ID: 946201648

View in Genome Browser
Species Human (GRCh38)
Location 2:218073996-218074018
Sequence TACAGGACAGACAGAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 8, 3: 82, 4: 404}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946201642_946201648 2 Left 946201642 2:218073971-218073993 CCGAGTGTACAGAGAGCCCTGAC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG 0: 1
1: 1
2: 8
3: 82
4: 404
946201638_946201648 8 Left 946201638 2:218073965-218073987 CCCCCTCCGAGTGTACAGAGAGC 0: 1
1: 0
2: 1
3: 7
4: 82
Right 946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG 0: 1
1: 1
2: 8
3: 82
4: 404
946201641_946201648 5 Left 946201641 2:218073968-218073990 CCTCCGAGTGTACAGAGAGCCCT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG 0: 1
1: 1
2: 8
3: 82
4: 404
946201639_946201648 7 Left 946201639 2:218073966-218073988 CCCCTCCGAGTGTACAGAGAGCC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG 0: 1
1: 1
2: 8
3: 82
4: 404
946201640_946201648 6 Left 946201640 2:218073967-218073989 CCCTCCGAGTGTACAGAGAGCCC 0: 1
1: 0
2: 0
3: 1
4: 81
Right 946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG 0: 1
1: 1
2: 8
3: 82
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946201648 Original CRISPR TACAGGACAGACAGAGCAAG AGG Intronic
900363691 1:2301846-2301868 AACAGGCCACACAGGGCAAGGGG - Intronic
901085055 1:6605808-6605830 TTTAAGGCAGACAGAGCAAGAGG + Intronic
901271740 1:7957304-7957326 AACAGGAATGACAGAGAAAGAGG - Intronic
901871804 1:12142752-12142774 TACAGAAGAGACAGTCCAAGGGG + Exonic
902397124 1:16138439-16138461 CACAGGACAGACAGAGCACAAGG + Intronic
903606190 1:24576636-24576658 TGCAGTCCAGACAGAACAAGTGG + Intronic
904243756 1:29170747-29170769 AAGAGGGCAGACAGAGCAGGAGG - Intronic
904970557 1:34416347-34416369 GTCAAGACAGACAGAGAAAGAGG + Intergenic
905519943 1:38589887-38589909 TCCAGGGCAGACAGAGCAGGAGG + Intergenic
905761280 1:40559920-40559942 TTCAGGCCAGGAAGAGCAAGGGG - Intergenic
905797737 1:40824937-40824959 TTCAGGAGAGACAGTTCAAGGGG - Intronic
906299846 1:44674069-44674091 GACAGGAAAGACAGAAAAAGAGG + Intronic
906529705 1:46516570-46516592 TGCAGGACAGAGAGAGGCAGGGG + Intergenic
907390628 1:54155891-54155913 GGCAGGAGAGAGAGAGCAAGCGG + Intronic
907529215 1:55076582-55076604 CAAGGGACAGACAGATCAAGAGG - Intronic
908795083 1:67823152-67823174 TTCAGGAGATACAGTGCAAGTGG + Intronic
909082247 1:71126686-71126708 CTGAGGACAGACTGAGCAAGGGG - Intergenic
909424235 1:75503428-75503450 TGCAGGAGAGAGAGAGCAAAGGG - Intronic
909579161 1:77213288-77213310 TCCAGGACAGACTGACCATGTGG + Intronic
910096055 1:83523304-83523326 TTCAGGATAGATAGAGTAAGGGG + Intergenic
910332919 1:86096655-86096677 TATAAGACAGAGAGAGAAAGGGG - Intronic
912090714 1:106071899-106071921 TATAGAACAGAAAGAGCTAGGGG - Intergenic
912313124 1:108642882-108642904 GGAAGGACAGACAGAGAAAGAGG - Intronic
912351044 1:109013481-109013503 TACAGAAAAGACAGAGAAAAAGG + Intronic
912691046 1:111804916-111804938 TGCAGGACAGACAGCACAGGAGG + Intronic
913302556 1:117387819-117387841 GAGAGGACACACAGAGAAAGTGG - Intronic
913937499 1:125067531-125067553 AACAGGGGAGGCAGAGCAAGAGG - Intergenic
914942048 1:152031799-152031821 TAGAGGAGAGAGAGAGAAAGAGG - Intergenic
915672583 1:157503006-157503028 TACAGCTCAGAAAGAACAAGAGG + Intergenic
915972012 1:160361807-160361829 AACAAGACTGACAGAGCCAGGGG - Intergenic
916257491 1:162804588-162804610 TAGAGGAGAGACAGAGCAATGGG + Intronic
918558073 1:185829372-185829394 TAGAGGACAGACAGGTCAATAGG - Intronic
919006640 1:191908052-191908074 AGCAGGAGAGAGAGAGCAAGGGG + Intergenic
919524949 1:198635426-198635448 AAAAGGGCAGACAGAGGAAGAGG + Intergenic
919594482 1:199545262-199545284 GACTGGACAGAATGAGCAAGAGG + Intergenic
919960232 1:202459925-202459947 GACAGGACAGAAATGGCAAGTGG + Intronic
920101626 1:203520446-203520468 CACAGGAGAGACAGGGGAAGTGG + Intergenic
920309137 1:205038332-205038354 TAAAGGGCAGACAGAGCAAAAGG + Intergenic
921534457 1:216329054-216329076 TACGGGAAAGTCAGAGCAGGAGG - Intronic
922343299 1:224674783-224674805 TTCAGGAGAGACAGAGCCAGAGG - Intronic
922400637 1:225250677-225250699 CACAGGGCAGACGGAGAAAGGGG + Intronic
922482114 1:225946309-225946331 TCCAGGGAGGACAGAGCAAGCGG - Intergenic
924210829 1:241765428-241765450 TAAAAGACTGGCAGAGCAAGAGG + Intronic
1063339696 10:5251743-5251765 GACAGGACGGACACAGCAATAGG + Intergenic
1063383070 10:5598642-5598664 AACAAGACAGAGAGAACAAGAGG + Intergenic
1065151543 10:22827437-22827459 TGCAGGTCAGAAAGAACAAGAGG - Intergenic
1065414120 10:25466069-25466091 TACAGGACAGAAAAAGGAAAAGG + Intronic
1066723940 10:38370274-38370296 TAGAGGAGAGACAGAGCAATGGG + Intergenic
