAGCCGTGTGACACAGTCGATGG + Intronic
1162575118 19:11494891-11494913 CAGGAGTGGCACACAGTGAGGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1163781380 19:19250825-19250847 CAGGAGTGGGACCCAGGGCAGGG - Exonic
1164579561 19:29426087-29426109 CTGAAGTGGGACACAGTGGGAGG + Intergenic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1165040068 19:33062852-33062874 CCGCACTGGGAAAGAGTGGATGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166167622 19:41003369-41003391 CCGGGGTGGGACAGAGTGGATGG + Intronic
1167247622 19:48383242-48383264 CAGCAGCGGGAGGCAGAGGAAGG - Exonic
1167830059 19:52012130-52012152 CAGGAGTAAGACAGAGTGGAGGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168129912 19:54311628-54311650 CAGCCGTGAGCCACACTGGAGGG + Exonic
1168169154 19:54574797-54574819 CACCTGTGAGACACACTGGAGGG - Exonic
1168171935 19:54595166-54595188 CACCTGTGAGACACAATGGAGGG - Exonic
925317835 2:2939036-2939058 CAGGGGTGGGACACAGGGGACGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925731390 2:6921712-6921734 GAGCAGTGGGACCCACAGGAGGG + Intronic
927430062 2:23019955-23019977 CTGCAGTGGGAAATAGTGGTGGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928361021 2:30662485-30662507 CAGCAGCTGCACACAGTGGTAGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929440703 2:41964145-41964167 CAGCAGTGGCAACAAGTGGAAGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931695228 2:64865867-64865889 CAACAGTGGGACACTTTGGGAGG + Intergenic
932412205 2:71554161-71554183 GTGCAGTGGGACACAGAGCAAGG + Intronic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934474982 2:94587745-94587767 CAGCAGTGGACCACAGGGGGAGG + Intergenic
934527235 2:95059453-95059475 CAGCAGGGGCTCACAGGGGAGGG - Intergenic
934729796 2:96649409-96649431 GAGCAATGGGTTACAGTGGAGGG - Intergenic
934972143 2:98772480-98772502 CACCACAGGGACACAATGGATGG + Intergenic
935071094 2:99694380-99694402 GAGCAGTAGGCCACAGTGGCAGG + Intronic
935133753 2:100280447-100280469 CAGCAGCGGCATTCAGTGGAAGG - Exonic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
938344470 2:130557275-130557297 CAGCACTGGGCCTCAGCGGAAGG + Intergenic
938345363 2:130563447-130563469 CAGCACTGGGCCTCAGCGGAAGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938552297 2:132393508-132393530 CAGAGGGGGGACACAGTGGAAGG - Intergenic
938552311 2:132393573-132393595 CAGAGGTGGGACACAGTGGAAGG - Intergenic
938590268 2:132729079-132729101 CTACAGTGGGACAGAGTGGCAGG - Intronic
938620536 2:133048076-133048098 CCACAGTGAGACACTGTGGAAGG - Intronic
938962868 2:136358786-136358808 CAGCAGTGGGCCTCGGGGGAGGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945223543 2:207508595-207508617 CAGCAGAGCAACAAAGTGGAAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
947926777 2:233928289-233928311 CAGCAGGAGGTCACAGTGGCAGG - Intronic
1168898717 20:1341910-1341932 CAGCAGTGAGACACTGGGAAGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169188642 20:3642526-3642548 CAGAGATGGGACACAGTGGCTGG - Intronic
1169200466 20:3706719-3706741 CGGCAGGGGGACAGAGGGGAGGG + Intronic
1169256868 20:4106307-4106329 CTGCAGTGGGGCAGAGGGGATGG + Intergenic
1169945247 20:10981155-10981177 CAGAAGTGGCAGACTGTGGAAGG + Intergenic
1170144265 20:13155312-13155334 CAGCAATGGGTTACATTGGAGGG - Intronic
1172245468 20:33442929-33442951 CACCAGTGGGACAGGGAGGAGGG - Intronic
1172290839 20:33775611-33775633 GGGAAGTGGGTCACAGTGGATGG - Intronic
