ID: 946202802

View in Genome Browser
Species Human (GRCh38)
Location 2:218080743-218080765
Sequence GAGGGAGGGAAGGATGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1705
Summary {0: 1, 1: 1, 2: 10, 3: 176, 4: 1517}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946202802_946202814 13 Left 946202802 2:218080743-218080765 CCATCAGCATCCTTCCCTCCCTC 0: 1
1: 1
2: 10
3: 176
4: 1517
Right 946202814 2:218080779-218080801 GCCCACTTGGCACCAGTGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 187
946202802_946202810 0 Left 946202802 2:218080743-218080765 CCATCAGCATCCTTCCCTCCCTC 0: 1
1: 1
2: 10
3: 176
4: 1517
Right 946202810 2:218080766-218080788 CCTCCCACCTGCTGCCCACTTGG 0: 1
1: 0
2: 2
3: 52
4: 390
946202802_946202817 22 Left 946202802 2:218080743-218080765 CCATCAGCATCCTTCCCTCCCTC 0: 1
1: 1
2: 10
3: 176
4: 1517
Right 946202817 2:218080788-218080810 GCACCAGTGCCAGGAATCACTGG 0: 1
1: 0
2: 1
3: 19
4: 130
946202802_946202819 30 Left 946202802 2:218080743-218080765 CCATCAGCATCCTTCCCTCCCTC 0: 1
1: 1
2: 10
3: 176
4: 1517
Right 946202819 2:218080796-218080818 GCCAGGAATCACTGGTGATCAGG 0: 1
1: 0
2: 1
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946202802 Original CRISPR GAGGGAGGGAAGGATGCTGA TGG (reversed) Intronic
900124137 1:1062109-1062131 GAGGGAGGGAATGGTGGTGAGGG - Intergenic
900156273 1:1204506-1204528 GAGGGAGGGAGGGAGGCTGGTGG + Intronic
900318184 1:2069762-2069784 GAGGGAGGGGTGGATGCTATAGG + Intronic
900352318 1:2241072-2241094 GAGGGAGCCCAGGATGCTGTGGG + Intronic
900725512 1:4214065-4214087 GATGGAAGGAAGGAAGGTGAAGG - Intergenic
900735683 1:4298111-4298133 GAGGGAGGGAGGGCTCCTGAAGG + Intergenic
900753745 1:4418633-4418655 GAGGGAAGGAAGGAGGAGGAGGG - Intergenic
900754345 1:4423317-4423339 GAGGGAAGGAAGGAACCTGGAGG - Intergenic
900849606 1:5131744-5131766 GAGGGAGGGAAGGAGAGGGAAGG - Intergenic
900862940 1:5246025-5246047 GAGGGAGGGAGGGAGGGAGATGG - Intergenic
900863127 1:5246657-5246679 GAGGGAGGGAAGGAAGAAAAAGG - Intergenic
900993150 1:6107058-6107080 GAGCGATGGAAGGATGATGGAGG + Intronic
900993192 1:6107195-6107217 GAGGGATGGAGGGATGATGGAGG + Intronic
900993198 1:6107214-6107236 GAGGGATGGAGGGATGATGGAGG + Intronic
900993203 1:6107233-6107255 GAGGGATGGAGGGATAATGAAGG + Intronic
900993227 1:6107339-6107361 GAGGGATGGAGGGATAATGAAGG + Intronic
900993246 1:6107412-6107434 GAGGGATGGAGGGATGATGGAGG + Intronic
900993259 1:6107461-6107483 GAGGGATGGAGGGATGATGAAGG + Intronic
900993277 1:6107534-6107556 GAGGGATGGAGGGATAATGAAGG + Intronic
900993338 1:6107817-6107839 GAGGGATGGAGGGATGATGAAGG + Intronic
900993347 1:6107854-6107876 GAGGGATGGAGGGATGATGGAGG + Intronic
900993562 1:6108699-6108721 GAGGAATGGAGGGATGATGAAGG + Intronic
901053226 1:6436129-6436151 GTGGGAGGGAGGGAGGCAGAGGG + Intronic
901198542 1:7453792-7453814 GAGGGAGGGAAGGAAAGGGACGG + Intronic
901214932 1:7550004-7550026 GAGGGAAGGAAGGAGGAGGAGGG + Intronic
901233070 1:7652012-7652034 GAGGGATGGCAGGGGGCTGAGGG - Intronic
901240409 1:7689767-7689789 GAGGGAGGAGAGCATGCAGAAGG - Intronic
901469507 1:9446477-9446499 GAGGGTGGGAAGGATGGGAAAGG + Intergenic
901631399 1:10649876-10649898 GAGGGAGGGAGGGAGGCTCACGG + Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
901827017 1:11868808-11868830 AGGGGAGGGAAGGATGGAGAGGG - Intergenic
901827787 1:11873900-11873922 AGGGGAGGGAAGGATGGAGAGGG - Intergenic
902098526 1:13966187-13966209 GAGGGAGGGAAGGAGTAGGAGGG - Intergenic
902275358 1:15335846-15335868 GAGGTAGCTGAGGATGCTGAAGG - Intronic
902388617 1:16089926-16089948 GAGGGAGGGAGGGAGGTTGGAGG + Intergenic
902436794 1:16403285-16403307 GAGGGAGGGATGGTAGCTGGCGG - Intronic
902481024 1:16711954-16711976 GAGGGAGGGAGGGAGGCAGAGGG - Intergenic
902547246 1:17197779-17197801 GAGGGCAGGAAGGTTGGTGATGG + Intergenic
902653850 1:17854113-17854135 CAGGGAGGGGAGGATGAAGAGGG - Intergenic
902777823 1:18685881-18685903 GATGGATGGAAGGTTGCTGGGGG - Intronic
902896238 1:19482057-19482079 GAGGGAGGGCAGGCTTCTAACGG + Intronic
903026552 1:20433666-20433688 GAGGGAGGGAGGGAGGGTGGGGG + Intergenic
903161671 1:21493438-21493460 GAGGGAGGGAAGCATCCTCACGG - Intergenic
903331555 1:22599603-22599625 GAGGGAGGGAGGGAGGAAGAAGG + Intronic
903341781 1:22659259-22659281 GATGGATGGACGGATGCAGATGG + Intronic
903341792 1:22659313-22659335 GATGGATGGATGGATGCAGATGG + Intronic
903639383 1:24848256-24848278 GAAGGAGGGAAGGAGGCCGGAGG - Intergenic
903670259 1:25031208-25031230 GATGGAGGGATGGAGGCTGGAGG + Intergenic
903740581 1:25556305-25556327 GAGGGAGGGTGGGAGGCCGAGGG + Intronic
903812685 1:26043618-26043640 GTGGGTGGGGAGGATCCTGAAGG - Intronic
903926292 1:26833241-26833263 AAAGGAGGGAAGGAGGATGAAGG + Intronic
904045090 1:27603940-27603962 GAGGGAGGGGAGGAGGGGGAGGG - Intronic
904208122 1:28868114-28868136 TAGGGAGGGCAGGAGGGTGATGG + Intergenic
904439271 1:30519364-30519386 GATGGAGAGAATGATGATGAAGG + Intergenic
904469529 1:30727894-30727916 GAGGGAGGGAGGGAAGGAGAGGG - Intergenic
904477768 1:30775840-30775862 GAGGGAGGGAGGGAGTCTGAGGG + Intergenic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
905259374 1:36706672-36706694 GAGAGAGGGAAGGAAGTGGATGG - Intergenic
905341626 1:37282297-37282319 GAGGGAGGGAGGGAGGAAGAGGG + Intergenic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
905731666 1:40302817-40302839 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
905766634 1:40607228-40607250 GAGGGAAGGGAGGGAGCTGAAGG - Intergenic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
906291340 1:44621480-44621502 GAGGGAGGGGAGGTTGCTACTGG - Intronic
906427788 1:45727462-45727484 GAGGGAGGGAAGGAAGAGAAAGG - Intronic
906562396 1:46768690-46768712 GAGGGAGGGACCGATGGGGAGGG + Intronic
906685724 1:47761873-47761895 AAGGAAGGGAAGGAAGCTGAAGG - Exonic
907047623 1:51309328-51309350 GCAGGAGGAAAAGATGCTGACGG + Intronic
907326963 1:53644595-53644617 GGGGTAGGGCAGGGTGCTGAAGG + Intronic
907333448 1:53685969-53685991 GGGGGAGGGCAGGTTTCTGACGG - Intronic
907821437 1:57973825-57973847 TAGGGAGGCAAGAATGGTGATGG - Intronic
907835722 1:58106835-58106857 GAGGGAGGGAGGGATGAAGGAGG - Intronic
908403284 1:63790712-63790734 GAGGGAGAAAAAGGTGCTGAGGG - Intronic
908984798 1:70004761-70004783 GAGGAAGGGAAGGAGGAAGAGGG - Intronic
909265891 1:73558025-73558047 GAGGGAGGTAAGGAACCTGTTGG + Intergenic
909665939 1:78133534-78133556 GAAGGAGAGAAGGATTTTGATGG + Intronic
909849367 1:80441074-80441096 GAGGGAGGTAAAGATGTGGAAGG - Intergenic
910161220 1:84274896-84274918 GAGGGAAGGAGGGAGGCGGAGGG - Intergenic
910437407 1:87219399-87219421 CAGGGAGGGGATGATGCTCAGGG + Intergenic
910449600 1:87331860-87331882 AAGGGCGGGAAGGAGGCTGAGGG - Intronic
910934383 1:92475651-92475673 GGGGGAGGGAAGAAACCTGAAGG + Exonic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
911126417 1:94344834-94344856 GAGGGAGGGAAAAATGCTAAAGG + Intergenic
911129966 1:94377558-94377580 GAGGGAGGGAAGGAATCTCCAGG + Intergenic
911226106 1:95307328-95307350 TAGGGAAGGAAGGAGACTGAAGG - Intergenic
911283579 1:95961269-95961291 GAGGCTGGGAAGGATACTGGAGG - Intergenic
911391942 1:97256288-97256310 GAGAGAAGGAAGGATGAGGAAGG - Intronic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
912413454 1:109493169-109493191 CAGGGAGGGATGGATGCCTAGGG - Intergenic
912834434 1:112983334-112983356 GAGGGAGGAAGGACTGCTGACGG + Intergenic
913131178 1:115839240-115839262 GAGGGAGGAGAGGATGCAGAGGG + Exonic
913169418 1:116218874-116218896 GAGGGAGGGAAGGAAGAGCATGG + Intergenic
913247029 1:116879080-116879102 GAGGGAGGGCAGGCAGCTGCTGG - Intergenic
913250652 1:116909993-116910015 GAGGGAGGGAAGGAGGCGGGAGG + Intergenic
913373171 1:118123177-118123199 GAAGGAGGGAAGGGAGCAGAGGG - Intronic
913583949 1:120254770-120254792 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
913624232 1:120643570-120643592 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
913673106 1:121116550-121116572 GATGGAGGGAAGGAGGCGGGGGG - Intergenic
914024883 1:143903911-143903933 GATGGAGGGAAGGAGGCGGGGGG - Intergenic
914565936 1:148866614-148866636 GAGGGAGGGAGGGAGGGGGAAGG + Intronic
914606885 1:149263622-149263644 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
914663312 1:149811631-149811653 GATGGAGGGAAGGAGGCGGGGGG - Intronic
914755413 1:150559256-150559278 GGGGGAGGGCAGGGTGATGAGGG - Intronic
914879353 1:151535689-151535711 GGGGGAGGGGAGGATTCTTAGGG + Intronic
914954827 1:152152248-152152270 GAGACAGGAATGGATGCTGAGGG - Intergenic
915050721 1:153069383-153069405 GAGGCAGGGAAAGATGTTCAGGG + Intergenic
915103872 1:153520200-153520222 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
915130152 1:153690221-153690243 GAGGGAGGGAGGGGTGTTAAGGG - Intronic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915357354 1:155263277-155263299 GGGCGAAGAAAGGATGCTGAAGG + Exonic
915365604 1:155313724-155313746 AAGGAAGGGAAGGAGGATGAGGG + Intronic
915394458 1:155572222-155572244 GAGGGAAGGGAGGATGCTATTGG - Intergenic
915469317 1:156116034-156116056 AAGGGAGGGAGGGAGGCAGAGGG + Intronic
915515562 1:156410457-156410479 GGGGGAAGGAGGGATTCTGAAGG + Intronic
915594305 1:156887652-156887674 TGGGGAGGGAGGGAGGCTGATGG - Intergenic
915623405 1:157099585-157099607 AAGGGAAGGAAGGAGGCAGAGGG + Exonic
915650779 1:157308922-157308944 GAGGGAGGGAGGGAAGGGGAAGG - Intergenic
915722469 1:157994569-157994591 GGGGGAGGGAAGAGGGCTGAGGG + Intronic
915866846 1:159510218-159510240 GAGGGAGGGAGGGAGGAAGATGG - Intergenic
915894708 1:159802814-159802836 GCAGGAGGGAAGGAGGCTGCTGG + Intronic
916058605 1:161084483-161084505 AAGGTGGGGAAGGATGCTGGGGG - Intronic
916420824 1:164636132-164636154 GAGAGAGAGAAAGATGCTGGGGG - Intronic
916491863 1:165309151-165309173 GACAGAGTGAATGATGCTGAGGG + Intronic
916845391 1:168645012-168645034 GGGAGAGGGAGGGGTGCTGATGG + Intergenic
917129917 1:171730678-171730700 GAGAGAGGGAAGGAGGGGGAAGG + Intronic
917157354 1:172018957-172018979 GAGGGAGGGAAGGAAGGGGAAGG - Intronic
917197813 1:172485112-172485134 GAGGGAGGGAGGGAGGAGGAGGG - Intergenic
917435483 1:175016991-175017013 GAGGCAGGGAAGCAGGATGATGG - Intronic
917460099 1:175222169-175222191 GAAGGAGGGAAGGAAGGAGAGGG + Intergenic
917469576 1:175314938-175314960 GAAGGAGGGAAGAATGAGGAAGG + Intergenic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
918539262 1:185610595-185610617 GAGGTAGGGAAGGGTAGTGAAGG + Intergenic
919211102 1:194487847-194487869 GAGGGAGGGAAGGAAGACCATGG - Intergenic
919803593 1:201367770-201367792 GAGGAAGCAAAGGAGGCTGAAGG - Exonic
919882883 1:201912390-201912412 GAGGGAGTGAAGGGAGCTGTGGG - Intronic
919935148 1:202246144-202246166 GGGGGAGGGAGGGATGGGGATGG - Intronic
920202705 1:204269545-204269567 GGGGCTGGGAAGGATGGTGAGGG - Intronic
920251464 1:204624932-204624954 CTGGGTGGGAGGGATGCTGAGGG + Intronic
920259617 1:204679975-204679997 GAGGGAGGGAAGGAGGAGAATGG + Intronic
920853003 1:209641550-209641572 GATGTAGGGAAGTATGCTAAAGG + Intronic
920989525 1:210923405-210923427 GAGGGAGGTAAGAAAGATGATGG - Intronic
921054252 1:211532147-211532169 GAGGGACAGCAGGTTGCTGAAGG + Intergenic
921248966 1:213278624-213278646 GAGGGAGGGGTGGATGAAGAGGG - Intergenic
921546000 1:216475729-216475751 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
921760300 1:218905981-218906003 GAGGCAGAGAATGGTGCTGATGG - Intergenic
921804805 1:219442150-219442172 GAGGAAGGAAAGATTGCTGAGGG - Intergenic
922020592 1:221700204-221700226 GAGGGAGGGAAGGAAAAGGAAGG + Intergenic
922277782 1:224095312-224095334 GAGGGTGGGAAGGAAAATGAAGG - Intergenic
922525256 1:226297103-226297125 GAGGAAGGGAATGAAGATGATGG + Intronic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
922655756 1:227382326-227382348 GAGGGAGGGAAGAAAAATGAAGG - Intergenic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
922794430 1:228333127-228333149 CAGGGCGGGAGGGGTGCTGAGGG - Intronic
922892640 1:229073397-229073419 GAAGGAGGGGAGGAGGGTGAGGG + Intergenic
922903279 1:229154862-229154884 GATGCAGGGAAGGAAGCTGTCGG + Intergenic
922961279 1:229647640-229647662 GACAGTGAGAAGGATGCTGAAGG - Exonic
923090341 1:230735745-230735767 GAGGGCGGGATGGGAGCTGATGG - Intergenic
923770029 1:236930462-236930484 TAGGGAGGGAAAGGGGCTGAGGG - Intergenic
923792785 1:237126552-237126574 GAGGGAAGGAAGGAGGATTATGG - Intronic
923988090 1:239403949-239403971 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
924149911 1:241118890-241118912 AAAGGAGGCAAGGAGGCTGAGGG + Intronic
924202572 1:241675082-241675104 GAGGGAGGGAGGAAGGATGAAGG - Intronic
924260785 1:242228650-242228672 GAGGGAGGGAAGGAGGGAGAGGG + Intronic
924448538 1:244156939-244156961 GAAGGAGGGAAGGATGGAGGGGG - Intergenic
924516463 1:244770192-244770214 GAGGAAGGGAGGGATGCAGAGGG + Intergenic
924536093 1:244937131-244937153 GAGGGATGGAGGGATTGTGAGGG + Intergenic
924549528 1:245062699-245062721 GGGGAAGGGGAGGATGCAGATGG - Intronic
924584082 1:245346394-245346416 GGAGGAGGGAAGGATGATCATGG - Intronic
924596082 1:245445862-245445884 AAGGGAGGGAAGGATGCTAATGG - Intronic
924673631 1:246153413-246153435 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
1062780345 10:199271-199293 GAGGGAGGGAGGGATGGGAAGGG - Intronic
1063153360 10:3356366-3356388 GAAGGAGGGAAGGAAGGAGAGGG - Intergenic
1063218911 10:3948367-3948389 GAGGGTGGAAGGGAGGCTGAGGG + Intergenic
1063286307 10:4692283-4692305 GAAGGAAGGAAGGAAGGTGAAGG + Intergenic
1063434564 10:6019740-6019762 GAGGGAGAGGAGGCTGCTGTGGG + Intronic
1063490673 10:6460820-6460842 GATGGATGGATGGATGGTGATGG - Intronic
1063691875 10:8295534-8295556 GAGGGAAGGAAGGAAGGAGAGGG - Intergenic
1063980276 10:11446708-11446730 GAGGGAGGGAGGGAGGGAGATGG + Intergenic
1064179014 10:13099424-13099446 GAGGGAGGGAAGGAGGGAGGGGG - Intronic
1064341529 10:14489942-14489964 GAGGGAGGGAAGGAAGGAAAAGG + Intergenic
1064421742 10:15196724-15196746 GAGGGAGGGAGGGAGGGAGATGG - Intergenic
1064587341 10:16852069-16852091 GAGGGAGGGAAAGATGATGGAGG - Intronic
1064703980 10:18051191-18051213 GAGGGAGGGAAGGATGGAAGAGG + Intergenic
1065001799 10:21343984-21344006 GAGGGAGGGAAGGAGGGAGGGGG + Intergenic
1065019512 10:21493324-21493346 AAGGGAGGGAAGGAAAATGAAGG - Exonic
1065185023 10:23163178-23163200 GAGGGAGGGAAGGAAGGAAAGGG + Intergenic
1065362488 10:24902102-24902124 GAGGGAAAGAAGGAAACTGATGG + Intronic
1066211509 10:33243886-33243908 GAGGGAGGGAGGGAAGGAGAAGG + Intronic
1066465217 10:35643799-35643821 AAGGGAGGGAAGGAAGGAGAGGG - Intergenic
1066542851 10:36467799-36467821 GAGGCAGGAATGGATGTTGATGG + Intergenic
1067216611 10:44309434-44309456 GAGGGAGGGAAGGAGGTGGCGGG + Intergenic
1067230193 10:44400972-44400994 GGGGGAGGGAAGGAGGCAGGGGG - Intergenic
1067295486 10:44973136-44973158 GAGGGAGGGGAGCAAGCTGTGGG - Intronic
1067494430 10:46749156-46749178 GGAGGATTGAAGGATGCTGATGG + Intergenic
1067600228 10:47591241-47591263 GGAGGATTGAAGGATGCTGATGG - Intergenic
1067745538 10:48933034-48933056 GAGGCAGGGAAGGAGAGTGATGG + Intronic
1067781127 10:49208322-49208344 GGGGGTGGGAGGGATGCTAAGGG + Intergenic
1068033502 10:51731999-51732021 GAGGGAGGGACGGGGGCGGAGGG - Intronic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1068370493 10:56107159-56107181 GAGGAAGGGAAGGATGAGGTGGG + Intergenic
