ID: 946202818

View in Genome Browser
Species Human (GRCh38)
Location 2:218080791-218080813
Sequence TCACCAGTGATTCCTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946202818_946202828 10 Left 946202818 2:218080791-218080813 CCAGTGCCAGGAATCACTGGTGA 0: 1
1: 0
2: 3
3: 20
4: 145
Right 946202828 2:218080824-218080846 ACCTGGGTGAAGGTGTAGGGAGG 0: 1
1: 0
2: 2
3: 29
4: 281
946202818_946202823 -6 Left 946202818 2:218080791-218080813 CCAGTGCCAGGAATCACTGGTGA 0: 1
1: 0
2: 3
3: 20
4: 145
Right 946202823 2:218080808-218080830 TGGTGATCAGGGCCTTACCTGGG 0: 1
1: 0
2: 1
3: 12
4: 123
946202818_946202824 0 Left 946202818 2:218080791-218080813 CCAGTGCCAGGAATCACTGGTGA 0: 1
1: 0
2: 3
3: 20
4: 145
Right 946202824 2:218080814-218080836 TCAGGGCCTTACCTGGGTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 185
946202818_946202830 30 Left 946202818 2:218080791-218080813 CCAGTGCCAGGAATCACTGGTGA 0: 1
1: 0
2: 3
3: 20
4: 145
Right 946202830 2:218080844-218080866 AGGCAAAAAGAGTTTTGATCTGG 0: 1
1: 0
2: 1
3: 14
4: 209
946202818_946202822 -7 Left 946202818 2:218080791-218080813 CCAGTGCCAGGAATCACTGGTGA 0: 1
1: 0
2: 3
3: 20
4: 145
Right 946202822 2:218080807-218080829 CTGGTGATCAGGGCCTTACCTGG 0: 1
1: 0
2: 3
3: 5
4: 114
946202818_946202826 6 Left 946202818 2:218080791-218080813 CCAGTGCCAGGAATCACTGGTGA 0: 1
1: 0
2: 3
3: 20
4: 145
Right 946202826 2:218080820-218080842 CCTTACCTGGGTGAAGGTGTAGG 0: 1
1: 0
2: 1
3: 19
4: 175
946202818_946202827 7 Left 946202818 2:218080791-218080813 CCAGTGCCAGGAATCACTGGTGA 0: 1
1: 0
2: 3
3: 20
4: 145
Right 946202827 2:218080821-218080843 CTTACCTGGGTGAAGGTGTAGGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946202818 Original CRISPR TCACCAGTGATTCCTGGCAC TGG (reversed) Intronic
901921981 1:12543368-12543390 TCACCAGTGGTTCCGGCTACTGG + Intergenic
904247157 1:29195905-29195927 TCATCTGTGACTCTTGGCACTGG + Intronic
906058474 1:42933472-42933494 TCACCAGGTATCCCTGGCACTGG - Intronic
906536790 1:46555187-46555209 TCACCAGTGAATAGTGGCAGAGG + Intergenic
908594211 1:65668568-65668590 TCCCCAGTGATTCATGCCCCTGG - Intergenic
910055343 1:83026940-83026962 TCATCAGTAATTCTTGGCAAGGG - Intergenic
910657863 1:89636244-89636266 ACACCAGTGTATCCTAGCACTGG + Intronic
919816667 1:201445175-201445197 GCAGCAGTGATCCCTGGCCCAGG + Intergenic
921276906 1:213529772-213529794 TCACCATTGATCCCTGGCATGGG + Intergenic
922144374 1:222924479-222924501 TCTTCAGTGATTCCCTGCACTGG + Intronic
924247635 1:242100349-242100371 TCAAAGGTGAGTCCTGGCACAGG - Intronic
1063169477 10:3494735-3494757 TCACCAGTGAGTCATCGTACTGG + Intergenic
1064413574 10:15129190-15129212 TCTTCAGTGATTCCAGGCTCTGG + Intronic
1065045927 10:21747631-21747653 TTACCAGTGATGCCTGGGAAAGG - Intergenic