1071024442 10:81095421-81095443 AACAGGACAGACAGATCATTGGG - Intergenic
1071361550 10:84851280-84851302 TGCAGGAGGGACAGAGCAAGAGG - Intergenic
1072027537 10:91476521-91476543 AACAGGGCAGACAGAGCAAGAGG + Intronic
1072718001 10:97764460-97764482 AACAGGACAGACAGGGGAGGAGG - Intergenic
1074848732 10:117421503-117421525 TATAGGGCCAACAGAGCAAGTGG - Intergenic
1075295537 10:121271904-121271926 TGCAGGACAGACAGGGCCTGCGG + Intergenic
1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG + Intronic
1075892391 10:125964122-125964144 TATATCACAGACAGAGGAAGAGG - Intronic
1076468280 10:130700798-130700820 CACAAGACAGACAGAGCTGGGGG + Intergenic
1076891056 10:133283633-133283655 TGCAGGAGAGGCAGGGCAAGGGG - Intronic
1078037402 11:7821718-7821740 TACTTGACACACAGAGGAAGGGG + Intergenic
1079292450 11:19200528-19200550 AACAGGAGACACAGGGCAAGGGG - Intronic
1080962265 11:37174360-37174382 GGCAGGAGAGAGAGAGCAAGGGG - Intergenic
1082744965 11:56951201-56951223 TAGGGGACAGAAAGATCAAGGGG + Intergenic
1083769204 11:64856918-64856940 TTGAGGACAGACAGGACAAGGGG - Intronic
1084654970 11:70509796-70509818 CACAGGACAGAAAGGGCAAAGGG - Intronic
1085702465 11:78757023-78757045 TGCAGGAGTGACAGAGCATGTGG + Intronic
1085856928 11:80185828-80185850 TATAGGAGAGAGAGAGCAACAGG - Intergenic
1086537508 11:87865789-87865811 TATATGACAGAAAGAGGAAGGGG + Intergenic
1086905524 11:92414000-92414022 TGCAAAACAGACAGAGAAAGTGG - Intronic
1087746478 11:101953526-101953548 TAAAGGACAGGCAAAGAAAGAGG + Intronic
1088003027 11:104905527-104905549 TCCAGGAGAGACAGCACAAGGGG - Intergenic
1089503371 11:118946391-118946413 TAAAGGACAGATACAGCAAGAGG - Intronic
1089727639 11:120496646-120496668 TACAGTGGAAACAGAGCAAGGGG - Intergenic
1091249126 11:134127258-134127280 TTCAAGACAGTCAGAGCAAGTGG - Intronic
1092585863 12:9900251-9900273 TTCAGGTCAGAAAGAACAAGAGG - Intronic
1092640952 12:10508239-10508261 TTCAGGCCAGGAAGAGCAAGGGG - Intronic
1092722154 12:11451916-11451938 GACAGGAGAGAGAGAGCAAAGGG - Intronic
1093676983 12:21953652-21953674 TACAGAACAGAAAGTTCAAGAGG - Intergenic
1095048884 12:37540313-37540335 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1095049711 12:37544908-37544930 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1095049984 12:37546524-37546546 ACCTGGGCAGACAGAGCAAGAGG - Intergenic
1095590747 12:43900818-43900840 TACAGAACAGAGAGAGAGAGAGG + Intronic
1096681164 12:53256183-53256205 AACAGGGCAGAAAGAGGAAGTGG - Intergenic
1097378291 12:58863549-58863571 TACAGGACAAACAGATGAAGTGG - Intergenic
1098668087 12:73190013-73190035 TCAAGGAAACACAGAGCAAGAGG + Intergenic
1099770900 12:87054571-87054593 AAAAGAACAGACAGAGCAAAAGG + Intergenic
1099830259 12:87833127-87833149 GGCAGGAGAGACAGAGCAAAGGG - Intergenic
1100360017 12:93868840-93868862 TACAGGGCTGCCAGAGCAACTGG + Intronic
1101950694 12:109172423-109172445 TACAGGACAGGAGGAGAAAGAGG - Intronic
1102297573 12:111748733-111748755 TACAGGGCAGACGCAGGAAGTGG + Intronic
1102741576 12:115211987-115212009 CACAGGACAGACAGAACCAAAGG - Intergenic
1103851957 12:123939126-123939148 TACAATAGAGACAGAACAAGAGG - Intronic
1104219850 12:126772374-126772396 TATAGGACAGAAAAAGGAAGAGG - Intergenic
1104993885 12:132642285-132642307 TAGGGGACAGCCAGAGCAGGTGG + Exonic
1107043750 13:35974601-35974623 AGCAGGAGAGAGAGAGCAAGAGG - Intronic
1107671947 13:42755047-42755069 CACTGGACAGAGAGAGCAAAAGG + Intergenic
1110836144 13:80085753-80085775 TTCAGGATATACATAGCAAGGGG - Intergenic
1111742831 13:92226096-92226118 GGCAGGAGAGAGAGAGCAAGAGG - Intronic
1111801429 13:92986200-92986222 CACAGGAGAGAGACAGCAAGGGG - Intergenic
1111831746 13:93338908-93338930 GACAGGGCAGAGAGAGCAATTGG + Intronic
1113256136 13:108508205-108508227 TACAAGGCATACAGAGAAAGAGG - Intergenic
1113763891 13:112868908-112868930 TGCAGGAGAGAGAGAGCAAAGGG + Intronic
1114683158 14:24504449-24504471 GACAGGACAGCCAGAGCCTGAGG - Intronic
1114713968 14:24805367-24805389 TAAAGGACAGTCCAAGCAAGGGG - Intergenic
1118728817 14:68652285-68652307 GAAAGGACAGCAAGAGCAAGAGG - Intronic
1118768651 14:68927266-68927288 TCCAGCCCAGACAGAGCAGGTGG - Intronic
1118967468 14:70601007-70601029 TAGAGGACAGAAAGACCGAGTGG + Intergenic
1120469267 14:84902432-84902454 AGCAGGAGAGAGAGAGCAAGGGG - Intergenic
1121118070 14:91357604-91357626 TCCAGGGCAGACAGAACAACAGG + Intronic
1122588180 14:102825638-102825660 CACAGGACGGACAGATCAATGGG + Intronic
1123907699 15:24936667-24936689 AGCAGGAGAGAGAGAGCAAGGGG + Intronic
1124985679 15:34609942-34609964 GACAGGACGGAAAGAGGAAGCGG + Intergenic
1125142004 15:36419161-36419183 TTAAGGATAGACAGAGGAAGAGG + Intergenic
