ID: 946220206

View in Genome Browser
Species Human (GRCh38)
Location 2:218219119-218219141
Sequence AAGCTGATCTACAAGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946220201_946220206 11 Left 946220201 2:218219085-218219107 CCAGACTAGCAAAGAATGAGACC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 946220206 2:218219119-218219141 AAGCTGATCTACAAGATAAATGG 0: 1
1: 0
2: 0
3: 14
4: 189
946220205_946220206 -10 Left 946220205 2:218219106-218219128 CCTGGGCGGTTATAAGCTGATCT 0: 1
1: 0
2: 0
3: 7
4: 30
Right 946220206 2:218219119-218219141 AAGCTGATCTACAAGATAAATGG 0: 1
1: 0
2: 0
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946220206 Original CRISPR AAGCTGATCTACAAGATAAA TGG Intronic
900708647 1:4096601-4096623 AAGCTGATGTCAAAGATTAAAGG + Intergenic
901929714 1:12589245-12589267 AAGCTGCTCTACTCGAGAAAGGG - Intronic
905520117 1:38591303-38591325 AAACTTATCTACAAAATTAAAGG + Intergenic
908380875 1:63595409-63595431 AAACAGATCTTCAAGATCAAGGG - Intronic
908817211 1:68046882-68046904 GAGCTGATCTGCAAGATCAAAGG - Exonic
911425893 1:97712018-97712040 AATCAGAACTTCAAGATAAAGGG - Intronic
913345682 1:117808047-117808069 AAGCTCTTCTACAAAATATAAGG + Intergenic
916809280 1:168291392-168291414 AAGCTGACCAACAAGCTCAATGG + Exonic
920054218 1:203180963-203180985 AAGGTGATCTGCAGGGTAAATGG - Intronic
921479419 1:215646826-215646848 AATCTGATATAAAAGATAAGAGG - Intronic
921704250 1:218302570-218302592 AATCTAATCTACAAGAGAACTGG - Intronic
924037285 1:239950184-239950206 AAGCTGATGGAAAAGATACATGG + Intergenic
1063034637 10:2274326-2274348 AAGCTGATTTAAAAGGTATATGG + Intergenic
1063593463 10:7412386-7412408 GAGCTGATCTAGAAGAAATACGG + Intergenic
1065185657 10:23168703-23168725 AAGATGAGCTCCAAGAGAAAAGG - Intergenic
1065728261 10:28687445-28687467 AATCTAATCTGCAAGATACAGGG - Intergenic
1070387009 10:75934821-75934843 AAACTGTTCTAAAAGAAAAAGGG - Intronic
1071175296 10:82919028-82919050 CAGCTTACCTACCAGATAAAAGG - Intronic
1071967406 10:90866318-90866340 AAGCTGATGTTCCAGATCAAAGG - Intergenic
1072338819 10:94426013-94426035 AAGCAGGATTACAAGATAAAAGG - Intronic
1072606270 10:96985448-96985470 AAGCTGATCTATGTGATTAAAGG + Exonic
1074795951 10:116943992-116944014 AAGCTGATCTCTAACATAAGAGG + Intronic
1080319547 11:30990565-30990587 AAGGTGATCTACAAGAGTGAAGG + Intronic
1080341153 11:31266835-31266857 AAGCTGTTCTACAGGCTGAAAGG - Intronic
1080625302 11:34024060-34024082 AAGCTGATTTACCACATTAATGG - Intergenic
1082950058 11:58805137-58805159 AAGCATATATACAAGATATATGG - Intergenic
1083286415 11:61662011-61662033 AAGCTGATTAATAAGAGAAAAGG - Intergenic
1088588795 11:111383190-111383212 CTGCTGATCAACAAGAAAAAGGG - Intronic
1089818502 11:121199216-121199238 AAACTGATCTCAAAGAAAAATGG + Intergenic
1090316779 11:125797894-125797916 AAGGTAATCTCCAAGACAAAGGG - Intergenic
1091144098 11:133262272-133262294 AATCTGTTCTCCAGGATAAATGG + Intronic
1092523678 12:9296549-9296571 AAGCTGACCTACAGGATCCACGG - Intergenic
1092543619 12:9435350-9435372 AAGCTGACCTACAGGATCCACGG + Intergenic