1068450387 10:57178892-57178914 GAGGGAGGGAAGGAGGGGAAGGG + Intergenic
1068558217 10:58482045-58482067 GAGGTAGGGAGGGACGGTGAGGG - Intergenic
1068611777 10:59068273-59068295 GAGGATGGGAAGGTTGATGAGGG - Intergenic
1068611910 10:59069626-59069648 GAGGATGGGAAAGTTGCTGATGG - Intergenic
1068627415 10:59264196-59264218 AAGGGAGGGAAGGAGGGAGAGGG + Intronic
1068830656 10:61491185-61491207 GAGGGAAGGAAGGAAGGAGAAGG + Intergenic
1068919209 10:62465300-62465322 GAGGGAGGCCAGGGTACTGAGGG + Intronic
1069595010 10:69664826-69664848 GCTGGAGGAAGGGATGCTGATGG - Intergenic
1069657160 10:70098379-70098401 GAGGGAGGGAAGGAGGGGGAGGG + Intronic
1069782799 10:70967461-70967483 GATGGAGATGAGGATGCTGATGG + Intergenic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070387048 10:75935117-75935139 GAGTAAGGGAAGGATGGAGACGG - Intronic
1070509464 10:77147415-77147437 GAAGGAGGGAGGGAGGCTGGTGG - Intronic
1070569008 10:77626973-77626995 GAGGGAGGGCAGGAGGTAGAGGG - Intronic
1070627701 10:78062947-78062969 AAGGGAAGGAAAGATGATGAGGG - Intergenic
1070768866 10:79070830-79070852 GAGGGAGGGAGGGAGGCAGGCGG - Intronic
1070779065 10:79127087-79127109 GCAGGAGGGAAGGAGGCAGAAGG - Intronic
1071028359 10:81141952-81141974 GAGGGAGGGAAGGAGGGGCAAGG - Intergenic
1071129051 10:82370366-82370388 GAGGGATGTCTGGATGCTGAGGG - Intronic
1071359334 10:84830221-84830243 TAAGGAGGTAAGGATGATGAGGG - Intergenic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071406293 10:85336224-85336246 GAGGCTGGGAAGGATACTGGGGG + Intergenic
1071444794 10:85735881-85735903 GAGGGAGGGAAGGAGGGAAAGGG + Intronic
1071554891 10:86594363-86594385 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
1071627382 10:87186415-87186437 GAGAGAGGGTTGGATGGTGAAGG - Intronic
1071651768 10:87399120-87399142 GGAGGATTGAAGGATGCTGATGG - Intergenic
1071786469 10:88905860-88905882 CAGGGAGGGCAGGAGGCTCAGGG + Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072187898 10:93060088-93060110 GAGGGAGGGAAGGATGTGCAGGG + Intergenic
1072609537 10:97007985-97008007 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
1072897402 10:99378582-99378604 GAGGGAGGGATGGAACCTGGGGG + Intronic
1072976214 10:100061077-100061099 GAGGCTGGGAAGGATGGTGGGGG + Intronic
1073047126 10:100646128-100646150 GAGGGAGGGGAGGAGGCTGGGGG + Intergenic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1073214378 10:101828558-101828580 GAGGGAGGGAGGGATTCTGGAGG - Intronic
1073229091 10:101951905-101951927 GAGGGAGGGAAGGAGGGAGGGGG + Intronic
1073484747 10:103809655-103809677 GAGGGAGGGAGGGAGGGAGAGGG - Intronic
1073607251 10:104908940-104908962 CAGGCAGGGAAGGATGCTCTAGG + Intronic
1073944041 10:108730184-108730206 GAGGGAGGGAAGTAAGTAGAGGG + Intergenic
1073944078 10:108730288-108730310 GAGGGAGGGAGGGAGGTAGAGGG + Intergenic
1074110995 10:110422841-110422863 GAGGGAAGGAAGGAGGCTATAGG + Intergenic
1074405662 10:113178385-113178407 GAGGGAGAGAAGGAGGGAGATGG + Intergenic
1074413931 10:113250632-113250654 GAGTGAGGGGAGCATGCGGAAGG - Intergenic
1074540258 10:114359441-114359463 GATGGTGCGAAGGAGGCTGAAGG + Intronic
1074728940 10:116347831-116347853 GAGGGAGGGAAGAATGGTGGAGG - Intronic
1074827986 10:117228456-117228478 GAGAGAGGGAAGGAGGAGGAAGG - Intergenic
1074967491 10:118504261-118504283 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1075077370 10:119360146-119360168 GAGGGGGTGAAGGAAGTTGAGGG + Intronic
1075094949 10:119465203-119465225 GAGGGAGGGAAGGAAGGAAAAGG + Intergenic
1075096761 10:119476762-119476784 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
1075153186 10:119953539-119953561 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1075153206 10:119953602-119953624 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1075153226 10:119953665-119953687 GAGGGAAGGAAGGAAGGAGAAGG - Intergenic
1075329163 10:121560275-121560297 GCTGGAGGCAAAGATGCTGAGGG - Intronic
1075616447 10:123893481-123893503 GAGGGAGAGGAGGAGGCTGCTGG + Intronic
1075704090 10:124488648-124488670 CAGGCAGAGAAGGATGCAGAAGG + Intronic
1075908016 10:126099350-126099372 GAGGGAGGGAAGGAGGGAGAAGG - Intronic
1076189073 10:128470215-128470237 GAGCGAGTGAAGGATGCAGCCGG + Intergenic
1076402554 10:130193536-130193558 GTGGGAGGGAAGGTGGCTGTGGG - Intergenic
1076681344 10:132173110-132173132 GAGAGAGGGAAGGAGGGGGAGGG - Intronic
1076744849 10:132507706-132507728 GAAGGAGGGAAGGAAGCTTTGGG + Intergenic
1076808016 10:132869057-132869079 GAGGGAGGGAGGGGCGGTGAGGG - Intronic
1076825095 10:132963238-132963260 GATGGAGGGAGGGATGTTAATGG - Intergenic
1076825101 10:132963264-132963286 GATGGAGGGAGGGATGTTGACGG - Intergenic
1076825126 10:132963384-132963406 GATGGAGGGAGGGATGTTGATGG - Intergenic
1076825134 10:132963414-132963436 GATGGAGGAAGGGATGTTGATGG - Intergenic
1076825141 10:132963444-132963466 GATGGATGGAGGGATGTTGATGG - Intergenic
1076825147 10:132963470-132963492 GATGGAGGGAGGGATGTTGATGG - Intergenic
1076825155 10:132963500-132963522 GATGGAGGGAGGGATGTTGATGG - Intergenic
1076825163 10:132963530-132963552 GATGGAGAGAGGGATGTTGATGG - Intergenic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077262690 11:1631232-1631254 GTGGGAGGGAGGGAAGCTCAGGG + Intergenic
1077272212 11:1686713-1686735 GAGGCAGGGAAGGAGGGGGAGGG - Intergenic
1077431514 11:2518141-2518163 GAGGGAGGGAATGCAGCTGGTGG + Intronic
1077479663 11:2807688-2807710 GTGGGTGGGGAGGAGGCTGAGGG - Intronic
1077555565 11:3224433-3224455 GAAGGAGGGAGGGAGGCAGAAGG - Intergenic
1078163410 11:8862041-8862063 GAGGGAGGGAGGGGAGATGAAGG + Intronic
1078406184 11:11071802-11071824 GAGGAAGGGAAGACTGCTAAGGG - Intergenic
1078442539 11:11379296-11379318 GAGGGAGGTCAGGAGGCAGAGGG + Intronic
1078488864 11:11750770-11750792 GAGGGAGAGGAGGATGCATAAGG + Intergenic
1078611080 11:12820040-12820062 GAGGGAGGGTGGGAAGGTGAAGG + Intronic
1078901450 11:15646563-15646585 GAGGGAAGGAAGGAAGGAGAGGG + Intergenic
1078901461 11:15646589-15646611 GAGGGAGGGAGGGATGGAGAGGG + Intergenic
1079104634 11:17562768-17562790 AAGGGAGGGACGAATGTTGAAGG - Intronic
1079307274 11:19334285-19334307 GATGGAGGGAAGGATGATATGGG + Intergenic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079478495 11:20857121-20857143 GAGGGAGAGAGGGAAGCTGTTGG + Intronic
1079506302 11:21156059-21156081 GACAGGGGGCAGGATGCTGATGG + Intronic
1079568133 11:21908461-21908483 GAGGGAGGGAAGGAGGGAGAAGG - Intergenic
1079761595 11:24336014-24336036 GAGGGAGGGAAGGAGGGAGGGGG - Intergenic
1079822518 11:25148399-25148421 GAAGGAGGGAAGGAGGGAGAGGG + Intergenic
1079934561 11:26600620-26600642 GAGGGAGGGAAGGAGGGAGGGGG - Intronic
1079966682 11:26988625-26988647 AAGGAAGGGAAGGAGGTTGAAGG - Intergenic
1080012141 11:27471010-27471032 GAGAGAGGAAGGGATCCTGAGGG - Intronic
1080036827 11:27719708-27719730 GAGGGAGGGATGGAGGCTGGAGG + Intronic
1080050232 11:27851945-27851967 GAGGGAGGGAGGGAGGAAGAAGG - Intergenic
1080176121 11:29365185-29365207 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1080230874 11:30016954-30016976 GAGAGAGGGATGGATGTTGGAGG - Exonic
1080601320 11:33822743-33822765 GAGGCTAGGAAGGATACTGAGGG - Intergenic
1080643172 11:34169825-34169847 GGGGGAGGGCAGGATGGGGACGG - Intronic
1080685211 11:34509624-34509646 GGGAGGGGGTAGGATGCTGAGGG + Intronic
1080749808 11:35141319-35141341 CAGGGAGGGAAGGATTTTGGTGG + Intronic
1080920810 11:36707759-36707781 GAGGGAGGGAGGGAGGGAGAAGG - Intergenic
1081448477 11:43151819-43151841 GAGGGAGACAAGGATACTAATGG + Intergenic
1081492731 11:43580198-43580220 GAGGGAGGGAGGGAGAGTGAGGG + Intronic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1081804174 11:45881281-45881303 GAGGGAGGGAAGGAGGTCTAGGG - Exonic
1082234800 11:49811406-49811428 GAAGAAGGGAGGGAAGCTGAAGG + Intergenic
1082773964 11:57231537-57231559 GAGGCAGGGAGGGAGACTGAGGG - Intergenic
1082786193 11:57318355-57318377 GAGGGAGAGAAGGAAGATGGCGG + Intronic
1082849819 11:57754723-57754745 GAGGGAGGGAGGGAGGGGGAGGG - Intronic
1082849844 11:57754823-57754845 GAGGGAGGGAGGGAGGAGGAGGG - Intronic
1083260189 11:61518511-61518533 TAGGGAGGGGAGGACCCTGAGGG - Exonic
1083317664 11:61826696-61826718 GAGTGAATGAAGGATGCTCAGGG + Intronic
1083613197 11:64014139-64014161 GAGGAAGGGCAGGGTGCTGTGGG + Intronic
1083633701 11:64108946-64108968 GTGGGCAGGAAGGAGGCTGAGGG + Intronic
1083731845 11:64656536-64656558 GGGGTGGGGAGGGATGCTGAAGG + Intronic
1083941781 11:65899993-65900015 GACGGAGGGACGGACGCGGACGG + Intronic
1083961242 11:66016144-66016166 GAAGCAGGGAATGAGGCTGAAGG - Intergenic
1083990740 11:66244355-66244377 CAGGGAGGGAAGGAGCCTGCTGG - Exonic
1084042432 11:66550020-66550042 GAGGAAGGAAAGGTGGCTGAGGG + Intronic
1084047621 11:66579110-66579132 GAGGGAGGACTGGATTCTGAGGG + Intergenic
1084155249 11:67309644-67309666 GAAGGAGGGAAGGACACTGAGGG - Intronic
1084596272 11:70118787-70118809 GATGGATGAATGGATGCTGAAGG + Intronic
1084596315 11:70118973-70118995 GATGGATGGATGGATGCTGGAGG + Intronic
1084624650 11:70296747-70296769 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1084640256 11:70421590-70421612 GGGGGAGGGTAGGAGGCTGGTGG - Intronic
1084738773 11:71123965-71123987 CAGGGAGGGGATGATGATGATGG + Intronic
1084742786 11:71150145-71150167 GAGGGAGGGAGGGAAGGAGAGGG + Intronic
1084742788 11:71150149-71150171 GAGGGAGGGAAGGAGAGGGAGGG + Intronic
1084742799 11:71150177-71150199 GAGGGAGGGAGGGAAGGAGAGGG + Intronic
1084742801 11:71150181-71150203 GAGGGAGGGAAGGAGAGGGAGGG + Intronic
1084742806 11:71150195-71150217 GAGGGAGGGAAGGAGAGGGAGGG + Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085311651 11:75520475-75520497 GAGGGAGGGGAGGATTCGGTGGG + Intronic
1085328640 11:75628256-75628278 GAGGGACTGCAGGATGCTGGGGG + Intronic
1085419153 11:76340755-76340777 GTGAGAGTGGAGGATGCTGATGG + Intergenic
1085513674 11:77100349-77100371 GAGGGAGGGGAGGAGGCAGAGGG - Intronic
1085658862 11:78343392-78343414 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1085998212 11:81947971-81947993 GAGGGAGGGAGGGAAGCGGGGGG + Intergenic
1086452868 11:86934415-86934437 AAGGGAGGGAGGTATGATGAGGG - Intronic
1086540279 11:87900738-87900760 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
1086571639 11:88291523-88291545 GAGGGAGGGAAGGAGGAAGGAGG + Intergenic
1086740506 11:90362341-90362363 GAGCAAGGGAAGAATGATGAAGG - Intergenic
1087076989 11:94134662-94134684 GAGGGAGAGAAGGAGGAAGAGGG - Intronic
1087124334 11:94608151-94608173 GTGGGAGAGAGGGAGGCTGAGGG - Intronic
1087161043 11:94948405-94948427 GAGGGAGGGAGGGAGACAGAGGG - Intergenic
1087594390 11:100235442-100235464 GAGGGCGAGGAGTATGCTGAGGG + Intronic
1087708149 11:101519035-101519057 GAGGCTGGGAAGGGTACTGAAGG + Intronic
1088076732 11:105858657-105858679 GAGGCTGGGAAGGATAGTGAGGG - Intronic
1088209832 11:107442804-107442826 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1088209844 11:107442844-107442866 GAGGGAGGGAGGGATAGAGAGGG + Intronic
1088394124 11:109348049-109348071 GAGGGAGGGAAGGAAGGAGAGGG - Intergenic
1088457097 11:110044328-110044350 GAGGAATGGAAGGAGGCAGAGGG - Intergenic
1088590727 11:111400403-111400425 GAGGGAGGGAAGGAGAGAGATGG - Intronic
1088609341 11:111562377-111562399 AAGGGAAGGGAAGATGCTGAGGG - Intergenic
1088713584 11:112529308-112529330 GAGGGAAAGAAGGCTGGTGATGG + Intergenic
1088738349 11:112746857-112746879 GAGGAAGGGAAGGAGGGAGATGG + Intergenic
1088979712 11:114851289-114851311 GAGGGAGGGAAGCAGGGAGAAGG - Intergenic
1089029389 11:115308783-115308805 GAGGGAGGGAGGAAGGATGAAGG - Intronic
1089134295 11:116237013-116237035 GAGGATGGGCAGGATGTTGATGG + Intergenic
1089196372 11:116696095-116696117 GAGGGAGGGGAGGAAGAGGATGG - Intergenic
1089197896 11:116705858-116705880 GGGTGAGGGAATGATGCTGGGGG + Intergenic
1089235019 11:117016354-117016376 GAGGGAGGGAGGGAAGGAGAGGG + Intronic
1089235021 11:117016358-117016380 GAGGGAGGGAAGGAGAGGGAGGG + Intronic
1089278829 11:117358328-117358350 GAGGGAGACAAGCATGCTGAGGG - Intronic
1089293013 11:117449887-117449909 GAGGGAAGGGAGGATGGGGATGG - Intronic
1089393597 11:118118676-118118698 GAGGGAGGGAAAGAGGCAAAGGG - Exonic
1089411013 11:118242887-118242909 GAGGGAGGGGAGCAGGCAGAGGG + Intronic
1089539703 11:119182379-119182401 GAGAGAGGGAAGTAGTCTGAAGG - Intronic
1090271543 11:125389504-125389526 GAGGGAGTGAAGGATGAAGCCGG - Intronic
1090357063 11:126147217-126147239 GAGGGAGGAAAGGAAGGGGAGGG - Intergenic
1090410345 11:126503767-126503789 GAGGGAGGGAAAGAGGGAGAGGG - Intronic
1090440634 11:126722289-126722311 GAGGGAGTGAACCATGCAGATGG - Intronic
1090624155 11:128591249-128591271 CAGTGAGGGAAGGTTGCTGGTGG - Intergenic
1090995115 11:131859068-131859090 GATGGATGGATGGATGTTGAAGG - Intronic
1091118241 11:133035052-133035074 GCGGGAGGAAAGGATGCTCTGGG + Intronic
1091596535 12:1882538-1882560 GTGGGAGGGAGGGATGATGAGGG + Intronic
1091633168 12:2177549-2177571 GAGGGAGGGAAGGAAAGGGAAGG - Intronic
1091652165 12:2318742-2318764 GAGAGAGGGAAGGAGGGAGATGG + Intronic
1091658228 12:2361510-2361532 GAAGGAGGGAGGGAGGCAGAAGG - Intronic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1091842017 12:3628130-3628152 GAGGGAGGGAGGAAGGGTGAAGG - Intronic
1091858823 12:3760443-3760465 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1091874590 12:3923680-3923702 GAGGGAGGGAAGGAGGAAGGAGG - Intergenic
1092145792 12:6213826-6213848 GAGGGAGGGAGGGAAGATGCTGG - Intronic
1092334285 12:7614978-7615000 GAGGGAGGGAAGGAAGGAGAAGG + Intergenic
1092413929 12:8275288-8275310 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
1092756294 12:11766509-11766531 GAGGAAGGGAAGCATGAAGAAGG - Intronic
1092817227 12:12322912-12322934 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1092882725 12:12900524-12900546 GAGGGAGGAAAGGAAGAGGAGGG - Intronic
1092996915 12:13959354-13959376 GAGGGAGGTCAGGCTGCAGAGGG + Intronic
1093183996 12:15999088-15999110 GAGGGATGGAGGGTTGGTGAGGG + Intronic
1093683516 12:22030399-22030421 GAGGGATGTCTGGATGCTGAGGG + Intergenic
1093778948 12:23111858-23111880 GAGAGAGGGAAGGAGGGAGAGGG - Intergenic
1094157670 12:27354424-27354446 GAGGGTGGGAAGAAGGGTGAGGG + Intronic
1094359987 12:29620317-29620339 GGGGGAGGGAAGGCTGTGGAGGG - Intronic
1095053540 12:37575504-37575526 AAGAGACGGAAGGGTGCTGAAGG - Intergenic
1095752743 12:45729467-45729489 GAGGGAGGGAAGGAAGGGGTGGG + Intergenic
1095882838 12:47156667-47156689 AATGGAGGAAAGGATGCTTAAGG - Intronic
1095908677 12:47403793-47403815 GAGAGAGAGAAGAATTCTGAAGG - Intergenic
1095986692 12:48004169-48004191 GCCGGGGAGAAGGATGCTGAGGG + Intronic
1096155081 12:49337149-49337171 GAGGGAGGGGAGGAAGGTTAGGG - Exonic
1096345583 12:50843130-50843152 GAGGGAGGGGCGCATGCAGAGGG + Exonic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1096682905 12:53268684-53268706 GAGGAAGGGAAGAGGGCTGAAGG - Intronic
1096734118 12:53639538-53639560 GAGGGAGGGAAAGAAGAGGAAGG - Intronic
1096745825 12:53726286-53726308 GATGGAAGGATGGAGGCTGAGGG - Intronic
1096751508 12:53761721-53761743 AAAGGAGGGAAGGATGCTGGAGG - Intergenic
1096919447 12:55068316-55068338 CAGGGCTGGAAGGATGCTAAGGG + Intergenic
1096943201 12:55372496-55372518 GAGGGAGGGAAGGAAGGAAAGGG + Intergenic