1125708272 15:41762124-41762146 TACAGGTAAGACAGAAGAAGTGG + Exonic
1126734162 15:51714725-51714747 TACAGCACAGAGGGAGAAAGAGG + Intronic
1127550556 15:60033609-60033631 CAGAGGGAAGACAGAGCAAGAGG - Intronic
1128459676 15:67857193-67857215 TAATGCACAGAAAGAGCAAGAGG - Intergenic
1128916437 15:71567016-71567038 TGCAGGACAGATAGAGTAATTGG + Intronic
1129188392 15:73924033-73924055 AACAGGAAAGACAGAGGAAGTGG + Intergenic
1129242226 15:74258474-74258496 AACAGGACAGGCAGGGCAGGTGG + Intronic
1129719104 15:77868182-77868204 TAAAGCACAGACAGAGCCAGGGG + Intergenic
1130086624 15:80783045-80783067 CTCAGGACAGACAGAGCAAATGG + Intronic
1130211544 15:81927381-81927403 TCTAGAACAGACAGACCAAGGGG + Intergenic
1130459831 15:84152690-84152712 TAAAGCACAGACAGAGCCAGGGG - Intergenic
1131072105 15:89472498-89472520 TCCAGGACAGACACAGGAACAGG - Intronic
1131913283 15:97232902-97232924 TACAGACCAGTCAGAACAAGGGG + Intergenic
1132156339 15:99498271-99498293 TAGAGGACAGACAGAGAACCAGG - Intergenic
1134259201 16:12637285-12637307 TACAGCACAGAAAGGGCAGGTGG - Intergenic
1135508137 16:23057520-23057542 TGCAAGACAAACATAGCAAGTGG + Intergenic
1136932649 16:34432891-34432913 AACATGGCAGACAGAGCAAGAGG - Intergenic
1136971923 16:34978923-34978945 AACATGGCAGACAGAGCAAGAGG + Intergenic
1136989215 16:35141904-35141926 AACATGGCAGATAGAGCAAGAGG - Intergenic
1137066856 16:35855729-35855751 TGCAGGACAGACTCAGCAGGGGG + Intergenic
1137336054 16:47550302-47550324 TACAGCAGAGACAGACTAAGAGG - Intronic
1137540306 16:49357137-49357159 TACAGGAGAGAGAGTGAAAGAGG - Intergenic
1137870090 16:51941644-51941666 AACAGGAGCAACAGAGCAAGTGG + Intergenic
1138336398 16:56256897-56256919 TACAGGACGGACACTGCCAGTGG + Intronic
1139088211 16:63614782-63614804 TAAAGGCTAGACAGAGCATGTGG - Intergenic
1139277483 16:65741401-65741423 AAGAGGAGAGACAGAGCAACAGG - Intergenic
1140125169 16:72112431-72112453 TCCAGGCCGGAAAGAGCAAGGGG + Exonic
1140268006 16:73436697-73436719 AACAGCACAGCCAAAGCAAGGGG - Intergenic
1140419540 16:74807321-74807343 CAGAGGACAGAGAGAGGAAGGGG - Intergenic
1141767466 16:86068000-86068022 TGCAGGTCAGGCAGAGAAAGAGG + Intergenic
1143183955 17:4999618-4999640 TAGAGGACAGAGAGAGAAAGAGG - Intronic
1144040756 17:11408972-11408994 TGCAAGACACACAGAGCAAATGG + Intronic
1144335053 17:14261210-14261232 TACCACACACACAGAGCAAGAGG - Intergenic
1144368758 17:14570128-14570150 TGCAGGACACACTGAGCAAGGGG + Intergenic
1144628227 17:16856426-16856448 GAAAAGACAGACGGAGCAAGGGG + Intergenic
1145159819 17:20566993-20567015 GAAAAGACAGACGGAGCAAGGGG + Intergenic
1145248998 17:21287224-21287246 TAGAGGACAGACTGAGGCAGAGG + Intronic
1145306068 17:21675880-21675902 AACTGGGCAGACAGAGCAAGAGG + Intergenic
1145306403 17:21677707-21677729 GCCAGGGGAGACAGAGCAAGAGG + Intergenic
1145308213 17:21687134-21687156 AACAGGGGAGGCAGAGCAAGAGG + Intergenic
1145370324 17:22301994-22302016 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145370600 17:22303610-22303632 AACTGGGCAGACAGAGCAATAGG - Intergenic
1145378768 17:22375674-22375696 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145379244 17:22378044-22378066 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145379722 17:22380414-22380436 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145380201 17:22382789-22382811 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145380681 17:22385136-22385158 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145381159 17:22387511-22387533 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145381642 17:22389864-22389886 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145381761 17:22390557-22390579 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145381895 17:22391286-22391308 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145382368 17:22393650-22393672 AACAGGGGAAACAGAGCAAGAGG - Intergenic
1145383222 17:22397836-22397858 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145383590 17:22399571-22399593 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145384173 17:22402506-22402528 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145385097 17:22406967-22406989 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145385280 17:22408039-22408061 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145385730 17:22410397-22410419 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145386102 17:22412565-22412587 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1145908239 17:28528014-28528036 ACCAGGCAAGACAGAGCAAGTGG + Intronic
1147227564 17:38991582-38991604 AGCAGGAGAGAGAGAGCAAGCGG - Intergenic