1092797156 12:12123548-12123570 AAGATTATCTAGAAGATAACAGG + Intronic
1093000285 12:13988542-13988564 ATGCTACTCTAGAAGATAAAAGG - Intergenic
1093138647 12:15480708-15480730 AAGCTGATGTAGAAGATGGATGG + Intronic
1094264972 12:28547328-28547350 AACCTAATCTAAAAGATACATGG - Intronic
1094509324 12:31086701-31086723 AAGCTGACCTACAGGATCCATGG - Intronic
1098403633 12:70100756-70100778 AAACTGATCAACCAGAAAAATGG + Intergenic
1098840389 12:75470709-75470731 AACCTGAACTACAAGAGACAGGG + Intergenic
1098903618 12:76138894-76138916 AAACTGAACTATAAAATAAATGG + Intergenic
1099128234 12:78793736-78793758 AATCAGATTTAGAAGATAAAAGG - Intergenic
1101889824 12:108703216-108703238 AAGCTAATGTAGAAGAAAAAAGG + Intronic
1102398824 12:112611193-112611215 AAACTGATTAACAAGCTAAAAGG - Intronic
1105644621 13:22303567-22303589 AAGCTAATCACCAAGACAAAGGG - Intergenic
1107330140 13:39290861-39290883 AATCTCATCTACAGGAAAAATGG - Intergenic
1111180963 13:84664233-84664255 AAATTGATCTTCAAGGTAAATGG - Intergenic
1113191651 13:107755215-107755237 AATTTCATTTACAAGATAAAAGG - Intronic
1115373155 14:32642062-32642084 AAGCTATTCCACAAGATAAAAGG + Intronic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1116065378 14:39975138-39975160 AAGCTGATATAGTTGATAAAAGG + Intergenic
1116232197 14:42231413-42231435 AAGCTGATGTATAAAATCAAAGG - Intergenic
1117177129 14:53156228-53156250 AAGATGATCTAGAAAACAAAAGG - Intergenic
1117702864 14:58432487-58432509 AAGCTGATTTACATAAGAAATGG - Intronic
1117795603 14:59390006-59390028 AATATGATATACAAGATAACTGG + Intergenic
1119981649 14:79088269-79088291 AAGCTGATCTTCAAGGAGAAGGG - Intronic
1120226747 14:81799239-81799261 ACTGTGATCTTCAAGATAAATGG - Intergenic
1124930024 15:34110444-34110466 AAGCTGTTTTTCAAAATAAAGGG + Intergenic
1137528269 16:49256710-49256732 ATGCAGATTTACATGATAAAAGG + Intergenic
1138485259 16:57337816-57337838 AACCTAACCAACAAGATAAAAGG - Intergenic
1143361904 17:6377899-6377921 AGGCAGTTCTTCAAGATAAAGGG - Intergenic
1147013444 17:37470994-37471016 AAGGTGACCTACCTGATAAATGG + Intronic
1148803927 17:50254274-50254296 AAGCTGATTTAAAAAAAAAAAGG + Intergenic
1148961975 17:51401041-51401063 AAGGAGATAAACAAGATAAATGG - Intergenic
1151267403 17:72967421-72967443 GAGCTGGTCTTCTAGATAAAAGG - Intronic
1151547817 17:74804082-74804104 AGACTGATCTACAGGATAAAAGG - Intronic
1153015322 18:577802-577824 AAGCTGAACTAAAAGCAAAACGG - Intergenic
1155498927 18:26467985-26468007 AAGATGATGTTAAAGATAAAAGG + Intronic
1156846928 18:41676848-41676870 AAGGTGATCTTCATGATAGAGGG + Intergenic
1157938572 18:51900242-51900264 AAGCTAATATTGAAGATAAAAGG - Intergenic
1157981348 18:52385148-52385170 AAGCAAATGTAGAAGATAAACGG + Intronic
1158726622 18:59979089-59979111 AAGAGGAACTAAAAGATAAATGG - Intergenic
1163865185 19:19767633-19767655 AAGCTGAGCTGAAAGAAAAACGG + Intergenic
1167007741 19:46786824-46786846 GGGCTGATCTAAAAGATAAAGGG + Intronic
928901933 2:36328628-36328650 AAGTTGATCTACAGATTAAATGG + Intergenic