1096987222 12:55768093-55768115 GAGGGAGGGAAGGAGGGAGATGG - Intronic
1096996322 12:55840431-55840453 GAGGGAGGGAAGGAGAGAGAAGG + Intronic
1097029302 12:56080071-56080093 GAGGGAGGGAGGAACGCAGAGGG - Exonic
1097107284 12:56633276-56633298 GGGAGAGGGAAGGATGTAGAGGG - Intronic
1097397850 12:59097769-59097791 AAGGGAGAGAAGGAGGATGAAGG + Intergenic
1097629510 12:62042891-62042913 GAGGAAAGGCAGGGTGCTGACGG - Intronic
1097770443 12:63578303-63578325 GAGGCTGGGAAGGATAGTGAGGG + Intronic
1097913462 12:64995205-64995227 GAGGGAGGAGAGGGAGCTGAAGG + Intergenic
1098216384 12:68224666-68224688 GAGGGAGGGAAGGAGGGTGGAGG + Intronic
1098919171 12:76287134-76287156 GAGGGAGGGAGGGATGGAGGAGG + Intergenic
1099169736 12:79349180-79349202 GAGGGAAGGAAGGAAGGGGAAGG + Intronic
1099177214 12:79435836-79435858 GAGAGAGGGAGGGATGCTATAGG - Intronic
1099185729 12:79513886-79513908 AAGGGAGGGAAGGAAGAAGAGGG - Intergenic
1099260979 12:80382472-80382494 GAGGAAGGGAAGGAGGCCCATGG - Intergenic
1099274509 12:80558076-80558098 GAGGGAGGGAGGGAAGGGGAGGG - Intronic
1099657984 12:85520098-85520120 GAGGGTGGGAAGGATAGTGAGGG + Intergenic
1100054863 12:90496960-90496982 GAGGGAGGGAAGGGGAGTGAGGG + Intergenic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1100272820 12:93042651-93042673 GAGGGAGGGAGGGAAGGAGAGGG + Intergenic
1100324058 12:93524397-93524419 GAGGGAGGGAAGCATGTTCTGGG - Intergenic
1100700991 12:97147856-97147878 GAGAGAGGGAGGGTTGCTAATGG + Intergenic
1100793094 12:98152151-98152173 GAGGGAGGGAAGGAGGGGGAAGG + Intergenic
1100826971 12:98483718-98483740 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
1101010101 12:100440711-100440733 GAGGGAGGAAAGGAGGAAGAAGG - Intergenic
1101172519 12:102113359-102113381 GAGTAAGGGAAGGATACTTAGGG + Intronic
1101341937 12:103849826-103849848 GAGTTGGGGAATGATGCTGAAGG - Intergenic
1101434120 12:104650599-104650621 GAGGGAGGAAATGATGGTGGGGG + Intronic
1101625284 12:106434778-106434800 GAAGGAGGAAAGGATGCTGGAGG - Intronic
1101638036 12:106562754-106562776 GAGGGAGGAAGGAATGCTAAGGG - Intronic
1101963789 12:109268368-109268390 GATGCAGTGAAGGAAGCTGAAGG + Intergenic
1102042754 12:109811072-109811094 GAGGGAGGGAAGGGTGTTGTAGG - Intronic
1102064651 12:109963856-109963878 GAGGGAGATAAGGATCCTGCAGG - Intronic
1102390169 12:112543300-112543322 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1102451489 12:113045040-113045062 GAGGGAGGGAAGGATGGAGGGGG + Intergenic
1102663506 12:114549775-114549797 GAGGGTGAGAAGGATGAAGATGG + Intergenic
1102695728 12:114797883-114797905 GAGGGAGAGAAGGTGGCTCAGGG - Intergenic
1102856106 12:116295500-116295522 GATGGAGGGATGGAGGATGAAGG + Intergenic
1102991997 12:117322311-117322333 GAAGGAGGGAAGGAAGAGGAGGG - Intronic
1103013397 12:117475363-117475385 GGGGGAGGAAAGGGAGCTGATGG - Intronic
1103084506 12:118052205-118052227 GAGAGAGGGAAGGTGGCTCATGG - Intronic
1103726229 12:122998618-122998640 GGGGCAGGGAAGGGAGCTGAAGG + Intronic
1103917820 12:124385040-124385062 GAGGAAGGGAAGGAGGAGGAAGG + Intronic
1103918762 12:124388898-124388920 GAGGGAGGGAGGGACGCGGCGGG + Intronic
1103954525 12:124568701-124568723 GAGGGAGGGAGGGAGGCTCCAGG - Intergenic
1104095087 12:125549934-125549956 CAGGGAGAGAAGGATGGTGTAGG - Intronic
1104114711 12:125738242-125738264 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1104463222 12:128971464-128971486 GAGGGAGGGAGGGAGGCAGAGGG - Intronic
1104490356 12:129188727-129188749 GAGAGAGGGAAGGAGGGAGAGGG + Intronic
1104569528 12:129912669-129912691 GAGGGAAGGAAGGAAGCAGTGGG + Intergenic
1104647380 12:130506868-130506890 GAGGGAGGGAAGGATTCTCTAGG - Intronic
1104691108 12:130827067-130827089 GAGGGAGGGAGGGGTGGGGAGGG + Intronic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1104841805 12:131829206-131829228 GTGGAGGGGAAGGAGGCTGAGGG - Intronic
1104866782 12:131960731-131960753 GAGGGAGCGAAGGGAGCTGCGGG - Exonic
1104998673 12:132674809-132674831 GAGGGAGGGAAGGAAGGGAATGG - Intronic
1104998681 12:132674831-132674853 GAGGGAGGGAAGGAAGGGAAGGG - Intronic
1105806611 13:23955183-23955205 GAGGAAAGGGAGGATGGTGAGGG + Intergenic
1106016975 13:25878865-25878887 GAGAGTGGGAAGGCAGCTGATGG - Intronic
1106565764 13:30883285-30883307 GAGGGAGAGAAGTCTGCAGACGG - Intergenic
1106567256 13:30896899-30896921 GAGACAGAGAAGGGTGCTGAGGG + Intergenic
1106923538 13:34589686-34589708 GAGGGAGGGTGGGAAGCAGAAGG + Intergenic
1107119735 13:36783123-36783145 GAGGGAGGGAAGGAGGAAAAAGG + Intergenic
1107246013 13:38294767-38294789 GAGGGAGGGAGGGAAGGAGATGG + Intergenic
1107606775 13:42065323-42065345 TAGGAAGGGAAGAATGTTGAAGG + Intronic
1107917643 13:45168904-45168926 GAGGGAGGGAAGGAAGGAGGAGG - Intronic
1107999998 13:45897199-45897221 GAGGGAGGGAAGGAGGAGGGAGG - Intergenic
1109253858 13:60053229-60053251 GAGGAAGGAAAGGATACTCACGG + Intronic
1109405831 13:61898844-61898866 GAGGGAGGGAGGGAGGAGGAGGG - Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110329187 13:74251618-74251640 GGGGGAGGGTAGGAAGATGAGGG - Intergenic
1110608516 13:77461978-77462000 GAGGGAAGGAAGGCAGCTGTGGG - Intergenic
1110705466 13:78599052-78599074 GGGGGAGGGTAGGGTGTTGAAGG - Exonic
1110862772 13:80361913-80361935 GAGGGAGTGACGGAGGCTGCAGG - Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1111620223 13:90715589-90715611 GAGGGAGGGAAAGATAATGCAGG + Intergenic
1111992825 13:95133753-95133775 GTGGCAGAGAAGGGTGCTGAAGG + Intronic
1112225836 13:97538974-97538996 GAGGTGGGGAAGGAGACTGAGGG + Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1113186127 13:107687308-107687330 GAGGGAGGGAAGGAGGGAGGGGG + Intronic
1113314439 13:109163488-109163510 GAGGGAGGGAAGGAGGGAGTGGG - Intronic
1113314451 13:109163515-109163537 GAGGGAGGGAAGGAGGGAGGTGG - Intronic
1113584533 13:111455798-111455820 GAGAGAGGGAAGGATGATGAAGG + Intergenic
1113680687 13:112242234-112242256 GATGGAGGGAAGGAGGAAGAAGG + Intergenic
1113765030 13:112875865-112875887 GACGTCGGGAAGGAGGCTGATGG - Exonic
1113780181 13:112972316-112972338 GATGGATGGATGGATGATGATGG + Intronic
1113780215 13:112972477-112972499 GATGGATGGATGGATGATGATGG + Intronic
1113918354 13:113888311-113888333 TAGGGAGGGGAGAAGGCTGAAGG + Intergenic
1114615738 14:24067423-24067445 GTGGGAGTGAAAGAGGCTGAGGG - Intronic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115490052 14:33950462-33950484 GAGGGACAGGAGGAAGCTGATGG + Exonic
1115846424 14:37540603-37540625 GAAGGAGGGAAAGATGGGGAGGG - Intronic
1116116464 14:40658022-40658044 GAAGCTGGGAAGGATGCTGGAGG - Intergenic
1116189909 14:41650913-41650935 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
1117092349 14:52263919-52263941 AAAGGAGGGAAGGAGGGTGAAGG - Intergenic
1117253589 14:53956824-53956846 GAGGGAGGGAAAGAGGAGGAAGG - Intronic
1117369383 14:55062849-55062871 GAAGGAGGAAAGGGTGCTGGGGG - Exonic
1117458011 14:55917213-55917235 GAGGAGGAGAAGGAGGCTGAGGG + Intergenic
1117625456 14:57632880-57632902 GAGGGAGGGATGGATAGGGAGGG - Intronic
1117937797 14:60926784-60926806 TAGGGAAGGGAGGAGGCTGAAGG - Intronic
1118329227 14:64802759-64802781 GAGGCAGGGAAGCAGGCTGCTGG - Intronic
1118556425 14:67028029-67028051 GAGGCTGGGAAGGATGGTGTGGG - Intronic
1118594787 14:67427120-67427142 GGGGGAGGGAGGGATGCTTCAGG + Intergenic
1118699544 14:68419813-68419835 GAGGGAGGAAGAGAGGCTGAGGG + Intronic
1118723838 14:68612831-68612853 GAGGGAAGGAAGGAGGGAGAGGG + Intronic
1118744398 14:68763311-68763333 GAGGGAGGGAAGGATGGAGGAGG - Intergenic
1118820523 14:69342447-69342469 GAGGGAGGGAAGGTGGAAGAAGG + Intronic
1119054697 14:71407483-71407505 GAGGGAAGGAAGGAAGGGGAGGG - Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119071107 14:71585147-71585169 GAGGGAGGGAGGGAGGGAGATGG + Intronic
1119196854 14:72723425-72723447 GAGGGAGGAGAGGAGGCAGAGGG - Intronic
1119553175 14:75531797-75531819 GAGGCAGAGAAGGATGCTTACGG + Intronic
1119769004 14:77208646-77208668 GAGGTGGGAATGGATGCTGAGGG + Intronic
1120070585 14:80098122-80098144 GTGGGAGGGAAAGTTGCTAAAGG - Intergenic
1120228513 14:81817954-81817976 GAAGGAGGGAGGGATGGAGAGGG - Intergenic
1120452269 14:84683656-84683678 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1120598111 14:86465574-86465596 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1120728059 14:87968788-87968810 GATGGATGGAAGCATGTTGAAGG + Intronic
1120873770 14:89360459-89360481 GAGGGAGGGAAGGAGAAAGAGGG + Intronic
1120903114 14:89593035-89593057 GAGGGAGGGAGGGAGGAGGAAGG + Intronic
1121013634 14:90535504-90535526 GAAGGAGAGAGGGAAGCTGAGGG - Exonic
1121138116 14:91516776-91516798 GAGTCTGGGAAGGATGTTGAGGG - Intergenic
1121302830 14:92885572-92885594 GTGGGAGGGAAGGAAGGTGAGGG + Intergenic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1122096454 14:99376479-99376501 GAGGGAGGGAGGGAAGGGGAAGG + Intergenic
1122096479 14:99376543-99376565 GAGGGAGGGAAGGAAGGGGAGGG + Intergenic
1122203133 14:100134577-100134599 GTGGGAGGGAGAGAGGCTGATGG + Intronic
1122292642 14:100687866-100687888 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292647 14:100687894-100687916 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292658 14:100687950-100687972 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292663 14:100687978-100688000 GAGGGATGGAGAGATGATGACGG - Intergenic
1122392500 14:101399829-101399851 GAGGGAGGGAAGGAAGGGGAAGG + Intergenic
1122475973 14:102009173-102009195 CAGGGAGGGTGGGATGCTGAAGG + Intronic
1122604156 14:102937488-102937510 GAGGGAGGGATGCAGGCGGAGGG - Intronic
1122604158 14:102937492-102937514 GAGGGAGGGAGGGATGCAGGCGG - Intronic
1122738871 14:103859445-103859467 GAGGGAGGGAAGGAAGGGAAGGG + Intergenic
1122793715 14:104195267-104195289 GAGGCAGGGAAGGGTGGTGCGGG + Intergenic
1122930828 14:104932448-104932470 GAGGGAGGGGCTGCTGCTGAAGG + Intronic
1123040949 14:105490092-105490114 GCCGGAGGGAAGGAGGCTGCGGG + Intronic
1123045602 14:105512149-105512171 GAGGGAGGGAAAGCTGCAGCTGG - Intergenic
1123885650 15:24725418-24725440 AAGGGAGGGAAGGAAGCAGCTGG - Intergenic
1124045199 15:26142531-26142553 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1124220539 15:27846773-27846795 GGAGGAGGAAAGGATGTTGAAGG + Intronic
1124239038 15:28014896-28014918 CAGGGAGGCCCGGATGCTGATGG + Exonic
1124813937 15:32969068-32969090 GGGGGAGGGATGGATGCGGGAGG + Exonic
1124858670 15:33415854-33415876 GAGGGAGGGAGGGATGAAGGTGG - Intronic
1124916299 15:33978022-33978044 GAGGGATGGAAGGATGGAGGAGG + Intronic
1124993584 15:34700353-34700375 GAGGGAGGAATGGATGAAGAGGG - Intergenic
1125206701 15:37161559-37161581 GAGGGAGGGAAGGAAAGAGAGGG - Intergenic
1125540714 15:40468382-40468404 GAGTGAGGGAAGGAGACAGAGGG + Intergenic
1125574319 15:40744932-40744954 GAGGGAGGGAGGGAAGGAGAAGG + Intronic
1125617823 15:41031485-41031507 GAGGGAGGGGAGGAAGGAGAAGG + Intronic
1125691470 15:41599476-41599498 GAGGAAGTGAGTGATGCTGAGGG + Intergenic
1125817218 15:42596395-42596417 GAGGAAGAGAAGTATGATGATGG + Intronic
1126167626 15:45667006-45667028 GAGGGAGGGAGGGAGGGGGAAGG - Intronic
1126171252 15:45697017-45697039 GAGGGAGGGAGGGAAGGAGAAGG - Intergenic
1126487526 15:49198835-49198857 GAGGGAGGGAGGGAGGGAGAGGG - Intronic
1126837341 15:52679797-52679819 GAGGGGGGGAAGGAGGGGGAGGG - Intronic
1126940428 15:53759830-53759852 GAGGGAGGGAGGGAGGCAGCGGG - Intronic
1127267524 15:57374091-57374113 GAGGGAGGGAAGGCAGGAGAAGG - Intergenic
1127375079 15:58376854-58376876 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
1127660743 15:61098089-61098111 GAGGGAGGGAAGGAGGAAGGAGG - Intronic
1127698781 15:61476913-61476935 GAGGGAGGAAATGTTGCAGATGG - Intergenic
1128016953 15:64356100-64356122 GAGGGAGGGGAGAAGGCGGACGG + Exonic
1128211975 15:65909338-65909360 GAGGGAGGGAGGGAAGGAGAGGG - Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1128793382 15:70449047-70449069 GAGGGAGGGAGGGAGGCAGGGGG + Intergenic
1128797849 15:70478249-70478271 TGGGGTGGGAGGGATGCTGAGGG - Intergenic
1129020510 15:72513717-72513739 GAGGGAGGGAAGGAGGGACAGGG - Intronic
1129020547 15:72513791-72513813 GAGGGAGGGAAGGAGGGAGAGGG - Intronic
1129117570 15:73373641-73373663 GAGGGAGGGAGGGAGGCAGGGGG + Intergenic
1129146576 15:73653337-73653359 GAGTAAGTGAAGGAAGCTGAGGG - Intergenic
1129228765 15:74184873-74184895 GAGGGAGGGAAGGGCTCTGCCGG - Intronic
1129332127 15:74833133-74833155 GAGGGAGGGAAGGAAGGAGCAGG - Intergenic
1129491139 15:75926723-75926745 GAGAGAAGGAAGGATGGGGAAGG + Intronic
1129503720 15:76063578-76063600 GGAGGAGGAAAGGATGCTGTGGG - Intronic
1129517616 15:76166214-76166236 GGGGAGGGGAAGGATGCTGCGGG + Intronic
1129832745 15:78681419-78681441 GAGGGAGGGATGGAGGCAGGAGG - Intronic
1130698375 15:86154338-86154360 GAGGAAGGGGAAGATGGTGAAGG - Intronic
1130740057 15:86589726-86589748 GAGGGAGGAAAGGAGGAGGAAGG - Intronic
1130813733 15:87408576-87408598 GAGGGAGAGAAGGAGAGTGAAGG + Intergenic
1130877470 15:88027131-88027153 AGGGGAGGGATGGATGCTGGAGG + Intronic
1131352819 15:91717282-91717304 GAGGGAAGGAAGGATTGTGTGGG - Intergenic
1131793343 15:95988418-95988440 GAGGGAGGGAAGGAAGAGGGAGG + Intergenic
1131810056 15:96163661-96163683 GAAGGAGGGAAGGAGGAAGAAGG + Intergenic
1132199936 15:99944343-99944365 CAGGGATGGAAAGGTGCTGAGGG + Intergenic
1132379981 15:101359566-101359588 GAAGGAAGGAAGGCTGCAGATGG + Intronic
1132519036 16:379006-379028 CAGGGAGGGAAGGATGCCCAAGG - Intronic
1132664369 16:1074785-1074807 ATGGGAGGGATGGATGCTGCTGG + Intergenic
1132736821 16:1390307-1390329 CTGCGAGGGAAGGATGCAGATGG - Intronic
1132865534 16:2091194-2091216 GAGGGCGGGAGGGACGCTGCCGG + Intronic
1133002395 16:2857964-2857986 GAAGGAGGGAAGGAGGGTGGAGG + Intronic
1133083791 16:3345701-3345723 GAGGGAGGGAAGGAAGGAAAGGG - Intergenic
1133252068 16:4489309-4489331 GAGAGAGGGAGGGAGGATGATGG - Intronic
1133594009 16:7273036-7273058 GAGGGAGGGAAGGGAGGGGAAGG - Intronic
1133717905 16:8466970-8466992 GAGGGAGGGACGGATGCGGGTGG + Intergenic
1133717937 16:8467088-8467110 GAGGGAGGGAGGGATGAGGAAGG + Intergenic
1133749502 16:8713570-8713592 GAGGGACGGAGGGAAGGTGAAGG - Exonic
1133839258 16:9394026-9394048 GAGGGAGGGAAGAAGGGGGATGG - Intergenic
1134052487 16:11146513-11146535 GAGGGAGGGATGGGTGTAGAAGG + Intronic
1134149733 16:11796725-11796747 GGGGGCGGGAAGGATGCCGGCGG - Intronic
1134265358 16:12687948-12687970 GAAGGAGGGAAGGAAGAAGAAGG + Intronic
1134459084 16:14416127-14416149 AAGGGAGGGAAGGAGGAAGAAGG + Intergenic
1134566522 16:15256700-15256722 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1134735974 16:16499999-16500021 AAGTGAGGGAAGGAGGATGATGG + Intergenic
1134866332 16:17610680-17610702 GAGGGAGGGAGGGAGGAAGAAGG - Intergenic
1134931550 16:18212160-18212182 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1135663338 16:24315407-24315429 GAGGGAGGGAGAGATGATGATGG - Intronic
1135922499 16:26663652-26663674 GAGGGAGGGAAGGGAGAAGAAGG + Intergenic
1135939573 16:26809660-26809682 GAGGGAAGGAAGGAAGGAGAGGG + Intergenic
1136056396 16:27693003-27693025 AAAGGAGTGAAGGAAGCTGAAGG - Intronic
1136071421 16:27789844-27789866 GATGGATGGATGGATGATGAAGG + Exonic
1136366785 16:29812599-29812621 GGAGGAGGGGAGGATGCAGAGGG + Intronic