1148490064 17:48017625-48017647 CACAGGGCAGAAAGAGGAAGAGG + Intergenic
1149519507 17:57307808-57307830 AACAGGAGAGAGAGAGAAAGAGG - Intronic
1149779789 17:59388215-59388237 TCCAGGACTGACACAGCAAAAGG - Intronic
1150642360 17:66958212-66958234 TACAGGACAAACAGGCCGAGAGG - Intergenic
1150967175 17:69984621-69984643 TACAAGATAGAAAGAGAAAGAGG + Intergenic
1151952968 17:77365424-77365446 GATAGGAAAGACAGAGAAAGGGG - Intronic
1152178961 17:78806040-78806062 CACAGGACAGACAAAGCATTGGG - Intronic
1152713166 17:81885039-81885061 CACAGGACAGCCAGAGGCAGAGG + Intergenic
1154337005 18:13474070-13474092 TGCAGGAGAGAAAGAGCACGAGG - Intronic
1154490954 18:14921874-14921896 AAAAGGGGAGACAGAGCAAGAGG + Intergenic
1155875400 18:31080667-31080689 AACAGGAGAGACAGAGCAAAGGG - Intronic
1156321899 18:36033767-36033789 TACAGAACAGCAAGAGGAAGGGG - Exonic
1156352533 18:36313164-36313186 TAGAGTACAGCCAGAGCATGTGG - Intronic
1156459789 18:37315272-37315294 CACAGGACAGACAGAGACAGAGG + Intronic
1156759815 18:40574890-40574912 AGCAGGAGAGACAGAGCAAAGGG + Intergenic
1157489550 18:48113278-48113300 TACAAGAAAGACAGACCAGGGGG - Intronic
1157493611 18:48139976-48139998 TTCAGGTCAGCCAGAGCACGTGG + Intronic
1157623757 18:49031590-49031612 TAGAGGAAAGACAGAGAAAGAGG - Intergenic
1158038684 18:53066923-53066945 TGCAGGAGAAACAGAGAAAGAGG + Intronic
1158374530 18:56848156-56848178 TCCAGGACACACTGTGCAAGGGG - Intronic
1159543935 18:69815929-69815951 TGTAGGATAGACAGTGCAAGTGG - Intronic
1160688515 19:448863-448885 GACAGGACGGACGGGGCAAGTGG + Intronic
1161299771 19:3537101-3537123 GCCAGGAGGGACAGAGCAAGGGG + Intronic
1161303976 19:3556970-3556992 CACGGGACAGACAGACCGAGGGG + Intronic
1161430342 19:4228616-4228638 GAGATGACAGACAGAGAAAGGGG - Intergenic
1161459909 19:4390417-4390439 GAGAGGACAGACAGAGAGAGAGG + Intronic
1165509174 19:36256365-36256387 AACAGGGCAGACAGAGCAAGAGG - Intergenic
1165509686 19:36258780-36258802 AACAGGGCAGGCAGAGCAAGAGG - Intergenic
1165510712 19:36265325-36265347 AACAGGGCAGGCAGAGCAAGAGG - Intergenic
1165511760 19:36270271-36270293 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165512310 19:36272772-36272794 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165512857 19:36275313-36275335 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165513413 19:36277868-36277890 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165514515 19:36282939-36282961 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165515617 19:36288008-36288030 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165518376 19:36300664-36300686 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165518926 19:36303196-36303218 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165519475 19:36305711-36305733 GACGGGGCAGACACAGCAAGAGG - Intergenic
1165595896 19:37011101-37011123 AACAGGGCAGACAGAGCAAGAGG - Intronic
1165601397 19:37058062-37058084 AACAGGAGAGACAGAGCAAGAGG - Intronic
1165601835 19:37060464-37060486 AACAGAAGAGACAGAGCAAGAGG - Intronic
1165624044 19:37270342-37270364 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165624590 19:37272883-37272905 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165625133 19:37275410-37275432 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165625667 19:37277948-37277970 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165626207 19:37280473-37280495 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165626748 19:37283000-37283022 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165627288 19:37285521-37285543 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165627829 19:37288049-37288071 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165628366 19:37290573-37290595 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165628906 19:37293098-37293120 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165629449 19:37295624-37295646 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165629990 19:37298149-37298171 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165630533 19:37300677-37300699 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165631069 19:37303215-37303237 GACGGGGCAGACACAGCAAGAGG + Intergenic
1165631528 19:37305666-37305688 AACAGGGCAGACAGAGCAAGAGG + Intergenic
1167080954 19:47275694-47275716 AACAGGACAGACACAGCACGAGG - Exonic
1167140175 19:47644921-47644943 CACAGGACAGAGAGAGAAAGAGG - Intronic
1168101985 19:54146214-54146236 TAAAGGACATAAAGAGCAATAGG + Intronic
1168511027 19:56973720-56973742 TACAGCACAGAGAGTGCAGGTGG + Intergenic
925230429 2:2228169-2228191 TACATAAAAGACAGGGCAAGGGG + Intronic