929373560 2:41256434-41256456 AAGCAGATCTACCAGATTTATGG + Intergenic
930790750 2:55325649-55325671 AACTTCATCTACCAGATAAAGGG - Intronic
931267919 2:60676917-60676939 ACGCTCATGTACAAGATGAAAGG - Intergenic
933498534 2:83082639-83082661 CAGTGGAGCTACAAGATAAAAGG + Intergenic
934931292 2:98426976-98426998 AAGCTGATCTAAAATTTATATGG - Intergenic
937144903 2:119636409-119636431 AAGATGATGTACAAGAAATAGGG + Intronic
937423440 2:121777584-121777606 AAGGTGATCTCCAAGATAAGAGG - Intergenic
938798712 2:134740249-134740271 AAGCTGATCCACCAAATTAAAGG - Intergenic
940662736 2:156567704-156567726 AAGCTGGTCTACATGAAGAAGGG + Intronic
945372176 2:209032706-209032728 AGGAAGATCTAGAAGATAAAAGG - Intergenic
946220206 2:218219119-218219141 AAGCTGATCTACAAGATAAATGG + Intronic
946510966 2:220355873-220355895 AAGCAGAGCTACAGGATTAATGG + Intergenic
946658410 2:221974212-221974234 AATCTGATCCACATGAGAAATGG + Intergenic
946892641 2:224294150-224294172 AAGCTGATTTACATAATAAAAGG - Intergenic
948345225 2:237290708-237290730 AAGCTGTTGTACATGATAACAGG - Intergenic
1169602962 20:7283162-7283184 AAGCAGATTTAGAAAATAAATGG - Intergenic
1169683664 20:8246034-8246056 ATGCTCATGTACAAAATAAAAGG - Intronic
1170304678 20:14925170-14925192 AATCTCATCTCAAAGATAAATGG + Intronic
1175018966 20:55824223-55824245 AAGATGTACTACAAAATAAATGG + Intergenic
1176888766 21:14288683-14288705 AGGGTTATCTACAATATAAATGG + Intergenic
1177286348 21:19056447-19056469 TAGCTTATCTAAAAGATAAGTGG + Intergenic
1178229874 21:30769844-30769866 AAGCTATTGTACAACATAAAAGG + Intergenic
1178293422 21:31388310-31388332 AAGTTGATCTCCAAGATGCAGGG + Intronic
1182205268 22:28617960-28617982 CAGCTGACCTACAAAATAAATGG + Intronic
951988832 3:28652478-28652500 AAGCTAAGTTACAGGATAAAAGG - Intergenic
952148425 3:30559281-30559303 AAGCTAACCTCCAACATAAAAGG - Intergenic
952391022 3:32880333-32880355 AAACTGATCTTAAAAATAAATGG - Intronic
953897059 3:46811021-46811043 GGGTTGATCTACAAGCTAAAGGG - Intronic
957110640 3:75951966-75951988 AAGCTGAAGTGCAAGATATATGG + Intronic
962710603 3:138082454-138082476 AAGCTGATCTTCAGGGTAAAAGG + Intronic
963340857 3:144031345-144031367 AAGCTGTTCTACAACACAATTGG - Intronic
963382637 3:144551338-144551360 AGGCTGATCTAGCAGAGAAAGGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
963971479 3:151434745-151434767 ATGCTGAGCTACAAAATATATGG - Exonic
967287439 3:187886975-187886997 AATCTCTTCTAGAAGATAAAAGG - Intergenic
970302389 4:14694943-14694965 AAGTTGATCTTCAGGTTAAAAGG + Intergenic
978074894 4:104516210-104516232 AAGATGCTCTAAAAGACAAATGG - Intergenic
978410927 4:108424529-108424551 AATCTGAACAACAAAATAAACGG + Intergenic
978540820 4:109814867-109814889 AAGCTGATGTCAAATATAAAGGG + Intergenic
978748998 4:112225952-112225974 AAGATGTTCTTAAAGATAAAAGG - Intergenic
978855799 4:113393384-113393406 AAGCTAAATTAAAAGATAAATGG + Intergenic
978876316 4:113644282-113644304 AAGCTGACCTATATCATAAATGG + Intronic
979487014 4:121281629-121281651 TGGCTGATTTACAAGGTAAAGGG + Intergenic