1136473336 16:30496366-30496388 GAGGGAGGGAAGGATCGGGCTGG - Intronic
1137469548 16:48742488-48742510 GAAGGAGGGCAGGGTGGTGACGG - Intergenic
1137619558 16:49867453-49867475 GGGGGAGGGAAGGCAGGTGAGGG + Intergenic
1137701502 16:50501214-50501236 GAGGAAGGAAAGGATTCTGCAGG + Intergenic
1138294189 16:55872773-55872795 GTGTCAGGGAAGGGTGCTGAGGG - Intronic
1138442063 16:57041068-57041090 GAAGGGGGGAAGAGTGCTGATGG - Intronic
1138495444 16:57406100-57406122 GAGGAAGGGAAGGTTGCTTGAGG + Intronic
1138538868 16:57676158-57676180 GGGGGAGGGTAGGATCCTGCAGG - Intronic
1138612772 16:58140523-58140545 GAGGGAGGGAGGGAAGAAGAGGG - Intergenic
1138923697 16:61565206-61565228 GAGGAAGGGAAGGAGTATGAAGG + Intergenic
1139173360 16:64658078-64658100 TAGGGAGAGAAGTATGATGATGG + Intergenic
1139300607 16:65942286-65942308 GAGGAAGGGAGGGATGGGGAGGG + Intergenic
1139518051 16:67463551-67463573 GAGGGAGGGAGGGAGGAAGAAGG + Intronic
1140828058 16:78726081-78726103 GAGGGAGGGAGGGAGGAAGAGGG - Intronic
1141331609 16:83116321-83116343 GGGGCGGGGAAGGAGGCTGATGG + Intronic
1141421926 16:83923090-83923112 GAGGGAAGGAGGGATGGAGAGGG - Exonic
1141463825 16:84194310-84194332 GAGGAAGGGAAGGGTGGTGAGGG + Intronic
1141539525 16:84708945-84708967 GAGGGAGAGAAGCAGGCTAATGG + Intronic
1141602195 16:85133720-85133742 GAGGGAGGAAAGTGTGCAGATGG + Intergenic
1141632193 16:85294177-85294199 GGTGGAGGGAAGGAGGCAGAAGG - Intergenic
1141714024 16:85716665-85716687 GAGGAAGGGAAGGAGGAGGAAGG + Intronic
1141734672 16:85844270-85844292 GAAGGAAGGAAGGAGGATGAAGG - Intergenic
1141822506 16:86456760-86456782 GAGGGAGGGAGGAAAGATGAGGG - Intergenic
1141822521 16:86456825-86456847 GAGGGAAGGAAGGAAGGAGAGGG - Intergenic
1142178867 16:88657615-88657637 CAGGGCGGGCAGGGTGCTGACGG - Intronic
1142505862 17:362851-362873 GAGGGAAGGAAGGTCGTTGATGG - Intronic
1142714140 17:1738807-1738829 GAGGGTGGGAAGGGGCCTGATGG + Intergenic
1142772212 17:2106642-2106664 GAGAGAGGGAAGGAGGATGCTGG + Intronic
1142836868 17:2593888-2593910 GAGGGAGGGAAGGAGGGGGGAGG - Exonic
1142843385 17:2651983-2652005 GAGGCAGGGAAGGATGAATAGGG - Intronic
1143152310 17:4815242-4815264 GATGGATGGATGGATGATGAAGG + Intronic
1143247368 17:5498316-5498338 GACGGAGGAAAGGAAGCTGGGGG + Intergenic
1143254422 17:5544962-5544984 GTGAGGGGGAAGGAGGCTGAAGG + Intronic
1143413380 17:6726457-6726479 GAAGGAGGAAAAGATGCTGATGG + Intergenic
1143476711 17:7207371-7207393 CAGGGAGGAAAGGCTGCAGAGGG + Intronic
1143495669 17:7311320-7311342 CAGATAGGGAAGGAGGCTGAAGG - Intronic
1143567683 17:7734401-7734423 CGGGGAGTGAAGGATGCTGTTGG + Intronic
1143611262 17:8019241-8019263 GAGAGAGGGAAGGAAGGGGAAGG - Intronic
1143910636 17:10245924-10245946 GAGAGAGGGATGGAGGGTGAAGG + Intergenic
1143965751 17:10755616-10755638 GAGGGAGGGAGGGAGAGTGAGGG - Intergenic
1143979118 17:10852856-10852878 TAGGGAGAGAATGATGATGAAGG + Intergenic
1143981306 17:10872560-10872582 GTGGGAGGGATGGATGCTAAAGG + Intergenic
1144038919 17:11391216-11391238 GAGGGTGGGCAGGAAGGTGATGG + Intronic
1144174172 17:12688592-12688614 GAGGGAAGGAAGGAAGGAGATGG - Intronic
1144212276 17:13025686-13025708 GAGGGAGGGAATGAGGTTGAGGG - Intergenic
1144295207 17:13868388-13868410 GTGGGAGTGAAGGATGGTTAAGG - Intergenic
1144374802 17:14628287-14628309 AAGGGAAGGAAGGATGGTGGCGG + Intergenic
1144670933 17:17132213-17132235 CAGGGAGGGAAGGAGGATCATGG - Intronic
1144693906 17:17288268-17288290 GAGGGGGAGGAGGATGCTGAAGG + Intergenic
1144729271 17:17517445-17517467 GAGGGAGGGCATGGAGCTGATGG - Intronic
1144776769 17:17788749-17788771 AAGGGAGAGAGGGAGGCTGAGGG - Intronic
1144777128 17:17790504-17790526 CAGGGAGGGAGGAATGCAGACGG + Intronic
1144777649 17:17792873-17792895 GAGGGAGGGGAGGATGGGCAGGG - Intronic
1144853649 17:18256714-18256736 GAGTGAGGGAGGGAAGCTGCAGG - Intronic
1144919910 17:18754738-18754760 GAGGGAGGGAAGGAGGGAGGAGG + Intronic
1145046311 17:19619703-19619725 AAGGTAGGGCAGGGTGCTGAGGG - Intergenic
1145093875 17:20008725-20008747 GAGGGTAGGGAAGATGCTGAGGG + Intergenic
1145124249 17:20287018-20287040 GAGGCAGGGGAGGCTGCTGACGG - Intronic
1145374080 17:22331525-22331547 AAGAGATGGAAGGGTGCTGAAGG - Intergenic
1145374890 17:22338135-22338157 GATGCAGGGCAGCATGCTGAGGG + Intergenic
1146051222 17:29555072-29555094 CAGGGAGAGAAGGCTGCTGAGGG + Intergenic
1146626198 17:34437347-34437369 TAGGGAGGGAAGTCTGCTGAAGG + Intergenic
1147187281 17:38719755-38719777 GAGTGCGGGGAGGCTGCTGATGG - Exonic
1147193039 17:38748241-38748263 GAGGGAGGGAAGGGAGGGGAGGG + Exonic
1147193799 17:38751962-38751984 GAGAAAGGGAAGGATCCTGATGG + Intergenic
1147250042 17:39147662-39147684 GAGGGAGGGAGGGAAGGGGAGGG + Intronic
1147671868 17:42181045-42181067 GAGGGAGGGGAGGAGGCAGGAGG - Exonic
1147684731 17:42280317-42280339 GAGAGAGGGGAGGAGGCTGTAGG - Intergenic
1147743685 17:42682693-42682715 GAGGGAGGGAAGGGTGGGTAAGG + Exonic
1147948090 17:44091804-44091826 GAGGGAGGGCTCGGTGCTGAGGG + Exonic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1148220424 17:45858008-45858030 GAGGGAAGGCTGGATGCAGATGG - Intergenic
1148233504 17:45951924-45951946 GAGAGAGGGAGGAAGGCTGATGG + Intronic
1148394189 17:47295361-47295383 GAGGGAGGAACGGGTGCTTAAGG - Intronic
1148431916 17:47649893-47649915 GAGGGAGGGAGGAAGGCGGAGGG - Exonic
1148498541 17:48070981-48071003 GGGGGAGGGAGGGATGGGGAGGG - Exonic
1148628447 17:49088336-49088358 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1148746632 17:49921953-49921975 GATGGATGGATGGATGATGATGG - Intergenic
1148789048 17:50162960-50162982 GAGGGAGAGAAGGAAGAAGAAGG + Intergenic
1148789056 17:50162990-50163012 GAGGGAGAGAAGGAAGAAGAAGG + Intergenic
1149362779 17:55911633-55911655 GAGTGTGGGAAGGAGGCAGACGG - Intergenic
1149855364 17:60078402-60078424 GAGGGAGTGAAGGAGGGTGCGGG + Intronic
1149895070 17:60422662-60422684 GAGGGAGGGAAGGAGGGTCCCGG + Intronic
1149999215 17:61422466-61422488 GAGGGAGGGAAGAAGGATGGAGG + Intergenic
1150002884 17:61452354-61452376 GAGGGAGGGAGGGAGGAGGAGGG + Intergenic
1150444476 17:65217857-65217879 GTGGAAGGGAAGGAAGCTGAAGG + Intronic
1150455476 17:65303704-65303726 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1150519587 17:65852319-65852341 GAGGGAGGGAAGGAAAGGGAAGG - Intronic
1150519633 17:65852433-65852455 GAGGGAGGGAAGGAAGGAAAGGG - Intronic
1150553338 17:66231306-66231328 AAGGGAGGGAAGGAAGGAGAAGG - Intronic
1150636074 17:66914235-66914257 GGGGCAGGGAAGCATGCTGGGGG - Intergenic
1150747834 17:67830621-67830643 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
1150775121 17:68075118-68075140 GATGGAGGGAAGCAGGCAGATGG - Intergenic
1150783446 17:68142862-68142884 GAGGGAGGGAAGGAAGGGAAGGG - Intergenic
1151100504 17:71550804-71550826 GAGGGAGGGAAGGAGGGGAAAGG + Intergenic
1151230032 17:72677859-72677881 GAGGGAGAGAAGGCTACCGACGG + Intronic
1151327643 17:73388886-73388908 GAGGGAGGGAGGGAGGGAGAAGG - Intronic
1151348781 17:73519297-73519319 GAGGGAGAGATGGAAGCTGGGGG + Intronic
1151373208 17:73663626-73663648 AAGGCAGGGAATGAAGCTGATGG - Intergenic
1151677173 17:75604534-75604556 GAGGGAGGGAGGGGTGTGGAAGG - Intergenic
1151777804 17:76219527-76219549 GAGGGAGGGAACGAAGTAGAAGG + Intronic
1151842517 17:76628236-76628258 GAGGGAGGGAGGGAGGGAGAAGG - Intronic
1151869029 17:76824098-76824120 GGTGGGTGGAAGGATGCTGAAGG - Intergenic
1152050735 17:77974039-77974061 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1152129642 17:78468314-78468336 CACGGAGGGATGGATGCTCAAGG - Intronic
1152141013 17:78536748-78536770 GGGGGTTGGAAGGATGATGAGGG + Intronic
1152204716 17:78968360-78968382 GAGGGAGGAAAGGATGATTTGGG - Intergenic
1152256837 17:79244867-79244889 GAGGGAGGGAAGGAAAGGGAAGG - Intronic
1152291474 17:79442337-79442359 GAGGGAGGGAGGGAGGAAGAGGG + Intronic
1152456923 17:80422010-80422032 GGGGGAGGGAAGGCTGCTGCAGG + Intronic
1152528305 17:80902304-80902326 GACGGGGGGCAGGAGGCTGAAGG - Intronic
1153089964 18:1331918-1331940 GAGGTAAGGAAGAATGCTCATGG + Intergenic
1153092705 18:1366586-1366608 GAGGGAGAGAAGGAGGAAGAGGG - Intergenic
1153366792 18:4265633-4265655 GAGGGAGGGAGGGAAGGGGAGGG - Intronic
1153397418 18:4640458-4640480 AAGGGAGGGAAGGAGCCCGAGGG + Intergenic
1153834154 18:8949337-8949359 GAGGAAGGCAAGGATGTGGAGGG + Intergenic
1154392078 18:13946672-13946694 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
1156591026 18:38488471-38488493 GAGGGAGAGATAGATGTTGAGGG + Intergenic
1156826352 18:41434502-41434524 GAAGGAGGGAGGGATGATGTGGG + Intergenic
1156997519 18:43485482-43485504 GAGGGAGGGATGAGTCCTGATGG - Intergenic
1157479626 18:48045122-48045144 GAGGGAGGGAAGGATTTGGGTGG + Intronic
1157483903 18:48073622-48073644 GAAGGAGAGAAAGAGGCTGAGGG - Intronic
1157576682 18:48748370-48748392 GAAGGAGGGAGGGATAATGATGG + Intronic
1157690083 18:49674443-49674465 GAGGGAGGGAGGGAAGGAGAGGG + Intergenic
1157690084 18:49674447-49674469 GAGGGAGGGAAGGAGAGGGAAGG + Intergenic
1157693332 18:49701159-49701181 GAGAGAGTGAAGGATTCTCAGGG - Intergenic
1157749103 18:50162273-50162295 GAGGGAGGGAGGGATGGTTCAGG - Intronic
1157883015 18:51340202-51340224 GCGGGAGAGAAGGAGGGTGATGG - Intergenic
1158103805 18:53861435-53861457 GAGGGAGGGAGGGAGGAAGAAGG + Intergenic
1158103841 18:53861530-53861552 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1158278204 18:55791910-55791932 GTGGGAGGGCAGGATGGGGAGGG - Intergenic
1158457540 18:57621554-57621576 GAGGGAGGGAGGGAGGGTGCTGG - Intronic
1158570727 18:58595198-58595220 GAGGGAGGGAAGGCGCATGACGG - Intronic
1158594567 18:58804833-58804855 GAGAGAAGGAAGGAAGCTGTGGG - Intergenic
1158887685 18:61844211-61844233 GAGGGAGGGAAGGAGGGAGACGG + Intronic
1159301600 18:66578993-66579015 TCAGGAGGGAAGGATGATGAAGG + Intronic
1159310225 18:66698355-66698377 GAGGGAGGGGAGGAGGAGGAAGG + Intergenic
1159310249 18:66698427-66698449 GAGGGAGGGGAGGAGGAGGACGG + Intergenic
1159550804 18:69894432-69894454 GAGGGAGGGAAGGGAGGGGAGGG + Intronic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1159586084 18:70284788-70284810 GAGGGAGGGAAGGAAGTGGAGGG + Intergenic
1159653131 18:71000654-71000676 GAGGGAGGGAGAGATGGGGAGGG + Intergenic
1159754225 18:72343695-72343717 GATGGAGGGAAGCAGGCTGAAGG + Intergenic
1160237691 18:77099003-77099025 GGAGGAGGGAAGGAGGATGACGG - Intronic
1160248410 18:77179767-77179789 TAAGGAGGGAAGGAGGCAGAAGG + Intergenic
1160252661 18:77216996-77217018 GAGAGAGGGGAGAATGCTGATGG - Intergenic
1160325864 18:77948023-77948045 GAGGGCGGGATGCATCCTGAAGG + Intergenic
1160356094 18:78229543-78229565 GAGGGAGGGAAGGGGGAGGAAGG - Intergenic
1160502484 18:79409091-79409113 GATGGATGGATGGATGATGATGG - Intronic
1160546108 18:79657093-79657115 GAGGGATGGCAGGATGGAGATGG + Intergenic
1160838669 19:1136629-1136651 GAGGGAGCGAAGGAGGGAGAGGG - Intronic
1160942146 19:1625410-1625432 GTGGGAGGGATGGACGGTGACGG - Intronic
1161100310 19:2418421-2418443 GAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100324 19:2418453-2418475 GAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100378 19:2418594-2418616 GAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100385 19:2418612-2418634 GAGGGAGGGAAGGAAACGGAGGG - Intronic
1161100409 19:2418680-2418702 GAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100430 19:2418735-2418757 GAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100437 19:2418753-2418775 GAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100458 19:2418808-2418830 GAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100465 19:2418826-2418848 GAGGGAGGGAAGGAAACGGAGGG - Intronic
1161100564 19:2419092-2419114 GAGGGAGGGAAGGAGACGGTGGG - Intronic
1161139649 19:2639842-2639864 GAGGGAAGGAAGGAAGGGGAGGG + Intronic
1161139699 19:2640000-2640022 GAGGGAGGGAAGGAGGGAGGGGG + Intronic
1161329014 19:3677748-3677770 GAGGGAGGGATGGAGGATGGAGG + Intronic
1161329066 19:3677882-3677904 GAGGGAGGGAGGGATGGAGGAGG + Intronic
1161419975 19:4171402-4171424 GATGGAGGGGAGGATGATGAGGG - Exonic
1161427715 19:4213215-4213237 GAGGGAAGGAAGGAAGGAGAAGG - Intronic
1161849593 19:6731568-6731590 GAGGGAGGGGAGGGGGCTGGGGG + Intronic
1161913902 19:7214818-7214840 GAGGGAGGGAAGGAAGGAAAGGG - Intronic
1162072953 19:8165873-8165895 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1162084777 19:8241957-8241979 AAGGGAGGAAATGAGGCTGAGGG - Intronic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1162617880 19:11816266-11816288 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162621851 19:11849702-11849724 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162626548 19:11889099-11889121 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162635782 19:11966003-11966025 GAGGTAGGAAGGAATGCTGAAGG + Intronic
1162789877 19:13057298-13057320 GAGGGAGGGAAGCAGGCAGGAGG + Intronic
1162826957 19:13258696-13258718 GAGGGAGGTGAGGATGCTGAGGG + Intronic
1162879701 19:13648937-13648959 GAGAGAGGGAAGGAGGGGGAGGG + Intergenic
1163020254 19:14477816-14477838 GAGGGAGGGAGGGACGATGGCGG - Exonic
1163262670 19:16200508-16200530 GAGGAAGGGAAGGAAGCCCACGG - Intronic
1163323467 19:16587977-16587999 GTGGGAGGGAAGGACGCTGTGGG - Intronic
1163462557 19:17447961-17447983 GAGGGAGGGAAGGAGGGAGGAGG + Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163533317 19:17863144-17863166 GAGGAAGGGAGGCATGTTGAGGG - Intronic
1163586364 19:18166359-18166381 CAGGGAGGGAAGGAAGCAGAAGG + Intronic
1163848928 19:19652740-19652762 GAGGGAGGGACAGATGGTGAGGG - Intronic
1164069200 19:21750766-21750788 GGGGGAGGGGCGGCTGCTGAGGG + Intronic
1164151090 19:22552027-22552049 AAGGAAGGGAAGGAAGCCGAGGG + Intergenic
1164393616 19:27845786-27845808 GAGGGAGGGACGGCTACAGAGGG + Intergenic
1164441966 19:28285341-28285363 GTGGAAGGGAAGGATGGTGGAGG + Intergenic
1164526908 19:29019513-29019535 GTGGGAGGGCTGGACGCTGAGGG + Intergenic
1164681219 19:30134969-30134991 GATGGTGGGAAGGCAGCTGAGGG + Intergenic
1164700345 19:30280290-30280312 GAAGGAGAGAAGGATGAAGATGG - Intronic
1164708618 19:30339005-30339027 GGGGGAGGGAAGGAAGAGGAGGG - Intronic
1164802357 19:31088178-31088200 GAGGGAGGGAAGGAAGAAGGAGG + Intergenic
1165569373 19:36762492-36762514 AAGAGATGGAAGGGTGCTGAAGG + Intronic
1165771079 19:38380664-38380686 GAGGGAGGGAGGGAGGAAGAGGG + Intronic
1166068899 19:40376568-40376590 GAGGTGGGGCAGGATGCAGAGGG - Intronic
1166084032 19:40463523-40463545 GAGGGAGGGAGGGAGGGAGAAGG - Intronic
1166123934 19:40702565-40702587 GAGGGAAGGAGGGAAGCTCAGGG + Intronic
1166280942 19:41792864-41792886 GAGAGAGGGAAGGCTGCTATTGG - Intergenic
1166294060 19:41880431-41880453 GAGGGAGGGAAGGAAGGGAAGGG + Intronic
1166350490 19:42195710-42195732 GAGGGAGGGAAGGTGGTGGAAGG - Intronic
1166350491 19:42195714-42195736 GAGGGAGGGAGGGAAGGTGGTGG - Intronic
1166362862 19:42262201-42262223 GAGGGAGGGAGGGAGACAGAAGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166751702 19:45166947-45166969 GAGGGAGGGATGGAGGCAGCTGG - Intronic
1166813347 19:45527114-45527136 CAGGGTGGGAAGGAAGATGAAGG - Intergenic
1166916302 19:46197995-46198017 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1166948085 19:46409250-46409272 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1167048059 19:47062903-47062925 GAGGAAGGTATGGAGGCTGAGGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167134931 19:47610187-47610209 GAGGGAGGGATGGAGGAGGAGGG + Intronic
