ID: 946216257

View in Genome Browser
Species Human (GRCh38)
Location 2:218186080-218186102
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946216251_946216257 30 Left 946216251 2:218186027-218186049 CCATTTGCTTGTTTATTATAGAG No data
Right 946216257 2:218186080-218186102 CATATAAGCTTCACGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type