1065828933 10:29597003-29597025 TCACCAGACATTCCTGGTAGGGG - Intronic
1066321916 10:34311327-34311349 ACACCTGTAATTCCAGGCACAGG - Intronic
1067497595 10:46774102-46774124 TCAGCAGTGTTTCCTGGGGCGGG + Intergenic
1069843235 10:71353070-71353092 CCACCAGTGATGTCTGGCACTGG - Intronic
1070410995 10:76140296-76140318 TCACCAGAGACTCCTTTCACTGG + Intronic
1070795551 10:79214420-79214442 TCACCAGTGACTCTTGGAATGGG - Intronic
1073098415 10:100994639-100994661 TCTCGAGTGATTCCTGGCACAGG + Intergenic
1075615512 10:123888205-123888227 TCAGCAGTGATTCCCCACACAGG - Intronic
1076312451 10:129518023-129518045 TCCCCAGAGATGCCTGCCACTGG - Intronic
1076784435 10:132742725-132742747 TCACCAGGGATTCCAGACCCCGG - Intronic
1077249861 11:1556203-1556225 TCAGCAGTGTTTCCTGGGGCGGG + Exonic
1078740390 11:14060549-14060571 TAACCAGGGATTCTTGGCCCTGG + Intronic
1079711273 11:23685381-23685403 TTGCCAGTGTTTCCTGGGACTGG + Intergenic
1080332883 11:31160876-31160898 TCAACATTTATTTCTGGCACTGG + Intronic
1080661555 11:34300440-34300462 TAACCAGTGATTTATAGCACTGG - Intronic
1085567834 11:77530848-77530870 CCACCAGTCATTCCTGGCATTGG + Intronic
1085836710 11:79964432-79964454 TCACCAGTGCTTCCTGGGAAGGG + Intergenic
1086927513 11:92656355-92656377 TCACAAGTGAATCCTTGCCCTGG + Intronic
1088980085 11:114854647-114854669 TCAACAGTGATTTCTGCCAGAGG - Intergenic
1089892406 11:121894532-121894554 TTAAAAGTGATTCCTGGCCCTGG - Intergenic
1090000622 11:122954114-122954136 CCACAAGTGATTGCTAGCACTGG + Intronic
1093866850 12:24237902-24237924 TCACCAGGGATTCCTGGAGATGG - Intergenic
1096309407 12:50506603-50506625 ATACCAGTGATTCCCGGGACTGG - Intronic
1098437748 12:70486008-70486030 TCACCTGTGATTCCTGGTGATGG - Intergenic
1100717181 12:97318271-97318293 TCACCAGTGATTCCAGGCCAGGG - Intergenic
1101098410 12:101367606-101367628 TCTACTGTGATTCCAGGCACTGG - Intronic
1101267343 12:103102960-103102982 TCACCTATTATTCCTGCCACAGG + Intergenic
1107353353 13:39539405-39539427 TCACCAGTGATCTCTGGTCCTGG + Intronic
1107872557 13:44760562-44760584 TCACCACTGGTTCTTTGCACAGG - Intergenic
1111012118 13:82326710-82326732 TCTCCAGTGGTCCCTGCCACAGG - Intergenic
1112007960 13:95270480-95270502 TCTCCCATCATTCCTGGCACAGG + Intronic
1112467030 13:99653448-99653470 TCACCTGTAACTCCTGGCAGGGG + Intronic
1120644693 14:87059557-87059579 TGTCCAGTAATTCCTGGCACAGG - Intergenic
1124249544 15:28097796-28097818 TCACCAGTGCTTCCCTGCCCCGG + Intronic
1124319298 15:28701237-28701259 ACACCGCTAATTCCTGGCACCGG + Intergenic
1124489673 15:30146262-30146284 ACACCGCTAATTCCTGGCACCGG - Intergenic
1124538300 15:30563196-30563218 ACACCGCTAATTCCTGGCACCGG - Intergenic
1124753856 15:32392065-32392087 ACACCGCTAATTCCTGGCACCGG + Intergenic