1167148606 19:47696396-47696418 GGGGGAGGGAAGGCTTCTGGAGG + Intronic
1167391418 19:49197457-49197479 GAAGGAGGGAGGGAGGCAGAGGG - Intronic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1167552864 19:50173122-50173144 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1167576371 19:50319937-50319959 GAGGGAGGCAGAGATGTTGATGG + Intronic
1167622844 19:50568578-50568600 GAGGGAGGGAAGAAAGGAGAGGG + Intergenic
1167649937 19:50723651-50723673 GAGGGAGGCCCTGATGCTGAAGG + Exonic
1167680226 19:50915358-50915380 GAGGGAGAGATGAAGGCTGACGG + Intergenic
1168240066 19:55084407-55084429 GGGGGAGGGAAGGAGGTAGATGG + Intronic
1168251851 19:55146334-55146356 GAGGGAGGGAAGGGTGGTCTTGG + Intronic
1168316507 19:55486857-55486879 GGGGGTGGGAGGGATGCTGGAGG + Exonic
1168639454 19:58021022-58021044 GAGGGAGGGAGGGATGGAGGAGG + Intergenic
1168691910 19:58382385-58382407 GAGGGCGAGCAGGAGGCTGAAGG + Intergenic
1202715061 1_KI270714v1_random:37858-37880 GAGGGAGGGAGGGAGGCAGAGGG - Intergenic
925056852 2:863032-863054 GAGGGAGGGAGGGAGGTGGAGGG - Intergenic
925222179 2:2150899-2150921 GAGGGAGGGAGGGAGACGGAGGG + Intronic
925375551 2:3381794-3381816 GAGGGAGGGGTGGAAGGTGATGG - Intronic
925425284 2:3744248-3744270 CAGGGAGGGATGGAGGCTCATGG + Intronic
925690053 2:6512494-6512516 GAAAGAGGGAATGATGATGAGGG - Intergenic
925717377 2:6796825-6796847 GGGGCAGGTGAGGATGCTGAGGG - Intergenic
925760770 2:7182264-7182286 CATGGAGGGAAGGATGGTCAGGG + Intergenic
925906921 2:8545168-8545190 GAAGGCGGGGAGGATGCTGTGGG + Intergenic
926116377 2:10216131-10216153 GAGGGAGGGAAGGAAGGAAAAGG + Intergenic
926150562 2:10423389-10423411 CAGGGAGGCAAGCATGCTGGTGG + Intronic
926691239 2:15735499-15735521 CAGGGATAGAAGGAGGCTGAAGG - Intronic
926695077 2:15765515-15765537 GAGGGAGGGACCGGTGCTGTGGG + Intergenic
926707856 2:15849340-15849362 GAAGGAGGGATGGAGGATGAGGG + Intergenic
926921827 2:17946764-17946786 GAGGGAGGGAAGGAAGGAGAGGG - Intronic
926921835 2:17946790-17946812 GAGGGAGGGAAGGAAAGAGAGGG - Intronic
926947697 2:18206156-18206178 GAGGGAGGGAAGGAGGAAGGAGG - Intronic
927465182 2:23331540-23331562 GCAGGAAGGAAGGATGCTGGGGG - Intergenic
927487363 2:23497653-23497675 GAGGCAGGGAAAGATGCTCCTGG - Intronic
927714255 2:25342044-25342066 GAGGGAGGGAAGGAGGAAGGCGG - Intronic
927815138 2:26209134-26209156 TAGGGAGGGAGGGATGCTACTGG - Intronic
927832532 2:26364659-26364681 GATGGAAGAAAGAATGCTGATGG + Intronic
928209095 2:29310707-29310729 GAGCGAGGGAGGGACACTGAGGG - Intronic
928921663 2:36534103-36534125 GAGGGAGGGAAGGAGGGGAAAGG + Intronic
928921884 2:36535121-36535143 GAGGGAGGGAGGGAAGGGGAAGG + Intronic
928943831 2:36754200-36754222 GAGGGAAGGAAGGGTGTTGATGG + Intronic
929448968 2:42023987-42024009 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
929579203 2:43071064-43071086 GAGGAAGTGAAGGTTGCAGAAGG - Intergenic
929830842 2:45345048-45345070 GTGAGAAGGAAAGATGCTGATGG - Intergenic
929962124 2:46504805-46504827 GAGAGAGGGAAGGAGGGGGAGGG - Intronic
930026773 2:47033881-47033903 GAGGCAGGGAAGGAAGCTCTGGG + Intronic
930312209 2:49755846-49755868 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
931660640 2:64559280-64559302 TAGGGAGGGAAGGATGGGGAGGG + Intronic
931826284 2:66004146-66004168 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
931835431 2:66093996-66094018 GAGGGAGTGAGGAATGGTGAGGG + Intergenic
932264665 2:70357351-70357373 GAGATAGTGAATGATGCTGAGGG + Intergenic
932428891 2:71661668-71661690 CAGAGAGGGGAGGATGCAGAGGG + Intronic
932490306 2:72115923-72115945 GAGGGTGGGGCTGATGCTGAAGG + Intergenic
932740573 2:74287732-74287754 GATGGAAGAAAGGATGTTGATGG - Intronic
933069276 2:77836830-77836852 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
933069306 2:77836955-77836977 GAGGGAAGGAAGGAAGAAGAGGG + Intergenic
933211796 2:79579231-79579253 GAGGGAGGGAAGGAAGGGAAGGG - Intronic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933360817 2:81281805-81281827 GAGTGAGAGAAAGATCCTGAAGG - Intergenic
933464304 2:82632696-82632718 GAGGGAGGGAGGGAGGAAGAAGG - Intergenic
933727356 2:85434403-85434425 GAGGCAGGGAGGGAGGCTCAGGG + Intronic
934056151 2:88253058-88253080 GAAGGAAGGAAGGAAGATGAGGG - Intergenic
934124200 2:88870681-88870703 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
934570503 2:95368874-95368896 GGGAGAGGGAAGGATGGTGGGGG - Intronic
934579110 2:95424296-95424318 GAGGGAGGGAGGGAAACAGATGG + Intergenic
934600335 2:95652411-95652433 GAGGGAGGGAGGGAAACAGATGG - Intergenic
934745424 2:96756475-96756497 GAGGGAAGAAGGGAGGCTGAGGG - Intergenic
934971608 2:98768805-98768827 GTGGGAGGGAAGGGTGCAGATGG + Intergenic
935129445 2:100250453-100250475 GAGAGAGAGAAAGAGGCTGAAGG - Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
936053133 2:109240693-109240715 GTGGGAGGGAGGGAAGATGAAGG - Intronic
936243039 2:110804825-110804847 GAGGGAGGGGAGTATGGGGAGGG + Intronic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
936563307 2:113560862-113560884 GAAGGAGGGCAGGAGGGTGATGG + Intergenic
937034526 2:118769808-118769830 GAGGGAGGAAAGGAAGGAGAGGG + Intergenic
937072284 2:119073377-119073399 GAGGGAGAGAGGAAGGCTGAGGG + Intergenic
937207609 2:120246513-120246535 GAGGAAGGAAAGGATGTTGGTGG - Intronic
937291567 2:120785165-120785187 GAGGGAGGGAGGGTGGCTGAGGG + Intronic
937331995 2:121037522-121037544 GAGGGAGGGGAGGATGAGGGTGG - Intergenic
937509843 2:122583065-122583087 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
937986191 2:127639170-127639192 AAGGGAGGGTAAGATGCGGAGGG + Exonic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938574145 2:132588311-132588333 GTGGGAGGGAAGGATGGCCAAGG + Intronic
938698829 2:133858480-133858502 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
938813666 2:134877681-134877703 GAGGGAGGGAGGGAAGAAGAGGG + Intronic
938938925 2:136152199-136152221 GAGGGAGGGAAGGAAGGAGAGGG - Intergenic
938940143 2:136162526-136162548 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940259517 2:151765725-151765747 GGAGGAGGGAAGGATGGAGAGGG - Intergenic
940411907 2:153374703-153374725 AAAGGAGGGAAGGAGACTGAGGG + Intergenic
940815578 2:158293950-158293972 GAGGGAGGGAGGGAGGGAGAGGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941163465 2:162060893-162060915 GAGGGAGGGAGGGAGGAGGAAGG - Intronic
941166831 2:162091833-162091855 GAGGGAGAGCATGATGCAGAAGG - Intergenic
941591152 2:167422141-167422163 GAGGGAGGAAAGGAAGAGGAAGG + Intergenic
941834771 2:170004480-170004502 GGGAGAGGGCAGGATGCTGAAGG + Intronic
942135974 2:172925934-172925956 GAGGGAGGGAAGGAAGGAGGGGG + Intronic
942135976 2:172925938-172925960 GAGGGAAGGAAGGAGGGGGAGGG + Intronic
942289436 2:174454678-174454700 GAGGGAGGGAAGGAAGGGAAAGG + Intronic
942391042 2:175493274-175493296 GAGGGAGGGAAAGATACTCTTGG + Intergenic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
942607784 2:177710234-177710256 GAAGGAGGGAAGGATGGGGATGG + Intronic
942965846 2:181891886-181891908 GAGGGAGGGAAGGAAGGGGAGGG - Exonic
943063588 2:183063830-183063852 GAAGGAGGGAAGGAAGGGGAAGG - Intergenic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
943375551 2:187072087-187072109 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
944219962 2:197293189-197293211 AAAGAAGGGAAGGATGGTGAAGG + Intronic
944687214 2:202128109-202128131 GGGGAAGGGAAGGAGGGTGAGGG - Intronic
945010942 2:205463079-205463101 GGGGCAGGGAAGGATATTGAGGG - Intronic
946068070 2:217007169-217007191 GTTGGAGGGAATGATGCTGAAGG + Intergenic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
946189104 2:217998266-217998288 GAGAGAGAGAGAGATGCTGATGG - Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946285246 2:218697788-218697810 GAGGGAGGGAGGAATGATAAAGG + Intronic
946415586 2:219538291-219538313 GAGGAAGGGAAGGAAGGAGAGGG + Exonic
946673914 2:222136731-222136753 GAGGGAGGGAGGGGTGGAGAGGG + Intergenic
946686967 2:222280297-222280319 GAGGGAGGGAAGGAGGGAGGAGG + Intronic
946688140 2:222291697-222291719 GAGGGGGAGAAGAAAGCTGAGGG - Intronic
946996261 2:225395506-225395528 GAGGGAGGGAAGGAGGGAGGGGG - Intergenic
947030207 2:225783503-225783525 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
947279834 2:228438359-228438381 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
947375349 2:229489710-229489732 GAGGGAGGGGAGGAAGAAGAGGG + Intronic
947620605 2:231588206-231588228 GAGGGAGGGAGGGAGGGAGATGG + Intergenic
947671102 2:231936015-231936037 GAGGGAGGGAAGGAGGGAGGAGG - Intergenic
947909222 2:233790595-233790617 GAGGGAGGGAGGGGAGGTGAGGG - Intronic
948211932 2:236200601-236200623 GAGGGAGGAAAGGAGAGTGAGGG - Intronic
948313920 2:237012336-237012358 GAGGAAGGGAGGCATGCTCAGGG + Intergenic
948333903 2:237193123-237193145 GAGTGAGGGAAGGTTGCAGGAGG + Intergenic
948358143 2:237397122-237397144 GAGGGAAGGAAGGAAGGAGAAGG + Intronic
948458378 2:238117780-238117802 GAGGAAGGGATGGATGGGGAGGG + Intronic
948763236 2:240205358-240205380 GAGAGAGGGAAGGAGGGAGAGGG + Intergenic
948856440 2:240732547-240732569 GAGGGAGGGATGGGGGATGAGGG + Intronic
1168842243 20:916913-916935 GAGGGAGGGGAGGAGGCAGAGGG + Intergenic
1168975980 20:1966170-1966192 CAAGAAGGGAAGGAAGCTGAGGG + Intergenic
1169046109 20:2535816-2535838 CAGGGAGGAAAAGCTGCTGAGGG + Intergenic
1169415957 20:5416403-5416425 GAGGGAGGGTAGGAAGCCAAAGG + Intergenic
1169475754 20:5929857-5929879 GAGGAGGGGAAGGCTGCTGGAGG + Intergenic
1169512915 20:6284367-6284389 TGGGGAGGGGAGGAGGCTGAAGG - Intergenic
1169586305 20:7089849-7089871 GAGGGAGGGAGGGAGGAAGAAGG + Intergenic
1169597856 20:7221112-7221134 GAGGGAGGGAATGAGGGGGAAGG - Intergenic
1170066002 20:12311258-12311280 AAGGGAGGGAAAGAAGCAGATGG - Intergenic
1170549296 20:17462532-17462554 GGGGGAGCTCAGGATGCTGAGGG - Intronic
1170631750 20:18072334-18072356 GAGGGAGGGAAGGAGGGAGGAGG - Intergenic
1170655823 20:18287400-18287422 GAGGCAGAGAATGATGTTGAGGG + Intergenic
1170682761 20:18541164-18541186 GAGAGAGGTAAGGAAGCTGCAGG - Intronic
1170752049 20:19158210-19158232 GAGAGAGGGAGGAATGCAGAAGG - Intergenic
1170763944 20:19274497-19274519 GAAGGAGAGGAGGATGCTGGAGG - Intronic
1171364514 20:24614619-24614641 GAGGGAGGGAGGGAAGGGGAGGG + Intronic
1171528727 20:25836893-25836915 AAGAGATGGAAGGGTGCTGAAGG + Intronic
1171548099 20:26018993-26019015 AAGAGATGGAAGGGTGCTGAAGG - Intergenic
1172205581 20:33160714-33160736 GAGAGAGGGAAGGAGGTTGGTGG - Intergenic
1172276048 20:33680005-33680027 GAGGTGGGGGTGGATGCTGAAGG - Intronic
1172292156 20:33784186-33784208 GAGGGAGGTGAGGAGGCGGAGGG - Intronic
1172454007 20:35051954-35051976 GAGGAAAGGAAGGATTGTGATGG - Intronic
1172486610 20:35302110-35302132 GAGTCAGGGAAAGGTGCTGATGG + Intergenic
1172487135 20:35305084-35305106 CAGGGAGGGCAGAGTGCTGAAGG - Intronic
1172556831 20:35849452-35849474 GAGGCAGGGCAGGATGGTGCAGG + Intronic
1172628707 20:36363953-36363975 GCAGGAGGGAAGGGTGCTGCAGG + Intronic
1172693211 20:36804513-36804535 GAGGAAGGGAAGGAAGGTGGGGG - Intronic
1172830984 20:37834215-37834237 GAGGGAGGGCTGGGTGCTGGTGG - Intronic
1172992555 20:39047441-39047463 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
1173423145 20:42920442-42920464 GAGGGAGAGAAGGAAGGGGAGGG + Intronic
1173457203 20:43212916-43212938 GAGGGAGGGAAGGAAGAAAAGGG + Intergenic
1173596010 20:44258710-44258732 GAGGGAGAGAAGGAGGAGGAAGG - Intronic
1173684982 20:44916888-44916910 GAGGGAGGGGCGGAGGCTGCAGG + Intronic
1173866687 20:46317035-46317057 GAGGGAGGGAGGGAGGCACAGGG - Intergenic
1174062731 20:47843994-47844016 GAGGGAGGGAGGGAAGGAGAGGG + Intergenic
1174062732 20:47843998-47844020 GAGGGAGGGAAGGAGAGGGAAGG + Intergenic
1174164581 20:48575719-48575741 GAGGGAGGGAGGGAGGCCCAAGG + Intergenic
1174199680 20:48798515-48798537 GAGGGAGGGAAGGCTGAGGAGGG - Intronic
1174296445 20:49548619-49548641 GATGGATGGATGGATGCTGTTGG + Intronic
1174359335 20:50018059-50018081 GAGGGAAGGAAGGAGGGAGAAGG - Intergenic
1174387986 20:50198194-50198216 GGGGGAGGGAAGGATGGGGAGGG + Intergenic
1174397986 20:50259767-50259789 GGGGCAGGGAAGGAAGCTGTGGG - Intergenic
1174473351 20:50777908-50777930 GAGGGAGGGAAGGAGGAAGGAGG - Intergenic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1174701180 20:52611021-52611043 GAAGGAGGGAAGGATGGAGGAGG - Intergenic
1174723291 20:52836242-52836264 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175138866 20:56844817-56844839 CAGGGAGGGAAGGAGACTGACGG + Intergenic
1175634552 20:60569558-60569580 GGGGTAGGGGAGAATGCTGAGGG - Intergenic
1175644083 20:60656726-60656748 GAGGAAGGTAAGGATGCCGTGGG - Intergenic
1175676394 20:60949857-60949879 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
1175733831 20:61371867-61371889 GGGCGAGGGACGGATGGTGAGGG - Intronic
1175984112 20:62755589-62755611 GAGGGAGGGAGGGATGATGGAGG - Intronic
1175984148 20:62755690-62755712 GAGGGAGAGAGGGATGATGGAGG - Intronic
1175984187 20:62755803-62755825 GAGGGAGGGAGGATGGCTGAAGG - Intronic
1176049856 20:63112976-63112998 GATGGAGGGACTGAGGCTGAGGG + Intergenic
1177497171 21:21903894-21903916 GAGGGAGGGAAGGGAGGGGAGGG + Intergenic
1177877073 21:26646543-26646565 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
1177944252 21:27447510-27447532 CAGGGAGGGAGTGATGGTGATGG - Intergenic
1178042459 21:28654404-28654426 TTGGAAGGGAAGGATACTGAAGG + Intergenic
1179013320 21:37573755-37573777 GAGGGAAGGAAGGAAACTCATGG + Intergenic
1179296834 21:40070286-40070308 GAGGGAGGGAAGGAGAGAGAAGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179891637 21:44338687-44338709 GAGGGAGGGGAGGAGGCCGGGGG - Intronic
1180075112 21:45458114-45458136 GAGGGAGGGAGGGCTGCAGCGGG + Intronic
1180186902 21:46144658-46144680 GAGGGAGGGAGGGATGGGGAGGG - Intronic
1180754028 22:18147897-18147919 CAGGGAGGGCAGGGTGCTGGTGG - Intergenic
1180786907 22:18552622-18552644 AAGGGAGGGAAGGGCGATGAAGG + Intergenic
1180843018 22:18968028-18968050 AAGGGAGGGAGGGCAGCTGACGG - Intergenic
1181047599 22:20222980-20223002 GAGGGAGAGAGGGAGGCTGCAGG + Intergenic
1181234834 22:21442688-21442710 AAGGGAGGGAAGGGCGATGAAGG - Exonic
1181243816 22:21492143-21492165 AAGGGAGGGAAGGGCGATGAAGG + Intergenic
1181528451 22:23502783-23502805 GAGGGAGGGATGGAGGATGGAGG - Intergenic
1181528470 22:23502835-23502857 GAGGGAGGGATGGAGGATGGAGG - Intergenic
1181528518 22:23502959-23502981 GAGGGATGGAGGGATGGGGATGG - Intergenic
1181573689 22:23781161-23781183 GAGAGAGGGACACATGCTGAGGG - Intronic
1181737476 22:24893063-24893085 GAAGGAAGGAAGGAAGCGGAGGG + Intronic
1181774053 22:25147051-25147073 GAGAGAGGGAGGGAGGGTGAGGG + Intronic
1181795042 22:25302061-25302083 GAGGGAGGGTAGAAGGCAGAAGG - Intergenic
1181795187 22:25303059-25303081 GAGGGAAGGAAAGATGGAGAAGG - Intergenic
1181835614 22:25605725-25605747 GAGGGAGGGTAGAAGGCAGAAGG - Intronic
1181835729 22:25606579-25606601 GAGGGAAGGAAAGATGGAGAAGG - Intronic
1181860875 22:25817371-25817393 GAGGGAGGGAGGGAGGGAGAAGG - Intronic
1181907336 22:26209769-26209791 GAGGGAGGGAAGAAGGAGGAAGG + Intronic