925582283 2:5423256-5423278 AGCAGGAGAGAGAGAGCAAGGGG - Intergenic
925655556 2:6144364-6144386 CACAGGAAACACAGAGAAAGGGG - Intergenic
925697461 2:6596000-6596022 TACATGTCAGAGAGAGCATGGGG + Intergenic
925734960 2:6955872-6955894 TACAGCACAGAAATAGCATGTGG - Intronic
926225591 2:10964846-10964868 TGCAGGAGAGCCAGAACAAGAGG - Intergenic
927832508 2:26364323-26364345 TGCATGACATACAGAGAAAGTGG - Exonic
928695333 2:33843304-33843326 AACAAGACAGAGTGAGCAAGAGG - Intergenic
929095999 2:38263765-38263787 GAGAGGAGAGACAGAGAAAGAGG - Intergenic
930008617 2:46917014-46917036 GACAGGAAAGACAAAGAAAGTGG + Intronic
930752337 2:54945696-54945718 CACTGGGCTGACAGAGCAAGAGG - Intronic
930798742 2:55420196-55420218 GACAGGGAAGGCAGAGCAAGGGG + Intergenic
930812695 2:55559614-55559636 AGCAGGAGAGAGAGAGCAAGGGG - Intronic
931061958 2:58540072-58540094 GACAGGAAAGACAGTGAAAGGGG + Intergenic
931269581 2:60689632-60689654 AACAGGAGAGAGAGAGTAAGGGG - Intergenic
931471989 2:62547661-62547683 TACATGAGAGAGAGAGGAAGAGG - Intergenic
933776664 2:85775221-85775243 GACAGGACACAAAGAGAAAGGGG - Intronic
933790303 2:85878915-85878937 GACAGGACAGAGAGAGGAGGCGG + Intronic
938386921 2:130873160-130873182 CACAGCACAGACAGATCAAGTGG - Intronic
938976260 2:136481228-136481250 TACAGGAGAGACGGATCAAGAGG - Intergenic
940153766 2:150631131-150631153 CACAGAACAAAAAGAGCAAGTGG + Intergenic
941870297 2:170377422-170377444 AACGGGAAAGACAGAGCCAGAGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943108917 2:183581951-183581973 GAAAGAACAGACAGAGCAAAGGG + Intergenic
943658048 2:190529864-190529886 TACAGAACTGACAAAGCATGAGG + Intronic
943747942 2:191481880-191481902 TACATGATAGACAAAGAAAGAGG - Intergenic
943953868 2:194161859-194161881 TAGAGGACAGGAAGATCAAGGGG - Intergenic
944538130 2:200731192-200731214 TACAGGACAGGAGGAGGAAGTGG - Intergenic
944656206 2:201878805-201878827 CACAGGGCAGAAAGAGCAAAAGG + Intronic
946072274 2:217044620-217044642 TAAAGGAGAGAAAGAGGAAGGGG - Intergenic
946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG + Intronic
946438043 2:219672141-219672163 GGCAGGAGAGACAGAGCAAGCGG - Intergenic
947050572 2:226038451-226038473 TACCAGACAGGAAGAGCAAGAGG + Intergenic
947971994 2:234332464-234332486 ATCAGGACAGACAGAGACAGGGG - Intergenic
948445360 2:238028256-238028278 AACAGCACAGCCAGAGCAGGAGG - Intronic
948859807 2:240747323-240747345 TGCAGGAGAAACAGAGCAAATGG + Intronic
1170549564 20:17465298-17465320 TACAGGAAGCAGAGAGCAAGAGG - Intronic
1170909725 20:20553723-20553745 TTCAGGAGTGACAGAACAAGTGG + Intronic
1170954968 20:20971654-20971676 AAGTGGACAGACAGAGAAAGTGG - Intergenic
1171410369 20:24943087-24943109 AGCAGGACAGGCAGAGCAATGGG + Intergenic
1171511082 20:25685533-25685555 GACAGGGCAGACAGAGCACAAGG - Intronic
1171523570 20:25793383-25793405 AACTGGGCAGACAGAACAAGAGG + Intronic
1171523910 20:25795182-25795204 AACAGGGGAGGCAGAGCAAGAGG + Intronic
1171531316 20:25855340-25855362 AACTGGGCAGACAGAACAAGAGG + Intronic
1171531643 20:25857168-25857190 GACAGGGGAGGCAGAGCAAGAGG + Intronic
1171533053 20:25864666-25864688 GACAGGGGAGACAGAGCAAGAGG + Intronic
1171533921 20:25869515-25869537 AACAGGGGAGACAGGGCAAGAGG + Intergenic
1171543855 20:25986199-25986221 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1171544235 20:25988422-25988444 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1171552917 20:26060701-26060723 AACAGGGGAGGCAGAGCAAGAGG - Intergenic
1171553257 20:26062500-26062522 AACTGGGCAGACAGAACAAGAGG - Intergenic
1171793213 20:29547307-29547329 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1171846456 20:30280418-30280440 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1171846889 20:30282856-30282878 AACAGGGGAGGCAGAGCAAGAGG - Intergenic
1171847427 20:30285474-30285496 AACAGGGGAGGCAGAGCAAGAGG + Intergenic
1171855241 20:30337072-30337094 AACAGGGGAGACAGAGCAAGAGG + Intergenic
1172080591 20:32337769-32337791 TACAGGACAGACGGGGCACCTGG + Intergenic
1172250989 20:33479054-33479076 TACAGCAGAGACTGAGAAAGGGG - Intergenic
1172705752 20:36880908-36880930 TGCAGGACAGGCAGGTCAAGGGG - Intronic
1172776213 20:37408711-37408733 GACAGGACAGACAGGAAAAGGGG + Intergenic
1173070158 20:39756457-39756479 TACAGGCCAAAGAGAGCAAGGGG + Intergenic
1173335925 20:42112437-42112459 TCCTGGGCAGACTGAGCAAGTGG - Intronic
1173554713 20:43957853-43957875 AGCAGGAGAGACAGAGCAAGTGG + Intronic
1173743057 20:45416172-45416194 AACAGGACGAGCAGAGCAAGCGG - Exonic
1173905558 20:46626196-46626218 GAGAGGACAGACAGAGGGAGTGG - Intronic
1174099350 20:48115292-48115314 CACAGGAGAGACAGAGCAAGAGG - Intergenic