1124760353 15:32444389-32444411 ACACCGCTAATTCCTGGCACCGG + Intergenic
1124778282 15:32604673-32604695 ACACCGCTAATTCCTGGCACCGG - Exonic
1126186201 15:45832552-45832574 TCTCTATTGCTTCCTGGCACAGG + Intergenic
1128290215 15:66472728-66472750 TCACCAGTTATTCCTAGCTTGGG - Intronic
1129319915 15:74768798-74768820 TCAACAGTGAATCCTGCCACTGG - Intergenic
1130357192 15:83144312-83144334 TCTCCAATGATTCCTGCCTCCGG + Intronic
1132415018 15:101613447-101613469 TCACCAGTGACTGCTGGGCCAGG - Intergenic
1133463666 16:6009173-6009195 TCAACAGTGATTCCAGGTCCAGG + Intergenic
1134035168 16:11024553-11024575 TCACCAGGTATTCCAGACACAGG - Intronic
1134304607 16:13020943-13020965 TCACCAGAGAATCCCGGGACTGG - Intronic
1139413304 16:66784105-66784127 TCACCTTTCATTCCTGGCACAGG + Intronic
1139573950 16:67829733-67829755 TCACCAGTCACTCCCTGCACTGG + Intronic
1141503399 16:84460059-84460081 TCACCAGTGATAGCTGCCAAGGG + Intronic
1142682052 17:1555797-1555819 CCACCAGTGCTTCCTGGCACAGG - Intronic
1145883053 17:28365526-28365548 TCTCCAGTGCTCCCAGGCACTGG + Intronic
1147498407 17:40939191-40939213 CCACCAGTTTTTCCTGGCCCTGG - Intergenic
1150337907 17:64343599-64343621 TCACAAATGGTTCCTGACACAGG - Intronic
1150608959 17:66717884-66717906 TCACCTGTGATTCCCGCCTCCGG + Intronic
1153508561 18:5828975-5828997 TCACCAGGGGTCCCTGGCACTGG + Intergenic
1155368683 18:25075419-25075441 TCACCAATGACTCCTGCCACCGG + Intronic
1156725981 18:40127491-40127513 TCATCAGTGTTCCCTGGCACAGG - Intergenic
1157754147 18:50203446-50203468 CCACCAGTGATTCCAAGCAGGGG - Intergenic
1159014226 18:63088530-63088552 TCACAAGGGTTTCCTGGCTCTGG - Intergenic
1159991840 18:74917928-74917950 TCACCATTGTTTACTGACACTGG - Intronic
1161571954 19:5035641-5035663 TCCCCCGAGATTCTTGGCACCGG + Intronic
1162999771 19:14359471-14359493 TAACCAGTGTTTCCTTGCATGGG - Intergenic
1165095094 19:33405895-33405917 GCACCAGGGATTGCTGGCTCTGG - Intronic
1166081040 19:40444272-40444294 TCACTGGTGGGTCCTGGCACTGG - Exonic
1166601619 19:44100745-44100767 TGACCAATGATTCCTGGGAGAGG - Intronic
1167271246 19:48507800-48507822 TGGCCAGTGTTTGCTGGCACAGG + Intronic
927399189 2:22691088-22691110 ACACCACTGATTCCTTGCATAGG + Intergenic
928482014 2:31692666-31692688 TCTCCAGTGGTCCCTGCCACAGG + Intergenic
929393426 2:41496665-41496687 TCTCCAGTGGTCCCTGCCACAGG - Intergenic
932781395 2:74560779-74560801 GGGCCAGTGGTTCCTGGCACAGG - Intronic
933707586 2:85303565-85303587 TCACCAGTGACTCTTGTCATTGG + Intronic
934605329 2:95690812-95690834 TCAACAGTGATTCCTGTCATGGG + Intergenic
936538786 2:113333365-113333387 TCAGCAGTGATTCCTGTCATGGG + Intergenic
939987940 2:148850538-148850560 CAACTAGTGGTTCCTGGCACAGG - Intergenic
943690477 2:190864706-190864728 TCAACTGTGATTCCAAGCACTGG - Intergenic