1182021537 22:27085783-27085805 GAGGAAGGGGAGGATGCAGAGGG - Intergenic
1182050693 22:27310581-27310603 GAGGGAGGGAAGGAGGGGGGAGG + Intergenic
1182050703 22:27310600-27310622 GAGGGAGGGAAGGAGGGGGGAGG + Intergenic
1182050713 22:27310619-27310641 GAGGGAGGGAAGGAGGGGGGAGG + Intergenic
1182103302 22:27672105-27672127 GAGGGAGGGAAGGAAGGGGAGGG + Intergenic
1182286658 22:29252598-29252620 GGGGAAGGAAAGGATGCAGATGG + Intronic
1182352716 22:29707764-29707786 CAGGGAAGGAGGCATGCTGAAGG + Intergenic
1182408354 22:30158579-30158601 GAGGGAAGGAAGGAAGGAGAAGG - Intronic
1182486342 22:30641302-30641324 GAGGGAGGGAAGGAGGGAGCTGG - Intronic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182796526 22:32995097-32995119 GAGGGAGGGAGCAAAGCTGAGGG - Intronic
1182864090 22:33586806-33586828 GAGGGAGGGAAGGAAAGAGAAGG - Intronic
1183108337 22:35630298-35630320 GGAGGAGGGAAGGAGGCGGAGGG + Intronic
1183374444 22:37454812-37454834 GAGGGAGGAAGGGAGGCTGGGGG - Intergenic
1183498877 22:38166242-38166264 GTGGAAGGGCAGGATGCAGAAGG - Intronic
1183550912 22:38484386-38484408 GAGAGAGGGATGGTTTCTGAGGG - Exonic
1183663337 22:39234014-39234036 GAGGGAGGGAGGGAGGGAGAGGG + Intronic
1183713501 22:39520443-39520465 GAGGGAGGGAAGGGAGCGGGCGG + Intronic
1183751491 22:39723591-39723613 GAGGGAGGGCAGGAGGCAGAAGG - Intergenic
1183930228 22:41231816-41231838 GAGGCAGGGCAGGTTCCTGAAGG - Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184293425 22:43509781-43509803 GAGGGAGGGAAGGAGGAGGAAGG - Intergenic
1184358092 22:43995991-43996013 CAGGGAGGGAAGGAGCCGGAAGG - Intronic
1184448866 22:44571049-44571071 GAGGGGGAGAGGGATGCAGAGGG + Intergenic
1184510453 22:44930260-44930282 GAGGGAGAGGAGGAAGCTGGAGG + Intronic
1184671466 22:46014102-46014124 GAGGGAGGGAAGGTGGCCGCGGG - Intergenic
1184703336 22:46192966-46192988 GAGGCTGGGAAGGGTGGTGAGGG + Intronic
1184832787 22:47000296-47000318 GATGGAGGGAAGCCTGGTGAGGG + Intronic
1185017800 22:48355329-48355351 GAGGGAGGGAGGGATGAATATGG - Intergenic
1185037060 22:48484891-48484913 GAGGGAGGGAAGGAAGGAGAAGG - Intergenic
1185050884 22:48553425-48553447 GAGGGAGGGAAGCAGGATGCAGG + Intronic
1185169443 22:49284125-49284147 GAGGGAGGAAGGGATGTTTAGGG + Intergenic
949167897 3:962749-962771 GAGGGAGGGAGGGAGGCAGAGGG + Intergenic
949457113 3:4250324-4250346 GAGGGAGGGAAGGAAGGGAAGGG + Intronic
949984241 3:9527019-9527041 GAGGGAGGGAAGGAGACAGAAGG + Intronic
950096763 3:10335175-10335197 AAAGGAGGGCAGGATGCTGAAGG + Intronic
950104827 3:10381542-10381564 GAGGAAGGGAAGGATGTTCTGGG + Intronic
950221041 3:11196293-11196315 GAGGGAGGAAAGGGTGCTCCAGG - Intronic
950363799 3:12468840-12468862 GAGGGAGGGAACGAGGAAGAAGG + Intergenic
950422517 3:12907300-12907322 AGGGGAGGCAAGGCTGCTGACGG + Intronic
950538209 3:13594172-13594194 GTGGGTGGGTAGGATACTGAGGG + Intronic
950613187 3:14139142-14139164 GGGGCAGGTCAGGATGCTGAGGG - Intronic
950647441 3:14385686-14385708 GAGGAATGGCAGGAGGCTGAAGG - Intergenic
950720601 3:14879839-14879861 GGAGGGGGAAAGGATGCTGAGGG + Intronic
950826785 3:15831497-15831519 GAAGGAGGGAAGGATACTATTGG - Intronic
950878326 3:16299234-16299256 GAGGGAGGGAAGGAGGATATAGG + Intronic
951150133 3:19278551-19278573 GAGGGAGGGAGGGAGGAGGAAGG + Intronic
951160452 3:19413380-19413402 AAGGGAGGGAAGGAGGGAGAAGG + Intronic
952187849 3:30989753-30989775 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
952253806 3:31678493-31678515 TAGAGAAGGAAGGATCCTGAAGG + Intronic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
952342833 3:32459791-32459813 GAGGTAGGGAGGAAGGCTGAGGG + Intronic
952370813 3:32720997-32721019 GAGGGAGGGAAGGGAACAGAAGG - Intronic
952839338 3:37630938-37630960 GAGGCAGGGCAGGAAGCTGATGG + Intronic
953004613 3:38966758-38966780 GAGGCTGGGAAGGATGTGGAGGG - Intergenic
953023295 3:39129701-39129723 GTGGGAGGTGGGGATGCTGAGGG + Intronic
953383556 3:42492175-42492197 GAAGGAAGGAAGGATGAGGAGGG - Intronic
953661583 3:44894859-44894881 GTGTGAGGAGAGGATGCTGAGGG - Intronic
953814491 3:46143421-46143443 GAGGAAGAGGAGGATTCTGATGG - Intergenic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954009469 3:47622678-47622700 TAGGGAGGAAAGGATAGTGAGGG - Intronic
954582509 3:51710710-51710732 GTGGGAGAGTAGGAGGCTGAGGG - Intronic
954930935 3:54280752-54280774 GAGGGAATGAATGATGCAGAGGG - Intronic
954963933 3:54593462-54593484 GAGGGAGGGAAGGAAGGTGAAGG + Intronic
955129683 3:56153247-56153269 TAGAGAGGGAAGGATGCCCATGG - Intronic
955205819 3:56895076-56895098 GAGGGAGGGAGGGAGGTAGAGGG - Intronic
955495615 3:59529133-59529155 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
955874582 3:63476167-63476189 GAGGGAGGGAAGGAAGGGAAGGG + Intronic
955874615 3:63476273-63476295 GAGGGAGGGAAGGAAGGGAAGGG + Intronic
955935371 3:64097945-64097967 GAGGGACAGAAGGATTCTGAGGG - Exonic
956901956 3:73726201-73726223 AGGGGAGGGATGGATGCTGGAGG + Intergenic
956961751 3:74411016-74411038 GAGGGAGGAAAGGATAGAGAGGG - Intronic
957311837 3:78530219-78530241 GAGGGAGGCAGGGATGAGGAGGG + Intergenic
957466683 3:80602516-80602538 GAGGGAGGGAAGGAGGGAGAAGG + Intergenic
957748298 3:84374680-84374702 GAGGAAGAGAAGGATGGAGAAGG + Intergenic
957818590 3:85338005-85338027 GATGGAGGCAATGATGCTTAAGG - Intronic
957913951 3:86661956-86661978 GAGGGAGGGGCAGATGCTAATGG - Intergenic
958019443 3:87979129-87979151 GAGGGAGGGAGGGAGGGAGATGG + Intergenic
958065158 3:88535628-88535650 AAGGGAGGGAAGGAGGGAGAAGG - Intergenic
958117170 3:89235015-89235037 GAGGGAGGGAGGGAAGGGGAGGG - Intronic
959121841 3:102242015-102242037 GAGGAATTGGAGGATGCTGAGGG + Intronic
959243417 3:103830045-103830067 AAGGGAGGGAGGGAGGGTGAGGG - Intergenic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961149781 3:124628202-124628224 GAGGGAGGGAAGGAAGGAGGGGG - Intronic
961149822 3:124628313-124628335 GAGGGAGGGAAGGAAGGAGGGGG - Intronic
961345041 3:126258812-126258834 GAGGGAGGGGAGCTGGCTGATGG - Intergenic
961429635 3:126872134-126872156 GACTGAGGGAAGGATACTGTTGG + Intronic
961640002 3:128359155-128359177 GAGGGAGGGAAGGAGCCACATGG + Intronic
961693642 3:128688727-128688749 GAAGGAGGAAGGAATGCTGATGG + Intergenic
961985485 3:131128306-131128328 GAGGGAGGGAAGAATGAGTAAGG - Intronic
962277992 3:134030139-134030161 GAGGGAGGGAAGGAGGTGGCGGG + Intronic
962340154 3:134575569-134575591 GAGGGAGGGAGGGAGGAAGAGGG - Intergenic
962346187 3:134620466-134620488 GACAGAGGGAAGGCTGCTGCTGG + Intronic
962502559 3:136010065-136010087 GAGGATGGGAAAGATGCTGGAGG - Intronic
962751205 3:138435666-138435688 GAGGGAGGGAAGGAGGCCCGGGG - Intronic
963353784 3:144184899-144184921 TATGCAGGCAAGGATGCTGAAGG - Intergenic
963479321 3:145850780-145850802 GTGAGAGGGAAGTATGATGATGG - Intergenic
963769827 3:149378573-149378595 GAGGGAAGGAAGGAGGGAGAGGG + Intergenic
963848053 3:150179979-150180001 TAGGGCGGGAAGGATACTGGAGG + Intergenic
964012159 3:151904226-151904248 GAGGGAGGGAAGGATGAAATAGG - Intergenic
964603473 3:158530609-158530631 GAGGGAGGGAGGGAAGATGTGGG + Intronic
964619557 3:158707446-158707468 CAAGGTGGGAAGGATACTGATGG + Intronic
964650861 3:159009687-159009709 GTGCGAGGGAAGGAGGCTGATGG - Intronic
964833114 3:160908015-160908037 AAGGGAGAGAATGATTCTGAAGG + Intronic
965173060 3:165293751-165293773 GAGGGAGAGAAGGAGGGAGAAGG + Intergenic
965424639 3:168506870-168506892 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
965994150 3:174858666-174858688 GAGGGAGAGAAGGAAGAAGAAGG + Intronic
966062477 3:175775975-175775997 GAGGGAGAAAAGGATACAGACGG - Intronic
966461475 3:180181650-180181672 GAGGGAGGGAAGGGAGGGGAAGG - Intergenic
967648603 3:191957460-191957482 GAAGGAGGGAGGGATGGAGAAGG + Intergenic
967689738 3:192459883-192459905 GAGGGAGAGAAGGAGACAGAAGG + Intronic
967836026 3:193963537-193963559 AAGAGAGGGGAGGATGCGGAAGG + Intergenic
967973477 3:195016227-195016249 TACAGAGAGAAGGATGCTGAGGG - Intergenic
968206902 3:196811228-196811250 GAGGGAGGGAAGGAAGGGAAGGG - Intronic
968462462 4:732294-732316 TAGGGAGGGAAGGGAGGTGAGGG - Intronic
968493054 4:900829-900851 GAGGGAGGAAAGGAAGGAGAAGG + Intronic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
968973196 4:3807082-3807104 GAGGGAGGGAGGGAGGAGGAAGG - Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969227452 4:5808127-5808149 GAGGGAGGGAGGGAGGGAGAAGG - Intronic
969315600 4:6379939-6379961 GAGGGAGGGGAGGAAGCCGGGGG - Intronic
969481279 4:7448398-7448420 GAGGGAGGGAATGAAGAGGAAGG - Intronic
969487275 4:7479338-7479360 GAGGGAGGGCTGGAGGCTCAGGG - Intronic
969656145 4:8499566-8499588 GAGGGAGGGGAGTGTCCTGAGGG + Intergenic
969668494 4:8575942-8575964 GAGGGAGGGAGGGAGGGAGAGGG - Intronic
969717971 4:8877547-8877569 GAGGGATGGAAGGAGGGGGAGGG + Intergenic
969799254 4:9549792-9549814 GAGGGAGGGAAGCATGGGGGAGG - Intergenic
970312983 4:14801751-14801773 GATGGAGGGAAGGAAGGGGAAGG + Intergenic
970418639 4:15883701-15883723 GAGAGAGGGAAGGATGAGGCAGG + Intergenic
970471403 4:16382806-16382828 GAGGGAGGGAAGGAGAAGGAAGG - Intergenic
970471404 4:16382810-16382832 GAGGGAGGGAGGGAAGGAGAAGG - Intergenic
970926396 4:21457450-21457472 GAGAGAGTGAATGATGTTGAAGG - Intronic
970932677 4:21531341-21531363 GAGGGAGGGAGGGAGGGGGAGGG - Intronic
971103628 4:23497547-23497569 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
971171985 4:24242842-24242864 GAGGCTGGGAGGGATGGTGAGGG - Intergenic
971304111 4:25465432-25465454 CAGGGAGGGAGGGATCCTCATGG + Intergenic
972165884 4:36283225-36283247 GAGAGTGGGAAGAATGATGACGG + Intronic
972234582 4:37116070-37116092 GAGGGCGGGAAGGTTGCTATTGG + Intergenic
972347526 4:38205356-38205378 GAACGAGGGAGAGATGCTGAGGG - Intergenic
972401282 4:38706060-38706082 TAGGGAGGGAAGGAGACAGATGG - Intergenic
972924177 4:43983656-43983678 GAGGGAGGGAAGGAAGGAAAGGG + Intergenic
973227700 4:47804707-47804729 GAGGCTGGGAAGGATGGTGGGGG + Intronic
973544380 4:51966162-51966184 GAGGGAGGGAAGGAGAAGGAAGG - Intergenic
973544381 4:51966166-51966188 GAGGGAGGGAGGGAAGGAGAAGG - Intergenic
973633826 4:52843730-52843752 GAGAGAGGTAAAGAGGCTGAGGG - Intergenic
973738986 4:53901582-53901604 GAGGGAGGGAGGGAGGGGGAAGG + Intronic
973865467 4:55108689-55108711 GAGGGAGGGAGGGAGGAAGAGGG - Intronic
974020456 4:56688013-56688035 GAGGGAGGGAAGGAGGGAGGGGG + Intergenic
974374799 4:61062214-61062236 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
974473880 4:62355142-62355164 GAGGGAGGGAGGGAGGCAGAGGG - Intergenic
975322356 4:73023180-73023202 GAAGGAGGGAGGGAGGCTGGTGG - Intergenic
975342664 4:73258873-73258895 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975735131 4:77373336-77373358 GAGGGAGGGAAGGAGGCACATGG - Intronic
976266599 4:83191024-83191046 GAGCAAGTGAAGGATACTGAGGG + Intergenic
978061410 4:104344783-104344805 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
978071714 4:104480838-104480860 GAGGGAGGGAGGGAAGATAAAGG - Intronic
978742346 4:112151241-112151263 GAGGGAGGGAAGGAGAGAGAGGG - Intronic
979506404 4:121502617-121502639 GAGGGAAGGAAGGAGGGGGAGGG - Intergenic
979506406 4:121502621-121502643 GAGGGAGGGAAGGAAGGAGGGGG - Intergenic
980195632 4:129584280-129584302 GAGGGAGGGAAGGAAGCGAAGGG + Intergenic
980195651 4:129584488-129584510 GAGGGAGGGAATAATGTTAAAGG + Intergenic
980295502 4:130909807-130909829 GAGGGTGGGAAGCATGGTCAGGG + Intergenic
980402995 4:132317271-132317293 AAAGCAGGGAAGTATGCTGAGGG - Intergenic
980944152 4:139302281-139302303 GAGGGAGGGACAGATGATGGAGG - Intronic
981037858 4:140190934-140190956 GAGGGGAGAGAGGATGCTGAGGG + Intergenic
981530422 4:145747775-145747797 GAAGGAGGGAAGGAAGCAAAAGG - Intronic
981531652 4:145760188-145760210 GAGAGAGGGAAAGGTGATGAAGG + Intronic
981900595 4:149857456-149857478 GTGGCAGTGAAGCATGCTGAAGG - Intergenic
981954708 4:150455811-150455833 GAGGCTGGGAAGGGTGGTGAGGG - Intronic
982036358 4:151349814-151349836 GAGAGAGGTAAGGAAGCTGCAGG + Intergenic
982406713 4:155028769-155028791 GAGGGAGGGAAGGAGGAGCAAGG - Intergenic
983160689 4:164410662-164410684 GAGGGAAGGAGGGATGGAGAAGG - Intergenic
983691064 4:170469639-170469661 GAGGGAGGGAAGGAGAGGGAGGG - Intergenic
983905228 4:173174616-173174638 TAGGGAGGGGAGGATGGGGATGG - Intronic
984177261 4:176434794-176434816 GAGGGAGGGAGGGAGGAAGAAGG - Intergenic
984238417 4:177189404-177189426 GAGGGAGGGAGGGAGGAGGAGGG - Intergenic
984822060 4:183890574-183890596 AAGGGAGGGAGGGATGATGGAGG + Intronic
984975870 4:185229539-185229561 GAGGGAGTTGAGGAGGCTGAGGG + Intronic
985170016 4:187138825-187138847 GAAGGAGAGAGGGCTGCTGAAGG + Intergenic
985293596 4:188411590-188411612 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
985323054 4:188735475-188735497 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
985521680 5:376692-376714 GCTGGAGGGAAGGCTGCTGTTGG + Exonic
985640154 5:1059791-1059813 GAGGGAGGGAAGCGAGCTGGAGG - Intronic
985645081 5:1081033-1081055 GAGGGAGGGAGGGAAGAAGAGGG + Intronic
985662548 5:1164331-1164353 GTGGGTGGGAAGGATGGTGTGGG + Intergenic
985730484 5:1544685-1544707 GAAGGAGGGAAGGAGGGAGAGGG - Intergenic
985783194 5:1881445-1881467 GAGGGAGGCCAGGAGCCTGAAGG + Intronic
985837008 5:2278914-2278936 GAGGAAGGGAAGGGTGGCGAGGG + Intergenic
985913508 5:2900752-2900774 GGTGGAGGGAAAGAAGCTGAGGG - Intergenic
985956707 5:3271107-3271129 AAGGGAGGGAAGGGGGCTGCTGG - Intergenic
985967415 5:3348173-3348195 TAAGGAGGGAGGGATGCTGTGGG - Intergenic
985969556 5:3364274-3364296 AAGGGAGGGAAGGATGATGCAGG + Intergenic
986432754 5:7697959-7697981 GAAGCAGAGAAGGATGGTGATGG - Intronic
987361513 5:17111534-17111556 GAGGGAGGGAAGGAGGGGGGAGG - Intronic
988246440 5:28688714-28688736 AAGGGAGGGAAGGAGGAAGAAGG - Intergenic
988977980 5:36534543-36534565 GAGGGAGAGAAGGATATGGAGGG + Intergenic
989022488 5:37025504-37025526 GAGGGAGGGAAGGGTTGTGAGGG + Intronic
989122740 5:38020580-38020602 GAGTGTGGGAATGATGCTAACGG + Intergenic
989331359 5:40262799-40262821 GAGGGAGGGAAAGAAGAGGAAGG + Intergenic
989727987 5:44610318-44610340 GAAGGAGGGAAGGAAGCTATAGG + Intergenic
990297924 5:54421368-54421390 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
990464707 5:56061076-56061098 GAGGGAGGCAAGTATGCCCAGGG + Intergenic
990835897 5:60019645-60019667 GAGAGAGGTGAGGAAGCTGAAGG - Intronic
990876931 5:60496357-60496379 GATTGAGAGACGGATGCTGATGG - Intronic
991272126 5:64796737-64796759 GAGGGAGGGAGGGAGGAGGAAGG - Intronic
991288185 5:65004208-65004230 GAAGGAAGGAAGGAAGCTCAAGG - Intronic
991344417 5:65648118-65648140 GAGGGAGGGATGGGTGGTGATGG - Intronic
991447730 5:66717897-66717919 GAGGGAAGGAAGGAGGCCGTGGG + Intronic
991942115 5:71863172-71863194 GAGGGAGGGAAGGAAGAGGAAGG - Intergenic
992092152 5:73326857-73326879 CAGGGAGGGAAGCTGGCTGATGG + Intergenic
992234309 5:74693429-74693451 GAGGGAGGGAAGAGTTCTGTTGG + Intronic
992264830 5:75008288-75008310 GAAGGAGGGAAGAAGGATGAAGG - Intergenic
992457251 5:76927268-76927290 GAGGTAGGGCCAGATGCTGAGGG - Intergenic
992828641 5:80572831-80572853 GAGGGAGAGAAGGAAGCAGAGGG - Intergenic
993013556 5:82510606-82510628 GAGGGACTGAAGGCTGCAGATGG - Intergenic
993309886 5:86315461-86315483 GAGAGAGGGATTGAAGCTGAGGG - Intergenic
993482027 5:88435480-88435502 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