1174421832 20:50404323-50404345 GACAAGAAAGACAGAGAAAGAGG + Intergenic
1177557572 21:22712629-22712651 TATAGTACTGACAAAGCAAGTGG - Intergenic
1177687385 21:24455665-24455687 TACATGACAGTTAGACCAAGTGG - Intergenic
1179299180 21:40091026-40091048 TTCAGGACAGAGAGACCAGGTGG + Intronic
1180116955 21:45714028-45714050 TAGAGGAAAGACAAAACAAGAGG - Intronic
1180840932 22:18958501-18958523 TACTGGACAGAGAGAGGAGGCGG - Intergenic
1181090514 22:20469347-20469369 CACAGGACACACAGAGCAGGGGG + Intronic
1181383746 22:22528317-22528339 AACAGGAACGACAGAGCAAGAGG + Intergenic
1181883862 22:26003353-26003375 AACTGGACAGAGAGAGCCAGGGG - Intronic
1182960384 22:34466719-34466741 TAAAGGACAGAGAGAGAAGGGGG - Intergenic
1183515372 22:38262479-38262501 AAGAGGGCAGACAGAGGAAGGGG + Intronic
949258209 3:2075826-2075848 TCCAGGAAAGACGGAGCAAAAGG + Intergenic
949329089 3:2901436-2901458 TACATGACAGGAAGAGAAAGGGG + Intronic
951480800 3:23160252-23160274 GACAGAACAGACAGAGCATTTGG - Intergenic
952014425 3:28939984-28940006 TACAGGAGGGACATAGAAAGAGG - Intergenic
952146934 3:30543257-30543279 CATAGTACAGACAGAACAAGTGG + Intergenic
952622336 3:35360932-35360954 TATAGTACAGACAAAACAAGAGG + Intergenic
953431951 3:42847331-42847353 GACAGCACAGAAAGAGGAAGTGG + Intronic
956401746 3:68887268-68887290 TGCAGGACATACAGAGCCAAAGG - Intronic
958037679 3:88189546-88189568 TACAGGACAGAAAAAGGAAGAGG - Intergenic
958091086 3:88876983-88877005 TACAGTATAGTCAGAGTAAGTGG - Intergenic
958744174 3:98113146-98113168 TGCAGCTCAGAAAGAGCAAGAGG + Intergenic
959914595 3:111802325-111802347 TAAAGGGGAGACAGAGCAAGGGG + Intronic
960206808 3:114911815-114911837 GAGAAGACAGACAGAGTAAGAGG + Intronic
961583482 3:127902623-127902645 TACAGGAGAGAAGGAGCAAAAGG + Intergenic
961797243 3:129418363-129418385 TACATGACCGACAGGGCAGGGGG + Exonic
961913698 3:130347839-130347861 TCCAGTACACACTGAGCAAGTGG + Intronic
962431724 3:135326378-135326400 TACAGGGCATACACAGGAAGGGG + Intergenic
962621400 3:137183489-137183511 TACAGGACAGTCAAAGCCAATGG - Intergenic
962698549 3:137974602-137974624 TAGAGGACAGACAGAGCAAGAGG - Intergenic
965077779 3:164001853-164001875 TACAGGACAAATACACCAAGGGG - Intergenic
965491685 3:169344862-169344884 TAAAGGACAGCCAGAGGAAGAGG + Intronic
965790206 3:172379267-172379289 TAGGGGACAGACAGCACAAGTGG + Intronic
966098949 3:176242828-176242850 AGCAGGAGAGACAGAGCAAAGGG + Intergenic
966505332 3:180694385-180694407 TAGGGGAGAGACAGAGAAAGAGG + Intronic
966771587 3:183508973-183508995 TACAGGAAATACAGGGAAAGAGG + Intronic
966798223 3:183736783-183736805 TTAAGGACAGCCAGAACAAGCGG + Exonic
968057564 3:195704290-195704312 TTCAGGAAAGACAGAGGCAGAGG - Intergenic
968546225 4:1200381-1200403 TAAATGACAGAGGGAGCAAGTGG + Intronic
968789762 4:2651488-2651510 GGCAGGAGAGAGAGAGCAAGAGG + Intronic
969108127 4:4823331-4823353 AGCAGGAGAGACAGAGCAAAGGG - Intergenic
969694182 4:8725529-8725551 CACAGGGCAGACAGAGGCAGAGG + Intergenic
969699548 4:8760690-8760712 GACAGGACAGAGGGAGCAAGAGG - Intergenic
969882361 4:10185499-10185521 AACAGAACAGACACATCAAGGGG - Intergenic
970140933 4:12981404-12981426 TAAAGGACTTACAGAGCAAATGG + Intergenic
970993806 4:22242422-22242444 TAGAGGGCAGACAGAGGGAGTGG - Intergenic
971264612 4:25086923-25086945 TACAGGGCAGACAAGGCTAGCGG + Intergenic
971283160 4:25259295-25259317 GCCAAGACAGACAGAGAAAGTGG - Intronic
971422780 4:26489314-26489336 TGCAGAAGAGACAGAGCATGAGG + Exonic
972656419 4:41067825-41067847 AACAGAATAAACAGAGCAAGTGG + Intronic
973612274 4:52647186-52647208 TACAAGACACAAACAGCAAGGGG + Intronic
974083914 4:57239493-57239515 AATAGGAAAGGCAGAGCAAGTGG + Intergenic
976462651 4:85330495-85330517 TAGAGGCCAGACTGAGCATGTGG + Intergenic
976636126 4:87287756-87287778 GGCAGGAGAGACAGAGCAAAGGG - Intergenic
980354274 4:131723710-131723732 GACGGGGCAGACACAGCAAGAGG - Intergenic
980354811 4:131726216-131726238 GACGGGGCAGACACAGCAAGAGG - Intergenic
980355346 4:131728693-131728715 GACGGGGCAGACACAGCAAGAGG - Intergenic
980355895 4:131731194-131731216 GACGGGGCAGACACAGCAAGAGG - Intergenic
980357509 4:131738665-131738687 GACGGGGCAGACACAGCAAGAGG - Intergenic
980358579 4:131743645-131743667 GACGGGGCAGACACAGCAAGAGG - Intergenic
980359122 4:131746118-131746140 GACGGGGCAGACACAGCAAGAGG - Intergenic
980360200 4:131751081-131751103 GACGGGGCAGACACAGCAAGAGG - Intergenic
980361286 4:131756036-131756058 GACGGGGCAGACACAGCAAGAGG - Intergenic
980362369 4:131760991-131761013 GACGGGGCAGACACAGCAAGAGG - Intergenic
980362909 4:131763474-131763496 GACGGGGCAGACACAGCAAGAGG - Intergenic
980378374 4:131977518-131977540 GACGGGGCAGACACAGCAAGAGG + Intergenic
982891389 4:160855807-160855829 GGCAGGAGAGACAGAGCCAGGGG + Intergenic