1172565998 20:35930924-35930946 GAGCAGTAGGAGGCAGTGGAAGG + Intronic
1172937019 20:38627745-38627767 CAACATAGGGACATAGTGGAAGG - Intronic
1174489625 20:50883743-50883765 CAGCAGTAGGAGTGAGTGGAGGG + Intergenic
1175273999 20:57754949-57754971 CAGCAGTGGGTCTCACTGGGAGG + Intergenic
1177538956 21:22466532-22466554 CAGCTCTGGGCGACAGTGGAAGG + Intergenic
1178098539 21:29241068-29241090 CAGCAGTGGGACACAGGACAAGG - Intronic
1178296389 21:31413813-31413835 CAGCACTGGAACCCTGTGGAAGG - Intronic
1179098722 21:38337887-38337909 CAGCAGTGGGCCTCTGTGGGAGG - Intergenic
1179771327 21:43619862-43619884 CAGCAGATGCACACAGTAGAAGG + Intronic
1179900796 21:44392791-44392813 CAGCAGTGGGGCTCAGGGCAGGG - Intronic
1180109143 21:45639868-45639890 CAGCTGTGGGGCACAGGGCAAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181652984 22:24271120-24271142 CAGGCGCGGGACACACTGGAGGG - Intronic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182477093 22:30582237-30582259 CAGAGGTGGGACTCAGTGGGCGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183158674 22:36095356-36095378 CGGCAGTGGGCCTCACTGGAGGG - Intergenic
1183352611 22:37342561-37342583 CAGCAGTGGGACCCAGGAGTGGG - Intergenic
1183523498 22:38310243-38310265 CATGAGTCAGACACAGTGGAGGG + Intronic
1183574049 22:38675757-38675779 CAGCACAGTGACACAGTGGAAGG + Intergenic
1183653551 22:39172262-39172284 CTGCAGTGGGAGATGGTGGATGG + Intergenic
1184161502 22:42700053-42700075 CCGCAGTGGGTCACTGGGGATGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184988630 22:48153049-48153071 CTGCCGTGGCACACAGAGGATGG + Intergenic
1185039359 22:48496562-48496584 CAGCTGTGGGGGACAGAGGAGGG + Intronic
950151115 3:10688309-10688331 CAGCAGAGGGCCCCAGTGGTGGG + Intronic
953383836 3:42493519-42493541 CTGCAGTGGGGGACAGAGGAGGG + Intronic
953675088 3:44994816-44994838 CAGCAGTCAGACAGAGAGGAAGG - Intronic
954387213 3:50250435-50250457 CAGAATTGGGACACTGTGAATGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954675930 3:52315420-52315442 CAGCAAGGAGACACAGGGGAGGG + Intergenic
955064891 3:55525751-55525773 AGGCAGTGGGACACCATGGAAGG + Intronic
957661117 3:83155026-83155048 CAGAAGTGGGACCTGGTGGAAGG - Intergenic
958084555 3:88789731-88789753 GAGCAGAGGGACACAGGGGATGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
960622294 3:119648443-119648465 CAGCAGTGGGACCCAGGACATGG + Exonic
960675461 3:120190274-120190296 CATCAGTGAGACAGAATGGAGGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961456006 3:127024343-127024365 TGGCAGTGGGGCACTGTGGAGGG + Intronic
961554681 3:127689836-127689858 CAGCAGGGGGACATGGTGGGCGG + Exonic
961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG + Intronic
962895443 3:139709845-139709867 CAGGAAAGGGACTCAGTGGATGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966168329 3:177047717-177047739 CATTAGTGTCACACAGTGGAAGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967671297 3:192238456-192238478 CAGCAGGGGGAGACAATGGGTGG + Intronic
967704074 3:192629994-192630016 CAGAAGTGGGGCCCAGTGGGAGG + Intronic
968453097 4:684252-684274 CAGCTGTGGGACGGAGCGGAGGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968927940 4:3559837-3559859 CAGCAGGTGGACAGAGGGGATGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970708222 4:18831047-18831069 AAGCAGTGGGCCACAGAGTATGG + Intergenic
971296753 4:25400624-25400646 CAGGAGTGGGGCACAGAGCAGGG + Intronic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
