ID: 946219349

View in Genome Browser
Species Human (GRCh38)
Location 2:218213216-218213238
Sequence CCCCCATCTGTGGAAGCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946219349_946219352 -4 Left 946219349 2:218213216-218213238 CCTAAGGCTTCCACAGATGGGGG No data
Right 946219352 2:218213235-218213257 GGGGAGATGTAACAGACAAAAGG No data
946219349_946219353 14 Left 946219349 2:218213216-218213238 CCTAAGGCTTCCACAGATGGGGG No data
Right 946219353 2:218213253-218213275 AAAGGATCAGAAACATGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946219349 Original CRISPR CCCCCATCTGTGGAAGCCTT AGG (reversed) Intergenic
No off target data available for this crispr