943799071 2:192035018-192035040 TCCCCACTGTTTCCTGTCACAGG + Intronic
944076311 2:195735042-195735064 TCAACAGTGATTACTGGGAAAGG - Exonic
945661600 2:212692518-212692540 TCACCACTGAATCCTGACTCAGG + Intergenic
946071041 2:217034648-217034670 TCTCCAGTGAGGCCTGTCACTGG + Intergenic
946138464 2:217667552-217667574 TTTCCACTGATTTCTGGCACTGG - Intronic
946202818 2:218080791-218080813 TCACCAGTGATTCCTGGCACTGG - Intronic
946958247 2:224955955-224955977 TTATCATTGATTCCTGGCACTGG - Intronic
947947562 2:234119656-234119678 TCACCTGTGATTCCTTCCATAGG - Intergenic
1168850818 20:975746-975768 TAACCATTGAGTCCTAGCACTGG - Intronic
1170780653 20:19422653-19422675 TCTGCAGTGAGTCCTGGCAGGGG + Intronic
1171180473 20:23087369-23087391 CCCCCAGAGTTTCCTGGCACTGG - Intergenic
1172117151 20:32579829-32579851 TTGACAGTGATGCCTGGCACAGG - Intronic
1172959445 20:38788169-38788191 TCAGCTGGGATTCCTGGAACAGG + Intergenic
1173171048 20:40724169-40724191 TCTCCGGTGATTCCGGGCATAGG + Intergenic
1178293669 21:31390754-31390776 ACATCAGTGTTTCCTGGCATAGG - Intronic
1181456406 22:23062495-23062517 TGAACAGTGTTTCCTGGCCCAGG - Intronic
949592162 3:5505802-5505824 TCTTCAGTGTTTCCTGGCCCTGG - Intergenic
952005162 3:28835339-28835361 TCACCTGTGAAGCCTGGGACCGG + Intergenic
954451612 3:50574743-50574765 TCTCCAGTAGTGCCTGGCACAGG + Intronic
955655500 3:61240782-61240804 TAACCAGTGGTTCTTGGCCCTGG + Intronic
957969603 3:87366065-87366087 TCACCAGCTACTCCTGTCACTGG - Intergenic
968976153 4:3823081-3823103 TCACTTGTGATTCCTGCCTCAGG + Intergenic
974564969 4:63569742-63569764 GGACCAGTGAATCCTGGCAGTGG - Intergenic
977682578 4:99812262-99812284 TCCCCAGTGATTTCTGGGAAGGG + Intergenic
980132772 4:128832055-128832077 ACACCAGTGACTCTTGGAACTGG - Intronic
982312571 4:154001348-154001370 GCACCAATTATTCCTGGCCCTGG - Intergenic
983412439 4:167417956-167417978 TCTCCAGTGGTTTCTGCCACAGG - Intergenic
983461056 4:168026606-168026628 CCTCCAGTGGTTCCTGCCACAGG + Intergenic
984224299 4:177015979-177016001 TCACCAGAAATTTCTGGCATTGG - Intergenic
985757447 5:1727327-1727349 GCACCAGTGAGACCTGGCACAGG - Intergenic
986559535 5:9046644-9046666 TCACCTGTGATACATGGCAGAGG + Intronic
986681050 5:10233105-10233127 GCCCCAGAGATTCCTGGCTCTGG + Intronic
987083675 5:14448835-14448857 TTACCAGTGATTACTGGGAGGGG - Intronic
987398882 5:17454188-17454210 TGGCCAGTGATTCCTTGGACTGG - Intergenic
987472238 5:18346827-18346849 TCACCAGTGAAACTTAGCACTGG + Intergenic
994074154 5:95632377-95632399 TCACCTGACATTCCTGGCAGGGG - Intergenic
996796582 5:127354535-127354557 TCACTAGTGATTTCTGCCACGGG + Intronic
997735605 5:136210453-136210475 TCCCCACTGAGTACTGGCACAGG - Intergenic