972260361 4:37401867-37401889 CTGCACTGGAACACAGAGGAAGG - Intronic
972645459 4:40963748-40963770 CATCAGTGGGACCAAGTGCATGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974463366 4:62220021-62220043 TAGCACTGGGACAAAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
977997727 4:103515128-103515150 CTGCAGTGGGGCACAGTAAAGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
981449926 4:144885164-144885186 CAGCAGTGGGGCAGGGTGGGGGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982202393 4:152973454-152973476 CAGCTGTGGGAGGCAGTGGTGGG + Intronic
982233145 4:153227658-153227680 CAGCTATTGGACACAATGGAGGG + Intronic
982335844 4:154236704-154236726 CAGCTGTGGAACTCAATGGAGGG + Exonic
983079351 4:163366078-163366100 CAAGGGAGGGACACAGTGGAAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984368342 4:178828106-178828128 CATGAGTGGTACACAGTGGAGGG - Intergenic
984475917 4:180234884-180234906 CAGCTGTGGGACAAGGAGGAAGG - Intergenic
984637766 4:182131722-182131744 TAGCAGTAGATCACAGTGGAAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985926613 5:3024360-3024382 GGGCACTGGGACACAGTGGGTGG - Intergenic
986594500 5:9407179-9407201 CAGCAGTGGTCCTCAATGGAAGG - Intronic
986669820 5:10132817-10132839 AAGCAGTGGGACACTGGCGAGGG - Intergenic
988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG + Intergenic
989513656 5:42317507-42317529 CAGCAGTGGCTCATAGTGGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989976506 5:50593837-50593859 CAGCAGTGGGACATGATGTACGG + Intergenic
990578683 5:57148258-57148280 TAGCAGTGGGACTCAGTGGGAGG + Intergenic
991275665 5:64843897-64843919 CAGCAGTGGGAGGCAGGGCATGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992000127 5:72428206-72428228 CAGCCTAGGGACACAGAGGAGGG + Intergenic
992033725 5:72750120-72750142 AAGCAGTGATACACAGAGGATGG + Intergenic
995456060 5:112353599-112353621 CAGCAGTGGTACACATGGCAGGG + Intronic
995659524 5:114465333-114465355 CAGGCGTGGGACACAGTGCCAGG - Intronic
996101449 5:119449656-119449678 ACGCAGTGGGACCCAGTGAATGG - Intergenic
997627134 5:135338758-135338780 CAGCTGTAGGACAGAGTGGCTGG - Intronic
998046200 5:138989051-138989073 TAGCAAAGGGACACGGTGGAAGG + Intronic
998561167 5:143173101-143173123 ATGCAGTGGGACCCAGGGGAGGG + Intronic
998955324 5:147432468-147432490 CTGCCCTGGGTCACAGTGGATGG + Intronic
999997817 5:157108945-157108967 CAGCAGCAGGACACAGTCAAAGG + Exonic
1000047285 5:157532143-157532165 CAGCCATGAGACACAGTGGCTGG - Intronic
1002599587 5:180346619-180346641 CAGGAGTGGGACCCAGAGGGCGG - Intronic
1002987006 6:2200244-2200266 CAGCAGTGTAAGAGAGTGGAAGG + Intronic
1003260265 6:4510462-4510484 CAGCAGTGGAACACTGGGGCTGG - Intergenic
1003520485 6:6854411-6854433 CAGCAGTGAGGAAAAGTGGAAGG + Intergenic
1004264139 6:14134265-14134287 GAGCAGTGAGGCACAGTGGGAGG + Intronic
1005031110 6:21510047-21510069 CAGCAGTGAGACACTGTGTAAGG - Intergenic
1006295573 6:33168629-33168651 CAGGAGTGGGGCACAGAAGAGGG + Intronic
1006987037 6:38182700-38182722 CAGCAATGGGACACATCTGAGGG + Intronic
1006998469 6:38285240-38285262 ATGCAGTGGGACACAGAAGAGGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1012924148 6:105250796-105250818 CAGCAGAGGGAAAAAGTGCATGG + Intergenic
1013403550 6:109821735-109821757 CAGCAGTTGGACCCAGAGGGTGG - Intronic