984787206 4:183578830-183578852 TTCATGACAGACAGAACAAGAGG - Intergenic
984922428 4:184777531-184777553 GAGAGGACAGAGAGAGAAAGAGG + Intronic
985906911 5:2845966-2845988 TACTGGAGAGAGAGAGAAAGGGG + Intergenic
986627375 5:9735084-9735106 GACAGGAGAGAGCGAGCAAGGGG + Intergenic
986879764 5:12155232-12155254 TAAAGGACAGCCAGAGAAAAAGG + Intergenic
987089297 5:14497137-14497159 TACAGGACACGCAGGGCACGGGG - Intronic
988275902 5:29080719-29080741 GACAGGACAGAGAGAGCAAAGGG - Intergenic
990505608 5:56441270-56441292 TACAGGAAACACTCAGCAAGGGG + Intergenic
990598556 5:57334643-57334665 TGGAGGACAGACAGAGTGAGAGG + Intergenic
990757714 5:59093829-59093851 TACAGGAAAGAGAGAGACAGAGG + Intronic
991604325 5:68385052-68385074 CACAGTGCAGACAGAGGAAGGGG + Intergenic
993118827 5:83750128-83750150 TACAGGACACACAAAGAAACAGG - Intergenic
993343777 5:86757054-86757076 TACAGGACATACAGTCCAACAGG - Intergenic
994446980 5:99888506-99888528 AACAGGAGAGAGAGAGCAAGGGG - Intergenic
994457226 5:100026258-100026280 TCCAGGATAGACAGAGTAAAAGG + Intergenic
997857144 5:137382614-137382636 AGCAGGAGAGACAGAGTAAGGGG + Intronic
999374018 5:151074093-151074115 TACAGTAGGGACAGAGGAAGGGG + Intronic
1000048480 5:157541397-157541419 CACAGAGCAGACAGAGCAGGGGG - Intronic
1000582847 5:163055075-163055097 TACAGGACAGTCAGAGAGATGGG + Intergenic
1001771958 5:174303380-174303402 AGCAGAACTGACAGAGCAAGTGG + Intergenic
1002819252 6:708747-708769 AACAAGACAGAAAGAGCCAGAGG + Intergenic
1003148720 6:3530765-3530787 GACAGGACTGACAGGGCAGGGGG + Intergenic
1003328289 6:5109306-5109328 CACAGGACAGGCAGCGCAAAAGG + Exonic
1003347513 6:5284477-5284499 TGCACGACAGCCAGAGCAGGTGG - Intronic
1003707947 6:8555713-8555735 TAGAGGAGAGACAGAGATAGTGG + Intergenic
1004005674 6:11635232-11635254 TTCAGGGCACACAGAGCGAGGGG - Intergenic
1004117310 6:12782050-12782072 AACATGGCAGACAGAGCAAGAGG - Intronic
1007047853 6:38795989-38796011 CACAGGACAGAAAGAACAACTGG - Intronic
1007629820 6:43266943-43266965 TACAGGCCAGAGAGAGCAGATGG + Intronic
1007752270 6:44077548-44077570 TACAGGAGAGAGGGGGCAAGAGG - Intergenic
1008365419 6:50673489-50673511 TGTAGGACAGACAGAGAAAGAGG + Intergenic
1009826220 6:68868276-68868298 ACCAGGAGAGACAGAGCAAGTGG - Intronic
1010875857 6:81104561-81104583 TCCAGGACAAACAGGGCAATTGG - Intergenic
1011651143 6:89507559-89507581 GACAGAACAAACAGAGCACGGGG + Intronic
1012104091 6:95131405-95131427 TAAAAGACAGACAGAGAAGGTGG - Intergenic
1013859995 6:114624212-114624234 TAGAGAAGAGACAGAGCATGGGG + Intergenic
1014043093 6:116851706-116851728 AGCAGGAAAGAGAGAGCAAGTGG - Intergenic
1014818422 6:125959302-125959324 TAAGGGACAGACAGAGGAAGAGG + Intronic
1016612937 6:146013028-146013050 GAAAGGACATACAGAGGAAGAGG + Intergenic
1016822761 6:148361838-148361860 AACAGGAGAGACAGAGACAGAGG + Intronic
1017055610 6:150433183-150433205 TGCAGTACAGACAGAACAGGAGG + Intergenic
1017065830 6:150528304-150528326 TATAGGAGAGAAAGAGCAGGAGG - Intergenic
1019129286 6:169861848-169861870 CACAGCACAGTCACAGCAAGTGG - Intergenic
1021137880 7:16987821-16987843 TCCAGACAAGACAGAGCAAGAGG - Intergenic
1021924893 7:25524883-25524905 TAGAGGAGAGGCAGAGCAAGGGG + Intergenic
1022374241 7:29798779-29798801 TACTGAACAGGCAGAGAAAGAGG - Intergenic
1023845985 7:44120709-44120731 AGCAGGAGAGAGAGAGCAAGGGG - Intronic
1024059118 7:45685313-45685335 AACAGGACAGACAGGGCAGGAGG + Intronic
1024741497 7:52359976-52359998 AGCAGGAGAGAGAGAGCAAGAGG + Intergenic
1025284011 7:57648297-57648319 AACTGGGCAGACAGAGCAAGAGG + Intergenic
1025294796 7:57768895-57768917 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1025295231 7:57771278-57771300 AACAGGGGAGACAGAGCGAGAGG - Intergenic
1025295893 7:57775103-57775125 GCCTGGGCAGACAGAGCAAGAGG - Intergenic
1025300751 7:57818310-57818332 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1025301642 7:57823183-57823205 GACAGGGGAGGCAGAGCAAGAGG - Intergenic
1025776864 7:64568323-64568345 TACAGGACAGCTGGAGCCAGGGG + Intergenic
1026467424 7:70666431-70666453 TACAGGACAGACAGAGATTTGGG + Intronic
1027791211 7:82640266-82640288 AACAGGACTGACGGTGCAAGGGG + Intergenic
1028357042 7:89923138-89923160 TGAAGGATAGACAGAGGAAGAGG + Intergenic
1028505715 7:91568124-91568146 AACAAAACAGACACAGCAAGAGG + Intergenic
1028603731 7:92631308-92631330 TCCAGGAGACTCAGAGCAAGAGG + Intronic
1029600555 7:101560876-101560898 GAAAAGAGAGACAGAGCAAGAGG + Intergenic
1029677380 7:102079766-102079788 AACAGGACAGAAAGAGGAACTGG + Intronic
1030779780 7:113585878-113585900 TACAGAACAGACATGGAAAGAGG - Intergenic
1031524368 7:122807033-122807055 TACTGTAAGGACAGAGCAAGAGG + Intronic