980450376 4:132961153-132961175 AATCTGCTCTATATGATAAATGG - Intergenic
982854198 4:160361223-160361245 TAGGTTATTTACAAGATAAATGG + Intergenic
982878481 4:160677747-160677769 AAGCTGAACTAGACTATAAAAGG + Intergenic
983357178 4:166678160-166678182 AAATTGATCTAAAATATAAATGG + Intergenic
983684954 4:170397343-170397365 AAGCTAATATATAAGAGAAAAGG + Intergenic
983901207 4:173136430-173136452 GAGCTGACTTCCAAGATAAAAGG - Intergenic
984649648 4:182256624-182256646 AGGCTACTTTACAAGATAAAAGG - Intronic
984696882 4:182787791-182787813 GAGCTGATTTACAAAATATAAGG - Intronic
985065962 4:186122187-186122209 AGGCTGTTCTAAAAGATAACTGG + Intronic
986983389 5:13474665-13474687 ACGCTAATCTCCAAGACAAAGGG + Intergenic
987181628 5:15373912-15373934 AAGTTGATCCCCAAGATAATGGG + Intergenic
988330396 5:29831008-29831030 AAGCTGTTCTACAAAATGGAGGG + Intergenic
988462570 5:31453656-31453678 AAGCTGTTTTACATGAGAAAAGG - Intronic
988666277 5:33331549-33331571 AAACTGAAATACAATATAAATGG + Intergenic
990098300 5:52148353-52148375 AAACTAATCCACAAGATATATGG + Intergenic
990401281 5:55439908-55439930 GAGCTGACCTTCAAAATAAATGG + Intronic
991560017 5:67940839-67940861 AAGTTTATCTACATAATAAAGGG + Intergenic
991608438 5:68426438-68426460 TAGCTGAGCTACAAGATCTAAGG + Intergenic
993075685 5:83227150-83227172 TAACTGATTTACAATATAAAAGG - Intronic
993141616 5:84041209-84041231 AAGGTGATGTTCAAGAAAAAAGG - Intronic
999858911 5:155624232-155624254 AAGTGGTTCTACAAGAGAAAAGG + Intergenic
999961506 5:156760906-156760928 AAGCTGATAGACAAGCCAAATGG + Intronic
1000035236 5:157442654-157442676 AAGTTGATTTAGAAAATAAATGG + Intronic
1002701815 5:181130077-181130099 GTGCTGATGAACAAGATAAATGG + Intergenic
1003789741 6:9532195-9532217 AAGCTTATCTAGAATATATAAGG + Intergenic
1004769590 6:18767122-18767144 AAGGTGATCTACAAAATTGAAGG + Intergenic
1004800809 6:19145118-19145140 AAGCTGTTCTGTTAGATAAAAGG - Intergenic
1005242128 6:23843142-23843164 AATGTGATCTACATAATAAAAGG + Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1008387878 6:50915078-50915100 AAGCTGATATACATGTTAATTGG - Intergenic
1009893932 6:69723296-69723318 AACCTGCACTACAAAATAAATGG + Intronic
1010247709 6:73677343-73677365 AAGTTAATCTACAAGTTAAATGG + Intergenic
1010666221 6:78632980-78633002 AACCTATTCTACAAGAAAAATGG + Intergenic
1011598337 6:89037543-89037565 GAGCTGGTATACAAGATGAAAGG - Intergenic
1012705292 6:102519712-102519734 TACCAGAGCTACAAGATAAAAGG + Intergenic
1013629277 6:111969858-111969880 AAACTGACCTAACAGATAAATGG - Intergenic
1014038400 6:116794975-116794997 CAGCTTTTCTACAAGATGAATGG + Intronic
1014808822 6:125862494-125862516 AAGGTAATCTACAACACAAAAGG - Intronic
1014886292 6:126785359-126785381 AAGCTTATCTATAAGAAGAAGGG - Intergenic
1015633423 6:135253318-135253340 AAGCTGCTCTGCAAAACAAAGGG - Intergenic
1021433684 7:20589860-20589882 AATCAGATTTAGAAGATAAAAGG + Intergenic
1024107452 7:46107716-46107738 AAGCTGAGCTGCAGGACAAAGGG + Intergenic
1025026345 7:55519420-55519442 AAGCTGATCTATAAAACAATTGG + Intronic