1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1014547539 6:122750662-122750684 CAGCAGTGGGGCCCAGGGGAGGG - Intergenic
1014942489 6:127459222-127459244 TAGCAGTGGAAGAAAGTGGATGG + Exonic
1015251164 6:131129640-131129662 CAGTAGTCAGACACAGTTGAAGG - Intergenic
1017027169 6:150191520-150191542 CAGCAGTGTGACAGAGGGCAAGG + Intronic
1017243960 6:152201776-152201798 CAGCAGAGGCACACAGGTGACGG + Intronic
1017769182 6:157631903-157631925 GAGTAGTGGGACACAGTGTGTGG - Intronic
1018080967 6:160259065-160259087 CTGCGGTGGGACACAGAGGGCGG - Intronic
1018622362 6:165742787-165742809 CAGCAGTGGGACGTAGGGGGTGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019779260 7:2929937-2929959 CTGCAGGGGGAGACAATGGAGGG + Intronic
1020469237 7:8517173-8517195 CAGCAGTGAGCAACAGTGGCGGG + Intronic
1021271700 7:18595844-18595866 CAACAGTGGGACACAAAGTATGG - Intronic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022238051 7:28481198-28481220 GAGCAGTGGGCCTCATTGGAAGG + Intronic
1022511312 7:30936647-30936669 CAGGAGTGGGAAACAGTGGCCGG - Intergenic
1022704104 7:32787156-32787178 CAGCAGTGGGGGTCAGTGGGTGG + Intergenic
1023295088 7:38706761-38706783 CAGTAGTGGGTTACAGAGGAGGG + Intergenic
1023682797 7:42704924-42704946 CAGCCTTGTGGCACAGTGGACGG - Intergenic
1023705845 7:42941196-42941218 CAGCAGAGGAACACAGGGGCAGG - Intronic
1024928304 7:54641563-54641585 CACCAGTGGGAGGCATTGGAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029610615 7:101624744-101624766 CAGCTCTGGGACAGAGTAGAGGG - Intronic
1031232995 7:119134356-119134378 CAGGAGTGAGACACAGAGGTGGG + Intergenic
1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1032283054 7:130521483-130521505 CAGGAGTGACACACAGTGTATGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034870969 7:154683644-154683666 AGGCAGTGGAAAACAGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035304495 7:157922946-157922968 CAGTGGTAGGAGACAGTGGAAGG - Intronic
1035315393 7:157994474-157994496 GAGCTGTGGGCCAAAGTGGAAGG - Intronic
1035622875 8:1047661-1047683 ACACAGTGGGACACAGTGGGAGG - Intergenic
1036602727 8:10277091-10277113 CAGCAGTGGATTATAGTGGAAGG + Intronic
1036659380 8:10698090-10698112 CCTCAGTGGCACACAGGGGAGGG + Intronic
1037487495 8:19362460-19362482 CAGGAGTGAGACACAGTGCCTGG - Intronic
1037914821 8:22766632-22766654 GAGCTGTGGGAGCCAGTGGAGGG + Intronic
1037931383 8:22882381-22882403 CAGCAGGGGGTCCCAGTTGAAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041449075 8:57988518-57988540 CAGCTGTTGGACCCAGTGAAGGG - Intergenic
1041790651 8:61693038-61693060 CAGCAATGAGGCACAGTGGAGGG - Intronic
1042176950 8:66046391-66046413 CTGCAGCTGGACACAGTGCAAGG + Intronic
1043278374 8:78430877-78430899 CAGTAGAGAGACACGGTGGATGG + Intergenic
1043823560 8:84898120-84898142 AAGCAGTGGAACTCAGAGGATGG + Intronic
1044953727 8:97458461-97458483 CAGCACTGGCACTCAGTGTAAGG - Intergenic
1044972419 8:97632987-97633009 CAGAAGTGGGATAAAGTGGAGGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046504185 8:115115839-115115861 AAGCAGTGACACCCAGTGGATGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048166328 8:132064789-132064811 GAGAAGTGAGAAACAGTGGAGGG + Intronic
1048438407 8:134439642-134439664 CAGAAATGGAATACAGTGGAAGG + Intergenic
1048438410 8:134439666-134439688 CAGAAATGGAATACAGTGGAAGG + Intergenic
1048438473 8:134440174-134440196 CAGAAATGGAACACAGTGGAAGG + Intergenic
1049103544 8:140597156-140597178 CAGAGCTGGGACACAGTGCAGGG - Intronic