993731816 5:91431244-91431266 AAGGGAAGGAAGGATACTCATGG + Intergenic
995160616 5:108976270-108976292 GAGGGAGGAAAAGATCCTAAAGG - Intronic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
995725749 5:115179357-115179379 TAGGGAGGGGAAGATGCTGGAGG - Intronic
995932514 5:117465036-117465058 GAGGGTGGGAAGGGTACTGGGGG - Intergenic
996082299 5:119269207-119269229 GAGGGAAGGAATGAGGCTCACGG - Intronic
996263587 5:121505924-121505946 GTGGGAGGGAGGGGTGGTGAGGG + Intergenic
996464024 5:123779109-123779131 GAGGGATGTATGGATGCCGAGGG - Intergenic
996479902 5:123963598-123963620 GAGGGAGGGAAGGATAAACAGGG - Intergenic
996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG + Intergenic
997376738 5:133402931-133402953 CGGGGAGGGAAGGAGGCGGAAGG + Intronic
997577202 5:134989584-134989606 GAGAGAGAGAAGGAGGCTGCCGG - Intronic
997739889 5:136244141-136244163 GAGGGAGGGAAGGGAGGGGAGGG - Intronic
997756557 5:136405180-136405202 GAGGGAGGGAAGGAGGAGGCAGG - Intergenic
997854179 5:137358442-137358464 GAGGGAGGGAGGGAAGGGGAGGG + Intronic
997859411 5:137403060-137403082 GAAGGAAGGAAGGAAGGTGAAGG - Intronic
998462501 5:142320185-142320207 AAGAGGGGGAGGGATGCTGAGGG + Intronic
998650795 5:144119100-144119122 GAAGGAGTGAAGGAGGCTGGTGG + Intergenic
998676133 5:144410016-144410038 GAGGAGGGGAAGGATGCTCCAGG + Intronic
998740544 5:145195720-145195742 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
998794195 5:145800251-145800273 GAGGGAGAGAGGAATTCTGAAGG - Intronic
999184767 5:149698852-149698874 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
999231901 5:150066675-150066697 CAGGGTGGGAAGGATGTTGGGGG - Intronic
1000115314 5:158148716-158148738 GAGGGAGGGAAGGAGAAAGAAGG - Intergenic
1000386023 5:160675478-160675500 GAGGGAGGAGAGGATGCTGAAGG + Intronic
1001089402 5:168726378-168726400 GAGGGAGGCAGGGAGGCAGAGGG + Intronic
1001089408 5:168726396-168726418 GAGGGAGGCAGGGAGGCAGAGGG + Intronic
1001241689 5:170076130-170076152 GGGGCAGGGAAGCATGCTGGAGG + Intronic
1001398120 5:171431135-171431157 GAGGGAGTGATGGAGGCTGCTGG + Intronic
1001624273 5:173117551-173117573 GAGGGAGGGAGGGAGGAAGAGGG - Intronic
1001774856 5:174320935-174320957 GAGGGAGGGAGGGAGGAAGAAGG - Intergenic
1001936400 5:175708889-175708911 GAGGGAGGGATGGATCTTGAGGG + Intergenic
1002048712 5:176556922-176556944 GAGGGAGGGGAGGAGGCCAAAGG - Intronic
1002080964 5:176737162-176737184 GAGGTAGGGAATGATGCCTAAGG + Intergenic
1002088935 5:176793232-176793254 GACGGAGGGTGGGGTGCTGAGGG - Intergenic
1002094922 5:176824995-176825017 GAGGGAGGGAAGGAGAGGGATGG - Intronic
1002191353 5:177479406-177479428 GAGGGTGGGGAGGATGTGGAAGG - Intergenic
1002193592 5:177491026-177491048 GAGGTGGGCAAGGATGCGGAAGG + Exonic
1002298597 5:178245294-178245316 GATGGATGGATGGATGATGATGG - Intronic
1002400508 5:178989212-178989234 GAGGGTGGGGAGGGTGGTGAGGG - Intronic
1002556925 5:180049228-180049250 GAGTGAGGGAAGGAGGCAGAGGG - Intronic
1002639041 5:180621980-180622002 GAGGGAGGGAGGGAGGCAGGAGG - Intronic
1002841828 6:913091-913113 GAGCGGGGGAAGGAGCCTGACGG - Intergenic
1002917659 6:1542025-1542047 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1002917708 6:1542169-1542191 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1003050167 6:2773288-2773310 GAGGGAGCGCAGTATGATGAAGG + Intronic
1003427843 6:6009105-6009127 GAGGAAGGCAAGGACGTTGAGGG - Intergenic
1003518443 6:6837051-6837073 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1003812234 6:9796917-9796939 GAGGGAGGGAAGGAGGGGGAAGG + Intronic
1004250788 6:14021738-14021760 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1004420087 6:15461442-15461464 GGAGGAGGGAGGGTTGCTGAAGG + Intronic
1004751374 6:18565776-18565798 GAGGGAGGGAGGGAAGAAGAAGG - Intergenic
1005018780 6:21398437-21398459 GAGGGAGGGAAGGAGGGGAAGGG - Intergenic
1005176021 6:23045404-23045426 GAGGGAGGGAGGGAGGGAGATGG + Intergenic
1005341482 6:24847575-24847597 GAGGGAGGGCAGGTCACTGAAGG + Exonic
1005555636 6:26979401-26979423 GAGGGAGGGAAGGAGGGAGAGGG + Intergenic
1005996828 6:30936678-30936700 AAGGGAGGGGAGGAGGATGATGG - Intergenic
1006112071 6:31753463-31753485 GAGGTGGGGAAGGAGGTTGAGGG + Intronic
1006187727 6:32190216-32190238 GAGCGAGGGAGGGAGGCTGGGGG + Intergenic
1006197548 6:32255110-32255132 GAGGGAGAGAAGGAAGCTGAGGG + Intergenic
1006249424 6:32768731-32768753 GAGGATGGGAAGGAGGGTGAAGG - Intergenic
1006525026 6:34596954-34596976 GATGGAGGGATGAATGATGAAGG - Intronic
1006923215 6:37639637-37639659 GAGGGAGGGAAGAATGTTCCAGG - Intronic
1006974667 6:38088385-38088407 GAGGCTGGGAAGGGTACTGAAGG + Intronic
1007168782 6:39847672-39847694 GAGGAAGGGGTGGATGCTGGTGG - Intronic
1007227946 6:40328026-40328048 GTGGGAGGCAGGGCTGCTGAGGG + Intergenic
1007231756 6:40353037-40353059 GAGGTAGTGAGGAATGCTGATGG - Intergenic
1007244748 6:40452821-40452843 GAGAGAGAGAAGGAAGCAGAGGG + Intronic
1007343409 6:41208604-41208626 GTGGGAGGGGAGGAGGGTGAGGG + Intergenic
1007498985 6:42281001-42281023 GACGGTGGGAGGGATGATGAAGG + Intronic
1007656950 6:43456123-43456145 GAGGGAGGGAAGGGTGGTGGGGG - Exonic
1007835625 6:44671658-44671680 GAAGGAGGTGAGGATGCTGAAGG - Intergenic
1008057449 6:46959820-46959842 GAGGGAGGGAGGGAAGATGAGGG + Intergenic
1008057455 6:46959838-46959860 GAGGGAGGGAGGGAAGATGAGGG + Intergenic
1008286180 6:49654040-49654062 GAGGGAGGGAAGAAGGAAGAAGG - Intergenic
1008452071 6:51664318-51664340 GAGGGAGAGAAGGAGACAGAGGG + Intronic
1008654146 6:53594123-53594145 CAGGGAGAGAAGGATGCAGGAGG + Intronic
1009447810 6:63763947-63763969 GAGGGAGGGAGGGAGGCCGGAGG - Intronic
1009684273 6:66936336-66936358 GAGGGAGGCTGGGAGGCTGAGGG + Intergenic
1011378119 6:86712712-86712734 GAGAGAGGGAAGAATTATGAAGG - Intergenic
1011847330 6:91582338-91582360 GAGGATTGGAAGGATGCAGAAGG - Intergenic
1012643301 6:101649842-101649864 GAGGAAGGGAAAGGTGCAGAAGG + Intronic
1013123268 6:107159294-107159316 GAGGGAGGGAGGGAGGCGGAAGG + Intronic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1013630659 6:111983063-111983085 GAGGGAGGGAAGAATGCACAAGG - Intergenic
1013749074 6:113381099-113381121 GAGGGAGGGAAGAATGATGTTGG + Intergenic
1014160305 6:118160032-118160054 GAGTAAAGGCAGGATGCTGAGGG + Intronic
1014626569 6:123733295-123733317 GAGGGAGGGATGGAGGGAGAAGG + Intergenic
1014676997 6:124379165-124379187 GAGGGAGGGAGGGAAGAGGAGGG + Intronic
1014743454 6:125172021-125172043 GAGGGAGGGAAGGAGGCAGTAGG - Intronic
1015114652 6:129634656-129634678 TAGGGAGGGAAAGATGGGGAAGG + Intronic
1015181601 6:130366529-130366551 GGGGAAGGAAAGGGTGCTGACGG + Intronic
1015567445 6:134588042-134588064 AAGGGAGGGAGGGATGGGGAGGG + Intergenic
1015805272 6:137102203-137102225 TGGGGAGGGAAGGAGGCTCAAGG - Intergenic
1016116777 6:140296160-140296182 GAGGCAGGGAAGGATGTAGCAGG + Intergenic
1016330230 6:142946396-142946418 GAGGGAGGGAGGGAGGAAGAGGG + Intergenic
1016456875 6:144240077-144240099 GAGGCTGGGAAGGATAGTGAAGG - Intergenic
1016461279 6:144282642-144282664 GAGGGAGGGAAGGAAGAGGAAGG - Intergenic
1016669878 6:146691885-146691907 GAGGGATGGAAGGAGGAAGAAGG - Intronic
1016758311 6:147710988-147711010 GAGGGAGGGAAGGAAAATAAAGG + Intronic
1016762503 6:147753705-147753727 GAGGCTGGGAAGGGTGGTGAGGG - Intergenic
1016924911 6:149335018-149335040 GAGGGAAGGAGGGAGGCGGAAGG - Intronic
1017075768 6:150616408-150616430 GAGGGAGGCAAGGATGCCTTTGG + Intronic
1017206488 6:151808416-151808438 GAGGGAGGGAGGGAGGGAGAAGG + Intronic
1017258911 6:152364660-152364682 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1017962249 6:159232847-159232869 GAGGGAGCGGAGGCTTCTGATGG + Exonic
1018219608 6:161565171-161565193 GAGGGAGGCTAAGAAGCTGAGGG - Intronic
1018240927 6:161773920-161773942 GAGGAAGGGAGTGATGCTGCTGG + Intronic
1018445591 6:163855311-163855333 GAGGAATGAAAGGATGCTAATGG - Intergenic
1018665495 6:166132840-166132862 GAGGGAGGGAAGGAAGGGAAGGG + Intergenic
1018733211 6:166668835-166668857 GAGGGAGGGAGGGATGGAGGAGG - Intronic
1018834618 6:167473589-167473611 GAGGGGAGGGAGGATGATGAGGG + Intergenic
1018871962 6:167790370-167790392 GGGGTAGGGGAGGATGGTGAGGG - Intronic
1019226279 6:170512616-170512638 GAGGGAGGAGAGGCGGCTGAGGG + Intergenic
1019419794 7:945716-945738 GAGGGAGGGAAAGAGGCTGGCGG - Intronic
1019443074 7:1057052-1057074 GAGGGAGGGAGGGAGGCTCAGGG + Intronic
1019465586 7:1186350-1186372 GAGAGAGGGCACGAGGCTGAGGG + Intergenic
1019522733 7:1468012-1468034 GAGGATGGGGAGGGTGCTGAGGG - Intergenic
1019536880 7:1533872-1533894 GGGGGAGAACAGGATGCTGATGG + Intronic
1019612824 7:1945587-1945609 GATGAAGGGAAGGAGGGTGAGGG + Intronic
1019781382 7:2942287-2942309 GAGGGAGGGAGGGAGGAAGAGGG - Intronic
1019910920 7:4100212-4100234 GAGGGAGGGACAGATGCGGATGG + Intronic
1020065229 7:5183259-5183281 GAGAGCAGGAAGGATGCTCAGGG - Intergenic
1020080210 7:5282774-5282796 GAGGGAGGAGAGGAGGGTGAAGG + Intronic
1020202748 7:6093159-6093181 GAGGGAGGGAAGGAAGGGAAGGG - Intergenic
1020256307 7:6504543-6504565 GAGAGAGGGAATGAGGCTGGAGG + Intronic
1020422606 7:8026378-8026400 GTGGGAGGGATGAATGCTGTAGG - Intronic
1020489322 7:8759678-8759700 GAAGGGGGGAAGAATGTTGAAGG - Intergenic
1021283108 7:18745175-18745197 GAGGGAAGGAATGAAGATGAAGG + Intronic
1021329943 7:19324019-19324041 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1021729781 7:23585121-23585143 GGGAGAAGAAAGGATGCTGAAGG + Intergenic
1022030987 7:26491761-26491783 GAGGGAGGGGAGCATCTTGATGG + Intergenic
1022056021 7:26735101-26735123 GAGAGAGGGAAGGATGCTGTGGG - Intronic
1022174862 7:27863211-27863233 AAGAGAGGGAAGGATAATGATGG - Intronic
1022357043 7:29625762-29625784 GAGGGAGGGAGGGAAGGGGAGGG + Intergenic
1022493723 7:30840021-30840043 GAGGGAGGGACAGAAGCTGGTGG - Intronic
1022518137 7:30988602-30988624 GAGGGAGGGAGGGATGGTGTGGG - Intronic
1022929921 7:35100553-35100575 GAGGCTGGGAAGGATAGTGAGGG + Intergenic
1022941784 7:35248919-35248941 GAGGGAGGGAAGGAGGGAAAGGG + Intronic
1023126370 7:36958448-36958470 GAGGGAGGGAAGGACTCTGGAGG - Intronic
1023205964 7:37750083-37750105 GAGATGGGGAAGGCTGCTGAGGG - Intronic
1023603245 7:41901736-41901758 TTGGGAGGGGAGGATACTGAGGG - Intergenic
1023965621 7:44961908-44961930 GAGGGGCTGAAGGAGGCTGAGGG + Intergenic
1024109783 7:46133618-46133640 GAGGGAGAGAAGGAGGAGGAGGG - Intergenic
1024532499 7:50405516-50405538 GTGGGAGCCTAGGATGCTGAGGG - Intergenic
1025117182 7:56268391-56268413 GAGGGAGGGAGGGAGGAAGAAGG - Intergenic
1025198707 7:56949423-56949445 GAGGGAGGAGAGGAGGGTGAAGG - Intergenic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1026162651 7:67883276-67883298 GAGGGAGAGAAGGAGGGAGACGG - Intergenic
1026162655 7:67883294-67883316 GAAGGAGGGAAGGAAGGGGAGGG - Intergenic
1026238023 7:68545754-68545776 GAGGGAGAGAAGGAGGGGGAGGG - Intergenic
1026300177 7:69090836-69090858 GAGGGAGGGAAGGTAGCGGAGGG + Intergenic
1026595776 7:71733097-71733119 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1026662821 7:72317169-72317191 GAGGGAGGGAAGGAGGCAGGAGG + Intronic
1026747894 7:73027022-73027044 GAGAGAGGGAAGAATGGGGAGGG - Intergenic
1026751544 7:73055161-73055183 GAGAGAGGGAAGAATGGGGAGGG - Intergenic
1026755193 7:73083275-73083297 GAGAGAGGGAAGAATGGGGAGGG - Intergenic
1026758841 7:73111309-73111331 GAGAGAGGGAAGAATGGGGAGGG - Intergenic
1026833096 7:73622013-73622035 GAGGGAGGGAGGGAGGGAGATGG - Intronic
1026927533 7:74204446-74204468 GAGGGAAGGAAGGAGGGAGAGGG + Intronic
1026927554 7:74204504-74204526 GAGGGAGGGAAGGAAGGAGGGGG + Intronic
1026944506 7:74307127-74307149 GAGGGGGAGAAGGGTGCAGAGGG - Intronic
1027034100 7:74912316-74912338 GAGAGAGGGAAGAATGGGGAGGG - Intergenic
1027088563 7:75282177-75282199 GAGAGAGGGAAGAATGGGGAGGG + Intergenic
1027092206 7:75310105-75310127 GAGAGAGGGAAGAATGGGGAGGG + Intergenic
1027095849 7:75338072-75338094 GAGAGAGGGAAGAATGGGGAGGG + Intergenic
1027323492 7:77029620-77029642 GAGAGAGGGAAGAATGGGGAGGG - Intergenic
1027470409 7:78566300-78566322 GAACGGTGGAAGGATGCTGAGGG + Intronic
1027470486 7:78567614-78567636 GAGAGAGAGAAGGAAGCTGGAGG - Intronic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1028728138 7:94112690-94112712 GAGGGAGGGAGGGAGGAGGAAGG + Intergenic
1028773144 7:94650242-94650264 AAGGGAGGGGAGGTTGCAGAAGG + Intronic
1029395949 7:100308783-100308805 GAGAGAGGGAAGAATGGGGAGGG + Intronic
1029396172 7:100310169-100310191 GAGAGAGGGAAGAATGGGGAGGG + Intronic
1029396398 7:100311559-100311581 GAGAGAGGGAAGAATGGGGAGGG + Intronic
1029396622 7:100312949-100312971 GAGAGAGGGAAGAATGGGGAGGG + Intronic
1029396847 7:100314341-100314363 GAGAGAGGGAAGAATGGGGAGGG + Intronic
1029412969 7:100427188-100427210 GAGGGAGGGAAGGGGGAGGAAGG - Intronic
1029412980 7:100427214-100427236 GAGGGAGGGAAGGGGGAGGAAGG - Intronic
1029422695 7:100479295-100479317 GAGGGAGGGAGGGAGGAGGAAGG - Intergenic
1029479494 7:100803960-100803982 GAGGAAGAGGAGGTTGCTGATGG + Intronic
1029507145 7:100969291-100969313 GAGGGAGGGAGGGAGGCTAGAGG - Intergenic
1029594751 7:101531571-101531593 AAGGGAGGGAAGGAGGGAGAGGG + Intronic
1029825815 7:103192997-103193019 GAGGCTGGGAAGGATAGTGAGGG + Intergenic
1030037946 7:105424183-105424205 GAGGGAGGGAAGGAGGGAGGGGG - Intergenic
1030751968 7:113240193-113240215 GAGGGAGGGAGGGAGGGAGAGGG - Intergenic
1031540627 7:122990883-122990905 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1031743329 7:125462741-125462763 GAGGGAGGGAAGGAGAGGGAGGG - Intergenic
1031819561 7:126483165-126483187 GAAGGAAGGAAGGAAGTTGAAGG - Intronic
1031866139 7:127040007-127040029 GAGGGAGGGGAGGGTGAGGAGGG + Intronic
1031866147 7:127040025-127040047 GAGGGAGGGGAGGGTGAGGAGGG + Intronic
1031995326 7:128226737-128226759 GATGGATGGAAGGATGGAGATGG - Intergenic
1032790989 7:135242200-135242222 GAGGGAGGGAGGGGAGCAGAAGG + Intronic
1032799840 7:135309164-135309186 GAGGGAGGGAAGGAGATGGAAGG + Intergenic
1032833044 7:135648039-135648061 GAGGGAGGGAAGGAGAATGCAGG - Intronic
1032996106 7:137448528-137448550 GAGGGAGGGAGGGAAGGGGAAGG + Intronic
1033263676 7:139865875-139865897 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1033525351 7:142207949-142207971 TAGGGAGAGAAGAATGGTGAAGG + Intronic
1033729299 7:144158924-144158946 GAGGGAGGGAGGGAGGGGGAAGG + Intergenic
1033755129 7:144392139-144392161 AAGGGAGGGTAGGAAGCAGATGG + Intergenic
1033800055 7:144890493-144890515 AAGGGTGTGAAGGATACTGATGG + Intergenic
1033842057 7:145386743-145386765 GAGGGAGGCAGGGTTGCTGTTGG + Intergenic
1034412030 7:150946898-150946920 GAGGGTGGGGAGGGGGCTGACGG + Exonic
1034458784 7:151186760-151186782 GAGAGAGGGGAGGCTGCAGATGG - Intronic
1034607396 7:152329737-152329759 GAGGGAGGGAAGGAAGGAGATGG + Intronic
1034697457 7:153066483-153066505 GAAGGAGGGCAGGATGCAGTCGG + Intergenic
1034869148 7:154668061-154668083 CAGGAAGGGAAGGAAGGTGAAGG - Intronic
1034975503 7:155446911-155446933 GAGGGAGGGAGGGAGGAGGAAGG + Intergenic
1035088110 7:156278877-156278899 TAGCCAGGGAAGGATCCTGATGG - Intergenic
1035178962 7:157075646-157075668 GAGAGAGGGAAAGGTGCAGATGG - Intergenic
1035226726 7:157438017-157438039 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035226746 7:157438076-157438098 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035276623 7:157751848-157751870 GAGGGAGGGAGGGATGGAAAGGG + Intronic