1026594355 7:71721937-71721959 AAACTTCTCAACAAGATAAAAGG - Intergenic
1028100414 7:86813195-86813217 AAGCTAATTAACTAGATAAAAGG + Intronic
1028866027 7:95713914-95713936 AAGCTGATCTAAAATTTATATGG + Intergenic
1029252263 7:99245221-99245243 AAACTGATCCACAGGAAAAAAGG - Intergenic
1031449806 7:121900904-121900926 ATGTTGAACTACATGATAAATGG - Intronic
1032892375 7:136211736-136211758 AAGTTAATCTAGAAGATAAATGG - Intergenic
1034856761 7:154557157-154557179 AAGCTTATCCACCAGATAAGTGG + Intronic
1036707120 8:11054460-11054482 AAGTTGATCTACAACGTAAATGG - Intronic
1038256133 8:25953045-25953067 AAGCTCATCTCCAAAAGAAAGGG + Intronic
1039181580 8:34872893-34872915 ACGCTATTCTACTAGATAAAAGG - Intergenic
1039481564 8:37877387-37877409 AAGCTGAAGGACAAGATCAAGGG - Exonic
1040819481 8:51539834-51539856 AAGCTGAACTACCATAAAAAAGG - Intronic
1040859866 8:51988204-51988226 AAGGTGAACTACAAGACACAGGG - Intergenic
1041160096 8:55032288-55032310 AAGCTCCTCAACAAAATAAAGGG + Intergenic
1042475462 8:69244341-69244363 CAGCTGATCTAAAGAATAAATGG + Intergenic
1043593477 8:81856906-81856928 AAGCTCCTCTAGAAGATAAGCGG - Intergenic
1044434549 8:92146702-92146724 AAGGTGATCTAAAAAAAAAAAGG - Intergenic
1044742407 8:95341716-95341738 AAGCAGAACCACAAAATAAAAGG - Intergenic
1046394436 8:113623791-113623813 AAGCTGAACTAGAAGCTGAATGG - Intergenic
1048124184 8:131614614-131614636 AACCTGAGCTACAGGTTAAAGGG + Intergenic
1051034591 9:12728364-12728386 AAACAGATATACAAGATAAAAGG + Intergenic
1051831347 9:21281501-21281523 CAGCTGACCTACAACATAAAAGG - Intergenic
1051833520 9:21308639-21308661 CTGCTGACCTACAACATAAAAGG - Intergenic
1052596372 9:30564145-30564167 AAGCTGATCTCCTAGTTTAATGG + Intergenic
1052774750 9:32722197-32722219 GAGCTGTTCTGCAAAATAAAGGG + Intergenic
1053120623 9:35544878-35544900 AGTCTGAGCTACAAGATTAAGGG - Intronic
1054846342 9:69802422-69802444 AATCTGATATACCAGATATAAGG + Intergenic
1054894412 9:70292034-70292056 AAGCTGTTATTCAAGAAAAATGG - Intronic
1059193286 9:112347190-112347212 AAGCCTATCAACAAGAGAAATGG + Intergenic
1060467776 9:123922669-123922691 AAGCTGAAATACAGGATATAAGG - Intronic
1186330783 X:8530828-8530850 AAGTTCATGTAAAAGATAAATGG + Exonic
1186551362 X:10509167-10509189 AATCTGATCTGGAAGAGAAAAGG + Intronic
1188207239 X:27375427-27375449 AAGTAGATCTAAAAGATGAAGGG + Intergenic
1188448959 X:30288889-30288911 AATCTTATCTAAAAGAGAAAGGG + Intergenic
1189746398 X:44173036-44173058 AAGCTGAATTATAAGAAAAATGG + Intronic
1190568265 X:51753511-51753533 AACCTGATGTACAAGAAAACAGG - Intergenic
1194680620 X:96847903-96847925 AATCATATCAACAAGATAAACGG - Intronic
1195464294 X:105163027-105163049 TAGCTGATCTAGAAGTTAAAGGG - Intronic
1196063180 X:111433291-111433313 CATCTTATCTACAAGATAGAAGG - Intergenic
1197799588 X:130335578-130335600 AAGCTGATAGGAAAGATAAATGG + Intergenic
1198003948 X:132472053-132472075 AAGCAAATCTACAAAATACATGG - Intronic
1200085994 X:153605417-153605439 CAATTGATCTACAAGTTAAATGG + Intergenic
1201675611 Y:16580490-16580512 AAGCTAATATAAGAGATAAAAGG - Intergenic