1049815709 8:144598340-144598362 CAGCTGTGGGTGTCAGTGGAGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050727952 9:8674036-8674058 CAGCAATGTGACACAGTGAAGGG - Intronic
1051266019 9:15308973-15308995 CAGCACTGGGAGACTGAGGAAGG + Intergenic
1051991875 9:23161682-23161704 CAGCAGTGGAACTGGGTGGATGG - Intergenic
1052374681 9:27705773-27705795 CAGCAGCAGGCCAAAGTGGAAGG - Intergenic
1053119749 9:35537864-35537886 GAGCAGTGGCACAAAGTGGACGG + Intronic
1053442888 9:38130392-38130414 CAGTAGTTGGGCACAGTGGTGGG + Intergenic
1053802798 9:41774918-41774940 CAGCAGGTGGACAGAGGGGATGG + Intergenic
1053933070 9:43126672-43126694 CAGCAGTGGACCACAGCGGGAGG - Intergenic
1054142445 9:61540152-61540174 CAGCAGGTGGACAGAGGGGATGG - Intergenic
1054191103 9:61986264-61986286 CAGCAGGTGGACAGAGGGGATGG + Intergenic
1054647266 9:67601453-67601475 CAGCAGGTGGACAGAGGGGATGG - Intergenic
1054805642 9:69393782-69393804 CAGGAGTGGGACAAAGTGGTTGG - Intergenic
1056378771 9:86038520-86038542 CCCCAGTGGGACAAAGTGGCTGG - Intronic
1057176564 9:93004557-93004579 CAGCAGTGGGACAGAGGGACAGG - Intronic
1057262032 9:93590403-93590425 CAGGAGTGGGAGAGAGTGGAAGG - Intronic
1057352931 9:94315705-94315727 CTGCTGTGGGACACAGTGCAAGG - Intergenic
1057654815 9:96941886-96941908 CTGCTGTGGGACACAGTGCAAGG + Intronic
1059084693 9:111287599-111287621 CAGGAGTGAGCCACAGTGGCTGG - Intergenic
1059178912 9:112193355-112193377 CACCAGGGGAGCACAGTGGAAGG - Intergenic
1059306158 9:113354831-113354853 CAGCAGTGGGATGCAGCAGAAGG - Intronic
1059716939 9:116921855-116921877 CAAGAGAGGGACCCAGTGGAAGG - Intronic
1059989110 9:119847929-119847951 GAGCAGTGGGACACATTTGATGG - Intergenic
1060758477 9:126229231-126229253 CAGCAATGGCACACAGTAGCAGG - Intergenic
1061378932 9:130242770-130242792 CAGCAGTAGCACACACAGGAAGG + Intergenic
1203773714 EBV:61635-61657 CAGCAGTCGGAAAAAGTGCAGGG + Intergenic
1186643626 X:11483059-11483081 CACCAGAGGAACACAGTCGAAGG + Intronic
1186871775 X:13781047-13781069 CAGCAGTGGGAGGAAGTGGGAGG - Intronic
1188170139 X:26914175-26914197 CAGCAATGGGAAACAGGGCAGGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189627629 X:42916020-42916042 TAGAAGTGGGGCCCAGTGGAAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190131193 X:47750360-47750382 CACCTGTGGGAAAGAGTGGAAGG + Intergenic
1193482632 X:82046187-82046209 CAGAGGTGGGACACAGTAGTGGG - Intergenic
1195394146 X:104392979-104393001 CAGGATAGGGACACAGAGGAGGG + Intergenic
1196985207 X:121261794-121261816 GAGCAGCGGCACACAGTGGTGGG + Intergenic
1198108943 X:133485615-133485637 CAGGGGTGGGACACAGTAGAAGG + Intergenic
1198219828 X:134589056-134589078 CACCAGTGGGAGAAACTGGAGGG - Intronic
1198617165 X:138471583-138471605 CAGCAGTGTGATATACTGGAGGG + Intergenic
1198766372 X:140083749-140083771 CAGAAGTCGGAAGCAGTGGAGGG - Intergenic
1199684927 X:150257443-150257465 CAACAGTGGGAAGCAATGGAAGG - Intergenic
1200182606 X:154159913-154159935 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200188260 X:154197027-154197049 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200193910 X:154234167-154234189 CAGCTTCGGGAGACAGTGGATGG - Intergenic
1200199665 X:154271971-154271993 CAGCTTCGGGAGACAGTGGATGG - Intronic
1200243295 X:154508752-154508774 CACCAGTAGGACACAGAGTATGG - Intronic
1200739271 Y:6835460-6835482 AGGAAGTGGGACACAGTGAAAGG + Intergenic
1200986535 Y:9306981-9307003 CAGCAGTGGGATAATGGGGAGGG + Intergenic