1035386938 7:158479339-158479361 GAGAGAGGGAGGGAGGCTGTCGG - Intronic
1035633467 8:1126467-1126489 GAGGGAGGCAAGGCAGGTGAGGG + Intergenic
1035770409 8:2142698-2142720 GAGGGAGGGAGGGAAGGGGAGGG - Intronic
1035834435 8:2733629-2733651 GAGGCAGAGAGGGCTGCTGAGGG + Intergenic
1035870046 8:3127862-3127884 GAGGGAGGGAAGGAATGAGAGGG + Intronic
1035918578 8:3652349-3652371 GATGGTGGTAAGCATGCTGATGG - Intronic
1036051667 8:5205819-5205841 GAGGGAGGGAGGGAGGAAGAGGG + Intergenic
1036288013 8:7461907-7461929 GAGGTTGGGTAGGATGCTGCAGG + Intronic
1036333463 8:7849621-7849643 GAGGTTGGGTAGGATGCTGCAGG - Intronic
1036361855 8:8083225-8083247 GAGGGAGGGAAGCATGGGGGAGG - Intergenic
1036533962 8:9627034-9627056 GAGGAAGGGAGAGAGGCTGAAGG + Intronic
1036691640 8:10948291-10948313 GAGGGACAGCAGGACGCTGAGGG - Intronic
1036896699 8:12641934-12641956 GAGGGAGGGAAGCATGGGGGAGG + Intergenic
1037097963 8:15008557-15008579 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1037656170 8:20886035-20886057 GAGGGAGGGAGGGAAGGAGAGGG + Intergenic
1037738086 8:21582733-21582755 GAGGGAGGGCAGGATGTGGCTGG - Intergenic
1038212641 8:25533837-25533859 GGGGGAGGGAAGGAGGATGGTGG - Intergenic
1038340351 8:26680684-26680706 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1038436644 8:27541146-27541168 GAGGCTGGGGAGGTTGCTGATGG - Intronic
1038449994 8:27633821-27633843 GAGGGAGGAAAGGAGGGAGAGGG + Intergenic
1038497308 8:28012872-28012894 GAGGGAGGGAGGGATGGAGAAGG + Intergenic
1038521735 8:28238835-28238857 GACGTGGGCAAGGATGCTGAAGG - Intergenic
1038682229 8:29679502-29679524 GAGAGAGGGAAGGATGGCGGTGG - Intergenic
1038778737 8:30553140-30553162 CAGGTAGTGAAGAATGCTGATGG + Intronic
1039065968 8:33607786-33607808 GAGGGAGGGAGGGAGGAAGAAGG - Intergenic
1039106562 8:33996083-33996105 GAGGGAGGGAGGGAAAATGAGGG + Intergenic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1039410219 8:37348829-37348851 GAGAGAGGGATGGGTGCTGTGGG - Intergenic
1039568198 8:38565808-38565830 GAGGGAGGGAGGGATGATCTAGG - Intergenic
1039762190 8:40589905-40589927 GAGGGAGGGAGGGAGGAAGAAGG - Intronic
1039781326 8:40789029-40789051 GAGGGAAGGAAGGAAGGAGAAGG + Intronic
1039845463 8:41322424-41322446 GAGGGAGGGAGGGAGGGGGAGGG + Intergenic
1039882326 8:41632697-41632719 GGCGGAGGGAAGGAGGCTGCAGG + Intergenic
1039931984 8:42001015-42001037 GAGGGAAGGAAGGAGGAGGAAGG + Intronic
1040955466 8:52975430-52975452 GAAGAAGAGAAGAATGCTGACGG - Intergenic
1041143535 8:54847129-54847151 GAGGGAGGGAAGGAGACAGAGGG + Intergenic
1041568289 8:59305700-59305722 GAGGGAGGGAATGAAGCGGGGGG - Intergenic
1041609910 8:59833498-59833520 GAGGGAGAGGAGGAGGCAGAGGG + Intergenic
1041681006 8:60591303-60591325 GAGGGAGGGAGGGAGGGAGAAGG - Intronic
1041930894 8:63285187-63285209 GAGGGAGGGAAGGAAAGGGAAGG - Intergenic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1042781101 8:72491896-72491918 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1042906035 8:73773083-73773105 GAGGGAGGGAGGGAGGAGGAGGG + Intronic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1043602040 8:81952539-81952561 GAGGGAGGGAGGGAGGGTGAGGG - Intergenic
1043803565 8:84642971-84642993 GAGGGAGCTAAGGATGCTTTTGG + Intronic
1044300005 8:90572803-90572825 GAGGGAGGGAGGGAGGATGGGGG + Intergenic
1044430674 8:92103165-92103187 GAGGGAGGGAGGGAGGCGGGAGG - Intronic
1044729042 8:95215654-95215676 ATGGGAGGGAAGGATGGGGAAGG - Intergenic
1045233090 8:100324831-100324853 GAGGGAGGGAGGGAGGAAGAAGG - Intronic
1045541884 8:103094437-103094459 GAGGGAGGGAGGGAGGGGGAAGG - Intergenic
1045650588 8:104338634-104338656 GAGGGAGGGAGGAAAGCTGAGGG - Intronic
1045679275 8:104641943-104641965 GAGGGAGGGAAGGGGGAAGAAGG - Intronic
1045755149 8:105533819-105533841 GAGGGAGGGAGGGAGGAAGAGGG - Intronic
1045950707 8:107848904-107848926 GAGGGAGGGAAGGAAGGAAAGGG + Intergenic
1046651100 8:116837418-116837440 GAGGGAGGGGAGTATGCTAATGG + Intronic
1046859100 8:119070477-119070499 GAGGGAGGGAAGGAGGGGGAAGG - Intronic
1047958996 8:129997137-129997159 GAGGGAGGAAAGGAGGGAGAGGG + Intronic
1048053998 8:130846628-130846650 GAAGGAGGGAAGGAAGGAGAAGG - Intronic
1048054042 8:130846788-130846810 GAGGGAAGGAAGGAAGGAGAAGG - Intronic
1048308643 8:133301142-133301164 AAGGGAGAGATGGATGCTGGAGG - Intronic
1048348267 8:133594967-133594989 GAGGAAGGGAAGAAAGGTGAAGG - Intergenic
1048357312 8:133664126-133664148 CAGGGAGGGAAGGAGGCTTTTGG + Intergenic
1048754836 8:137727260-137727282 GAGGGAGGGAAGGAAGGAGAGGG + Intergenic
1048840032 8:138557607-138557629 GAGGGAGGGAAGAAAGAGGAAGG + Intergenic
1048997060 8:139800892-139800914 GAGGGAGGGAAGGTACCGGAGGG - Intronic
1048997067 8:139800910-139800932 GAGGGAGGGAAGGTACCGGAGGG - Intronic
1048997106 8:139801024-139801046 GAGGGAGGGAAGGTACCGGAGGG - Intronic
1048997113 8:139801042-139801064 GAGGGAGGGAAGGTGCCGGAGGG - Intronic
1049008944 8:139874694-139874716 AAGGGAGGCAAGGATGAAGAAGG + Intronic
1049102795 8:140591049-140591071 GAAGGAGGGAAGGAAGCTCTGGG + Intronic
1049149429 8:141024904-141024926 GAGGGATGGACTGATGCTGATGG + Intergenic
1049235636 8:141510887-141510909 GGGGGAGGGGGTGATGCTGATGG + Intergenic
1049370301 8:142261165-142261187 GAGAGAGGGAAGGATGTGGGAGG + Intronic
1049378295 8:142299468-142299490 GAGGAAGGGAAGGACGTTCAAGG + Intronic
1049396913 8:142405168-142405190 GAGGGGGAGGAGGATGCTAAGGG + Intergenic
1049415484 8:142492991-142493013 TAGAGAGGGAAGGCTCCTGAAGG - Intronic
1049551932 8:143264044-143264066 GAGGGAGGGGAGGCAGCAGAAGG - Intronic
1049577451 8:143396352-143396374 GGGGAAGGGATGGATGCTGGGGG - Intergenic
1049595460 8:143481331-143481353 CGGGGAGGGAAGGATGCTGAGGG - Intronic
1049618698 8:143588238-143588260 GAGTCAGGGAAGGACTCTGAAGG - Intronic
1049739830 8:144233348-144233370 GGGGGAGGGAAGGTTGATGGTGG - Intronic
1049791889 8:144475924-144475946 GGGGGAGGGGAGCATGCCGAGGG + Exonic
1049805544 8:144537177-144537199 GTGGGTGGGAAGGGTGCTGGTGG + Intronic
1049872583 8:144992488-144992510 GAAGGAGTGAAAGATGATGAAGG + Intergenic
1050160267 9:2711593-2711615 GAGGGAGAGAGGGAGGCAGAAGG - Intergenic
1050707200 9:8414887-8414909 GAGGGAGAGAGGGATGGGGAGGG + Intronic
1050766488 9:9141194-9141216 GAGGGAGGGAAGCAAGCAGATGG - Intronic
1050866791 9:10510837-10510859 TGGGGAGGGAAGGATGAAGAAGG - Intronic
1051469719 9:17423878-17423900 GAATGAGGGAAGGATGATGTAGG + Intronic
1052433970 9:28402575-28402597 AAGGGAGGGAAGGAGGGAGAGGG - Intronic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1053135350 9:35647213-35647235 GAGGGAGGGAGGGAGGCTTCGGG - Intergenic
1053337320 9:37286989-37287011 GAGGGAGGGAAGGAGGGGGGAGG - Intronic
1053473225 9:38361575-38361597 AAGGCAGGGGAGGATGCTCAGGG - Intergenic
1053796704 9:41733122-41733144 AAGAGATGGAAGGGTGCTGAAGG + Intergenic
1054148482 9:61581739-61581761 AAGAGATGGAAGGGTGCTGAAGG - Intergenic
1054468233 9:65512834-65512856 AAGAGATGGAAGGGTGCTGAAGG - Intergenic
1054653392 9:67643299-67643321 AAGAGATGGAAGGGTGCTGAAGG - Intergenic
1054728294 9:68674861-68674883 GAAGGAAGGAAGGAGGCTCAAGG - Intergenic
1054891152 9:70253374-70253396 AAGGGAGGGAAGAAGGCAGATGG - Intergenic
1055007655 9:71526942-71526964 GGGGGAGGGAAGGAGGATGGAGG - Intergenic
1055419233 9:76119947-76119969 GAGGCTGGGAAGGGTGGTGATGG - Intronic
1055708227 9:79031779-79031801 GAGGGAGGGAGGGATGAAGGAGG + Intergenic
1056137751 9:83646590-83646612 GAGGGAGGGAAGGGGGAAGAAGG + Intergenic
1056341747 9:85641577-85641599 GTGGCAGGGAAGGCTGCAGAAGG + Intronic
1056618329 9:88187625-88187647 GAGGGAGGGAGGGGAGGTGAGGG + Intergenic
1056713281 9:89008854-89008876 TAGGGAGAGAAGGAAGCTGACGG - Intergenic
1057113951 9:92502400-92502422 GAGGGAGGTGACGATACTGAAGG - Intronic
1057226567 9:93296192-93296214 AGGTGAGGGAAGGATGGTGAGGG - Intronic
1057226833 9:93296994-93297016 TGGGGAGGGGAGGATGCGGAGGG - Intronic
1057518410 9:95740461-95740483 GTGGGAGGCAAGGAGGTTGAAGG + Intergenic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1058708469 9:107657459-107657481 GAGAGAATGTAGGATGCTGAAGG + Intergenic
1058921911 9:109624886-109624908 GAGGGAGGGAAGGAAGGGAAGGG - Intergenic
1059082879 9:111268715-111268737 GAGGGAGAGAAGCAGGTTGAGGG - Intergenic
1059305648 9:113351073-113351095 GAGGGAGGAAGTGATGCTAATGG + Intronic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1059653701 9:116337982-116338004 TGGGGAGGGAAGGATAGTGATGG + Intronic
1059876925 9:118645375-118645397 GAGGGAGGGAGGGAGGATGGAGG - Intergenic
1060183915 9:121552380-121552402 GAGGGAGGAAAGTAGGCTGGTGG - Intergenic
1060227634 9:121804099-121804121 GAGGCTGGGAAGGGTGTTGAGGG - Intergenic
1060227800 9:121806067-121806089 GAGGCTGGGAAGGGTGTTGAGGG + Intergenic
1060413376 9:123414320-123414342 GAGGCAGGGAAACCTGCTGATGG - Intronic
1060766295 9:126296899-126296921 GTGGGCGGGAAGGATGGGGAAGG - Intergenic
1060906858 9:127314554-127314576 GAGGGAGGGAGGGAGGGGGAGGG - Intronic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061389054 9:130307173-130307195 GAGGGAGGGACGTGTGCTGGGGG + Intronic
1061871788 9:133524788-133524810 GAGGAAGGCCAGGCTGCTGAGGG + Exonic
1062012979 9:134276804-134276826 GAGGGAGGGACAGAGGCAGAGGG - Intergenic
1062018806 9:134306370-134306392 GATGGTGGTAAGGATGTTGATGG + Intergenic
1062050537 9:134444494-134444516 GAAGGAGGGAAGGAGGGGGAAGG - Intergenic
1062085481 9:134645937-134645959 GAAGGAGGGAAGGATGGAGGGGG - Intronic
1062092443 9:134685504-134685526 GATGGATGGATGGATGGTGATGG - Intronic
1062172845 9:135144964-135144986 AAGGGAGGGAAGGCCGCTGAGGG + Intergenic
1062378707 9:136276491-136276513 GAGGGAGGGGAGCATGCAGGTGG - Intergenic
1062449183 9:136608371-136608393 AAGGGAGGGAAGGAGGGAGAGGG + Intergenic
1062479024 9:136742977-136742999 GAGGGAGGGGAGGGAGCGGAGGG + Intronic
1062703971 9:137924373-137924395 GAGGGAGGGAAGGAAGGAGGAGG - Intronic
1062710116 9:137970963-137970985 GAGGGAGGGCCAGATGCTGCAGG + Intronic
1202802117 9_KI270720v1_random:9588-9610 GAAGGAGGGAAGGAAGGAGAGGG - Intergenic
1203446617 Un_GL000219v1:63145-63167 GAGAGAGGGAAGGAAGGAGAGGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1185476814 X:420286-420308 GAGGGAGGGAAGGGAGGTAAGGG - Intergenic
1185567873 X:1109522-1109544 GAGGGAGGGAGGGAGGAGGAAGG + Intergenic
1185627590 X:1493389-1493411 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1185627603 X:1493428-1493450 GAGGGAGGGAAGGAGGAGGAAGG + Intronic
1185680010 X:1880806-1880828 TAGGGAGGGAAGGAGGAGGATGG + Intergenic
1185824891 X:3240617-3240639 GAGGGAGGGAAGGAAGGGAAGGG - Intergenic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1186020601 X:5251156-5251178 GAGGGAGGGAGGGAAGTGGAGGG + Intergenic
1187327864 X:18308323-18308345 GAGGGAGGGAAGGACAGGGAGGG + Intronic
1187725024 X:22193372-22193394 GAGGGAGGGATGGTTCCTGATGG - Intronic
1188522432 X:31053735-31053757 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1188551508 X:31369578-31369600 TAGGGAGGGAAAAATGTTGAGGG + Intronic
1188645021 X:32554810-32554832 GAGGGAGGGAGGGAGGGGGAGGG + Intronic
1188743780 X:33817186-33817208 GAGGTAGGGCTGGATGCTGGTGG + Intergenic
1188971686 X:36625162-36625184 GAGGGTGGGAAGGGTAGTGAGGG - Intergenic
1189083340 X:37996380-37996402 GAGGGAGGGAAAGGTGAGGAAGG + Intronic
1189551340 X:42096708-42096730 GAGGGAGGGAAGGATAAGAAAGG - Intergenic
1189988857 X:46576136-46576158 GAGAGAGGGAAGGAGGGGGAGGG - Intronic
1190050021 X:47142551-47142573 GAGGCAGGGATGGAGGTTGAAGG - Intronic
1190242388 X:48667648-48667670 GAAGGAGGGAGGGCAGCTGAAGG - Intergenic
1190266212 X:48828643-48828665 GAGGGAGGGCAGGATTTTGCCGG - Intergenic
1190469988 X:50769205-50769227 GAGGGAGGGAAGAAAGGGGAAGG + Intronic
1190644266 X:52510268-52510290 GAGAGAGAGAAGGATGGAGAGGG - Intergenic
1190773792 X:53536626-53536648 GAAGAAGGGCAGGATGCTGGTGG - Exonic
1190813631 X:53908901-53908923 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1190931297 X:54951323-54951345 GAGGGAGGAGAGGATGGGGAGGG + Intronic
1191628738 X:63298667-63298689 GGGGGAGGGAGGGATGGGGAGGG - Intergenic
1191846375 X:65550672-65550694 AAGGGAGGGCAGGCTGCAGAGGG + Intergenic
1191866771 X:65710060-65710082 GAAGGAGGCAAGGATGCAGATGG - Intronic
1191992212 X:67050835-67050857 GGGGGAAGGAAGGGTACTGAGGG - Intergenic
1192201831 X:69071228-69071250 GGGGGAGGGAACCAGGCTGAAGG - Intergenic
1192234547 X:69287324-69287346 GAGGGAGGGGAGGAAGCACAGGG + Intergenic
1192493896 X:71600967-71600989 GAGGCAGGGAAGGATAGTGGAGG - Intronic
1193416914 X:81236879-81236901 GAGGGAGAGAGAGAGGCTGAGGG + Intronic
1193931069 X:87552798-87552820 GAGGCTGGGAAGGATAGTGAGGG + Intronic
1194178468 X:90683523-90683545 TTGGAAGGGAAGAATGCTGATGG - Intergenic
1194921454 X:99771392-99771414 GAGGGAAGGAAGGAAGAGGAAGG + Intergenic
1195001417 X:100646861-100646883 GAGGGTGGGAAGAAGTCTGATGG - Intronic
1195599137 X:106726608-106726630 GAGGGAGGAAAGGACACTGCGGG - Intronic
1195617003 X:106920485-106920507 GAGGGAGAAAGGGATCCTGAGGG - Intronic
1196198552 X:112860188-112860210 GAGGGAGGGAGGGCTGATGGTGG - Intergenic
1196212776 X:113013707-113013729 GAGGGAGGGAAGGGAGGGGAGGG + Intergenic
1196281594 X:113829000-113829022 GAGGGAGGGAGGGAGGGAGAGGG + Intergenic
1196425146 X:115561854-115561876 AAGGGAGGGAAGCAGGCAGAAGG - Intronic
1196902374 X:120397985-120398007 TAGGGAGGGAAGAGTGCTGAAGG - Intergenic
1196910770 X:120482285-120482307 AAGGGAGGGGAGGATGCAGAAGG - Intergenic
1197144876 X:123160232-123160254 GAGGGAGAGAAGAATGAAGAAGG + Intergenic
1197207385 X:123801613-123801635 GAGGGAGGGAAGGAGGGAGGGGG + Intergenic
1197354859 X:125425895-125425917 GAGGCTGGGAAGGATGGTGGGGG + Intergenic
1197398876 X:125964058-125964080 GAGGGAGGGAGGGAAGGGGAGGG + Intergenic
1198115138 X:133537402-133537424 GAGGGAAGGAAGGAAGAGGAAGG + Intronic
1198204379 X:134452262-134452284 GAGGGAGGGAGGGAAGGTCATGG + Intergenic
1198297361 X:135300872-135300894 GAGGGAGGGAAGGATGAGGCAGG + Intronic
1198383422 X:136105258-136105280 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198383427 X:136105276-136105298 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198810300 X:140529177-140529199 GAGGGAGAGAAGGAGGCTAGAGG + Intergenic
1199317073 X:146393555-146393577 GAGGGAGGGAGGGAGGGGGAGGG - Intergenic
1199458314 X:148054252-148054274 GAGGGTGCTGAGGATGCTGAGGG + Intergenic
1199512695 X:148640380-148640402 GAGGGAGGGAGGGAGGGAGAAGG - Intronic
1199665956 X:150096636-150096658 GAGGGAGAACAGGATGGTGAAGG - Intergenic
1200100596 X:153687810-153687832 GCGGGAGGGAGGGATGCGGGAGG + Intronic
1200153925 X:153965259-153965281 GGGGCAGGGAGGGATGCTGGTGG - Intronic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic
1200525132 Y:4265688-4265710 TTGGAAGGGAAGAATGCTGATGG - Intergenic
1200656831 Y:5912638-5912660 GAGGGAGGGAAGGAGGGAGAGGG + Intergenic
1200817463 Y:7548376-7548398 GAGGGAGGGAAGGAGGGAGGAGG + Intergenic
1201146545 Y:11067906-11067928 GAGGGAGGAAAGGAGGGAGAGGG + Intergenic
1201256405 Y:12112282-12112304 GATGGAGGGAAGGAGGGGGAGGG - Intergenic
1201341146 Y:12935693-12935715 GAGGGAGGGAAGGAAGGAAAGGG - Intergenic
1201989723 Y:20010243-20010265 GAGGGAGGGAAGGAATCTCCAGG + Intergenic