1032626328 7:133595199-133595221 TGCAGGAGAATCAGAGCAAGTGG + Intronic
1033437527 7:141347017-141347039 GGCAGGAGAGAGAGAGCAAGGGG - Intronic
1033672661 7:143507930-143507952 TACAGGATAGGCAGAGGAAGGGG - Intergenic
1034732768 7:153402297-153402319 TACATGATAGAAAGAGAAAGGGG - Intergenic
1036164318 8:6418275-6418297 TAGGGGACAGACAGAAAAAGTGG + Intronic
1036701816 8:11018135-11018157 TTCAGGTCAGACAGAGGGAGGGG - Intronic
1037157400 8:15720624-15720646 TCCTGGACATACAGAGCAAATGG + Intronic
1037560003 8:20065205-20065227 TAAAGGACAAACAAAGCCAGTGG - Intergenic
1039128928 8:34238733-34238755 AACAGGAGAGAGAGAGCAAAGGG + Intergenic
1039368037 8:36952838-36952860 GACAGAAAAGAAAGAGCAAGTGG + Intergenic
1039457098 8:37714763-37714785 TTCAGGATATACAAAGCAAGGGG - Intergenic
1039757355 8:40537904-40537926 TACAGCTGAGGCAGAGCAAGGGG + Intronic
1040794444 8:51273629-51273651 TACAGAAGGGACAGAGGAAGGGG + Intergenic
1040949660 8:52924814-52924836 TACACAACAGAGAGAGAAAGTGG - Intergenic
1040984876 8:53282641-53282663 AACAGGACAGAATGTGCAAGAGG - Intergenic
1041463779 8:58139076-58139098 TAATGGAAACACAGAGCAAGAGG + Intronic
1042960941 8:74303176-74303198 TACGGGACATGCAGAGAAAGAGG - Intronic
1043086726 8:75844001-75844023 TACATTCCAGACAGAGGAAGTGG + Intergenic
1044344725 8:91091956-91091978 TAAAGGACAGTCAGGGGAAGAGG - Intergenic
1045558322 8:103236572-103236594 TAAGGGACAGGCAGAGGAAGAGG - Intergenic
1045921944 8:107540681-107540703 TACCAGAGACACAGAGCAAGTGG + Intergenic
1046895701 8:119469817-119469839 TGCAGGACAGGCAGAGGTAGAGG + Intergenic
1047889913 8:129296371-129296393 GGCAGGAGAGAGAGAGCAAGGGG + Intergenic
1048413720 8:134203054-134203076 TGAAGAACAGACAGAGAAAGGGG + Intergenic
1049299525 8:141862253-141862275 CACAGGACACACAGAGCAAGGGG - Intergenic
1049686392 8:143940936-143940958 GGCCGGACAGGCAGAGCAAGAGG - Intronic
1050319715 9:4439104-4439126 TGCAGCACAGAGAGAGAAAGGGG - Intergenic
1052171207 9:25399439-25399461 TACAAGACAGAGAGAAAAAGGGG + Intergenic
1052849330 9:33367092-33367114 GAGAGGACAGACAGAGGAACAGG - Intronic
1053793073 9:41700361-41700383 AACAGGGGAGACAGAGCAAGAGG + Intergenic
1054152102 9:61614463-61614485 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1054161627 9:61675397-61675419 AACAGGGGAGACAGAGCAAGAGG + Intergenic
1054181481 9:61912382-61912404 AACAGGGGAGACAGAGCAAGAGG + Intergenic
1054471876 9:65545607-65545629 AACAGGGGAGACAGAGCAAGAGG - Intergenic
1055034806 9:71807024-71807046 TACAGGGCAGAGAGAGCCAAAGG + Intronic
1055249162 9:74281705-74281727 TAAAGGACAGAGAGATTAAGTGG + Intergenic
1056164568 9:83928597-83928619 TGCAGGGGAGACAGAGGAAGGGG - Intergenic
1057378477 9:94545729-94545751 AACAGACGAGACAGAGCAAGAGG + Intergenic
1057428927 9:94976977-94976999 CTCAGGAAAGCCAGAGCAAGAGG - Intronic
1058491179 9:105501356-105501378 TTCATGAAAGCCAGAGCAAGAGG - Intronic
1058550907 9:106113830-106113852 TTCAGATCAGACAGAGAAAGGGG - Intergenic
1059697042 9:116739388-116739410 TTAAGGACAGTCAGAGCAGGAGG - Intronic
1061481596 9:130900090-130900112 TTCAGGGGAGACAGAGCGAGAGG + Intergenic
1062300811 9:135867779-135867801 CACAGGACAAACAAGGCAAGAGG + Intronic
1186477556 X:9869506-9869528 AAAAGGATAGACAGAGAAAGTGG - Intronic
1186799771 X:13080966-13080988 GACAGGACAGCCAGTGCAAAGGG - Intergenic
1187263528 X:17709579-17709601 TACAAGACTGACAGGGCAAATGG + Intronic
1187907156 X:24077682-24077704 TTCAGGCCAGGAAGAGCAAGGGG - Exonic
1188247988 X:27857074-27857096 TACATTCCAGACAGAGTAAGGGG - Intergenic
1190443931 X:50504093-50504115 TTCAAGACATACAGAGCAAGTGG - Intergenic
1192897759 X:75461515-75461537 TTCAGGGCAGCCAGAGCAAAAGG + Intronic
1193047751 X:77070277-77070299 CAGAGGACAGAGAGAGAAAGAGG + Intergenic
1193057855 X:77173764-77173786 AGCAGGAGAGAGAGAGCAAGGGG + Intergenic
1194916370 X:99714290-99714312 TTCAGGACAGCAAGGGCAAGGGG + Intergenic
1195307297 X:103596606-103596628 TACAAGACAGCAAAAGCAAGGGG - Intergenic
1195345839 X:103950372-103950394 AACAGAACAGGCAGAGCTAGTGG + Intronic
1195361759 X:104089065-104089087 AACAGAACAGGCAGAGCTAGTGG - Intergenic
1196532983 X:116811539-116811561 TAGAAGACAGAGAGATCAAGAGG - Intergenic
1197390346 X:125855860-125855882 AACAGGAGAGAGAGAGCAAAGGG - Intergenic
1197666618 X:129231013-129231035 TAGAGCACAGACACAGTAAGAGG + Intergenic
1198613765 X:138431188-138431210 AACAGGAGAGAGAGAGCAAAGGG - Intergenic
1199273955 X:145920965-145920987 AACAGGAGAGACAGAGCGAAGGG - Intergenic
1199735145 X:150679109-150679131 TACGGGACAGACAGAGGAAGAGG + Intergenic
1202379414 Y:24262476-24262498 TAAAGCATAGACAGAGCCAGGGG + Intergenic
1202491368 Y:25407645-25407667 TAAAGCATAGACAGAGCCAGGGG - Intergenic