997972509 5:138415218-138415240 ACACAAATTATTCCTGGCACAGG + Exonic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1003075423 6:2979743-2979765 TGACCAATGACTCCTGACACAGG - Intergenic
1003237315 6:4307491-4307513 GCACTAGTGATTCCAGACACTGG - Intergenic
1007826193 6:44602657-44602679 TCACCTGCCACTCCTGGCACAGG - Intergenic
1012517973 6:100085339-100085361 TCATCCTTGATTCTTGGCACTGG + Intergenic
1013350133 6:109298210-109298232 TTCCCAATGTTTCCTGGCACAGG + Intergenic
1016280053 6:142406377-142406399 TCACCAGTGTTTGCTGGCAGTGG - Intronic
1018763894 6:166914534-166914556 GCACCAGTGATTCTTGGACCTGG + Intronic
1018838305 6:167501384-167501406 TCTCCAGTGATTCCTGTCGGTGG + Intergenic
1018839365 6:167507554-167507576 GCTCCAGTGCTTCCTGGCAGAGG - Intergenic
1024570642 7:50720452-50720474 TCACCTGTGTTTGCTGCCACCGG - Intronic
1029265194 7:99333385-99333407 TCACCTGTCATGCCTGGAACAGG + Exonic
1029714964 7:102320710-102320732 TCCCTAATGATTCCTGGCAAGGG + Intronic
1032329942 7:130968895-130968917 AAACCAGTGAATCCTGTCACAGG + Intergenic
1033029808 7:137814908-137814930 TCAGCAGCAATTCCTGCCACTGG + Intronic
1035890523 8:3337899-3337921 GCACCAGTGATTCCTGGCCAGGG - Intronic
1038937618 8:32269560-32269582 TTCCCAGTCAGTCCTGGCACAGG - Intronic
1041414562 8:57593599-57593621 TTGCCAGTGGTTCGTGGCACCGG - Intergenic
1041463472 8:58136598-58136620 TTCCAAGTGATTCTTGGCACTGG + Intronic
1041734180 8:61092631-61092653 TAACCTGTGAATCCTGGCCCTGG - Intronic
1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG + Intronic
1048360506 8:133693552-133693574 TCAGCAGTGATGCTTGTCACAGG - Intergenic
1048560451 8:135530536-135530558 TGACCTGTGCTTTCTGGCACTGG + Intronic
1048650284 8:136468415-136468437 TTCCCAGTGAGTCCAGGCACAGG - Intergenic
1049211263 8:141387434-141387456 GTCCCAGTGATGCCTGGCACAGG + Intergenic
1049415960 8:142495274-142495296 TGACCAGTGATGGCTGGCATGGG + Intronic
1050247657 9:3707936-3707958 TCACCAGTGATTGCTGCTTCTGG + Intergenic
1051097590 9:13484207-13484229 TCACCAGTGACACCTGGCAATGG - Intergenic
1055690842 9:78828748-78828770 TCCACGGTGATCCCTGGCACAGG - Intergenic
1057205627 9:93170642-93170664 TGACCAGTGAGGCCTGGCTCAGG + Intergenic
1062375845 9:136261548-136261570 TCTTCAGAGATTCCTGGGACTGG + Intergenic
1187447515 X:19372414-19372436 ACCGCAGTGATTCCAGGCACTGG - Intronic
1187858139 X:23656712-23656734 GCACCAGGGATCCATGGCACTGG - Intergenic
1188830229 X:34887598-34887620 TCACCAGTCATTCTTAGAACTGG - Intergenic
1189212203 X:39292932-39292954 TCACCAGTCATTCCTGGCAGAGG + Intergenic
1192607244 X:72531080-72531102 TCACCAATCATTCCTTGCTCTGG - Intronic
1195767886 X:108316046-108316068 TCACCAGTGCTTTCTTGCATGGG + Intronic
1196236504 X:113287261-113287283 TCCCCTGTGATTCCTCACACAGG - Intergenic
1196847811 X:119910515-119910537 GCATCCCTGATTCCTGGCACAGG - Intronic