ID: 946215011

View in Genome Browser
Species Human (GRCh38)
Location 2:218177405-218177427
Sequence CATCCTGCACAGATGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946215006_946215011 9 Left 946215006 2:218177373-218177395 CCAGGTGAGTTGAACAGTCAGAT No data
Right 946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946215011 Original CRISPR CATCCTGCACAGATGGGACA CGG Intergenic
No off target data available for this crispr