ID: 946210082

View in Genome Browser
Species Human (GRCh38)
Location 2:218140452-218140474
Sequence GTTCCTAATTCCTCTCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946210082_946210083 -8 Left 946210082 2:218140452-218140474 CCAGTAGGAGAGGAATTAGGAAC No data
Right 946210083 2:218140467-218140489 TTAGGAACGATCCTTCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946210082 Original CRISPR GTTCCTAATTCCTCTCCTAC TGG (reversed) Intergenic
No off target data available for this crispr