ID: 946221912

View in Genome Browser
Species Human (GRCh38)
Location 2:218235003-218235025
Sequence CAAATTCTGAGGCATTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946221910_946221912 -1 Left 946221910 2:218234981-218235003 CCTGTGATTCAGTGGCATGTCTC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 946221912 2:218235003-218235025 CAAATTCTGAGGCATTTAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 163
946221909_946221912 0 Left 946221909 2:218234980-218235002 CCCTGTGATTCAGTGGCATGTCT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 946221912 2:218235003-218235025 CAAATTCTGAGGCATTTAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 163
946221907_946221912 8 Left 946221907 2:218234972-218234994 CCTTTTTACCCTGTGATTCAGTG 0: 1
1: 0
2: 1
3: 24
4: 265
Right 946221912 2:218235003-218235025 CAAATTCTGAGGCATTTAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946221912 Original CRISPR CAAATTCTGAGGCATTTAGC AGG Intronic
902896225 1:19482008-19482030 CAAATACTGAGGCATGTTGTGGG - Intronic
907626475 1:56035300-56035322 GAAATTCTGAGGCATCCATCAGG - Intergenic
907956250 1:59230946-59230968 CAATATCTCAGGCATTTAACAGG - Intergenic
909417912 1:75428362-75428384 CAAATACAGAGGCAGTAAGCAGG - Intronic
910075678 1:83275618-83275640 CAAATTCTGAGGGAGTGAGGTGG - Intergenic
915785763 1:158609792-158609814 CAAATTATTAGTCATTTAGTGGG - Intergenic
917427742 1:174933235-174933257 CAAATACTGGGGGATTTATCAGG - Intronic
921501797 1:215913419-215913441 CAAAGTCTTAGTCATTTAACAGG - Intronic
1066664980 10:37773829-37773851 CACATTCTGAGGCATTGAGGGGG + Intergenic
1070498869 10:77051605-77051627 AAATTGCTGAGGTATTTAGCTGG + Intronic
1071315814 10:84396072-84396094 CAAATTCTGTGGCATTTGATTGG - Intronic
1072356010 10:94611663-94611685 CCAATTCTGAGGTATTTTCCCGG + Intronic
1073651434 10:105363667-105363689 CACAGGCTGAGGCAGTTAGCAGG - Intergenic
1073858159 10:107702001-107702023 CAAAAGCTGAGGTATTTATCAGG + Intergenic
1074348894 10:112715772-112715794 CAGCTTCTGAGGCCTTCAGCAGG + Intronic
1075042881 10:119122607-119122629 CAGCTTCTGAGATATTTAGCAGG + Intronic
1078022252 11:7665686-7665708 CTAGTTCTGAGGCTTTTTGCAGG - Intronic
1078426958 11:11259784-11259806 AAATTTCAGAGGCATTTAGGAGG - Intergenic
1079776630 11:24539781-24539803 TAAATGTTTAGGCATTTAGCTGG - Intronic
1084103646 11:66966451-66966473 CAAATTCTGAGGAATTTCTGAGG - Intergenic
1085904197 11:80739894-80739916 CAAATTCTGAAGCATGCAGTTGG + Intergenic
1086028247 11:82321113-82321135 CAGTTTCTGTGGCATTTTGCTGG - Intergenic
1086319981 11:85635515-85635537 CAAACTCTGTGGCATATAACAGG - Intronic
1087470632 11:98569622-98569644 CAAATTCTGTGTGATTTAGATGG - Intergenic
1088042966 11:105410868-105410890 CAAATTCTGACACACTAAGCTGG - Intergenic
1088546329 11:110963055-110963077 CATTTTCTGAAGCATTTAGTTGG - Intergenic
1088843047 11:113642912-113642934 CAATTTCTGAGGCAGTTACTGGG - Intergenic
1090271740 11:125390773-125390795 CAAATTCTGAGGCCATCAGAAGG + Intronic
1094289164 12:28826943-28826965 TCTTTTCTGAGGCATTTAGCTGG + Intergenic
1095364691 12:41388426-41388448 CAAATTTTGAAGCATTTTGTAGG + Intronic
1097357651 12:58620308-58620330 CAAGTTCTGAGGGGTTTATCAGG + Intronic
1104133784 12:125918753-125918775 CCAATGATGAGGCATTTGGCAGG - Intergenic
1105465642 13:20637227-20637249 AGAATTCTGTGGCATTTAGTAGG - Intronic
1106272945 13:28171947-28171969 GAAATTCCGAGGGATTTAGGAGG + Intronic
1107236781 13:38179941-38179963 CAAATTATCAGGCAGTTATCTGG + Intergenic
1109681633 13:65758750-65758772 CCAATTCTGAGGCCTCTAGGTGG - Intergenic
1111016503 13:82388313-82388335 CCAACTCTGAGGCACTTACCAGG - Intergenic
1111448717 13:88386201-88386223 CAAATTCTGTGAGCTTTAGCAGG + Intergenic
1113155786 13:107319979-107320001 CCAAAGTTGAGGCATTTAGCAGG + Intronic
1114402626 14:22423730-22423752 TAAATTCAGAGGCATGTGGCTGG - Intergenic
1114904020 14:27102078-27102100 CAAATTCTGTGGCCTTTTTCTGG - Intergenic
1114924178 14:27372901-27372923 TAAATTCCTTGGCATTTAGCTGG + Intergenic
1115450875 14:33545915-33545937 CACATTCTGTGGCTTTCAGCAGG - Intronic
1115907622 14:38218154-38218176 CAAAGTCTGAGGAATATGGCTGG + Intergenic
1116329695 14:43579870-43579892 CATATTATGAAGCATTTAGGAGG - Intergenic
1119718257 14:76873859-76873881 CAATTTCTGAGCCATGCAGCTGG - Intergenic
1120804748 14:88735214-88735236 CAAATTCTCAGGCCTTTTACAGG - Intronic
1124695968 15:31864510-31864532 CAAGATCTGATGCATTTATCAGG - Intronic
1125037297 15:35140341-35140363 CAGATTCTGAATCATATAGCTGG - Intergenic
1125204875 15:37142568-37142590 GTAATTCTGAAGCATTTAGTGGG - Intergenic
1125991676 15:44115872-44115894 CAAATTCTGAGGCAATCATCAGG + Intronic
1126325952 15:47477631-47477653 CAAATTCTGTGGCTGTTGGCTGG - Intronic
1128223729 15:65987057-65987079 CAAAGTCTGAAGCAGTCAGCAGG - Intronic
1130376517 15:83334134-83334156 GAACATCTGAGGCATGTAGCAGG + Intergenic
1130655558 15:85789855-85789877 CAAACTCTGAGGCAGTGGGCAGG + Intronic
1132690132 16:1178418-1178440 CACATTCTGAGGCACTTGGGGGG - Intronic
1133572308 16:7053540-7053562 TTAATTCTCAGGCATTTATCAGG - Intronic
1134292224 16:12911301-12911323 CAAATTCTTAGGCATTTGTGTGG + Intronic
1135303218 16:21348184-21348206 AAAATTCTGGGGCTTTTAGAGGG + Intergenic
1136299960 16:29327376-29327398 AAAATTCTGGGGCTTTTAGAGGG + Intergenic
1138872856 16:60912927-60912949 CACCTTCTGAGGATTTTAGCAGG + Intergenic
1139786141 16:69393888-69393910 CAAATTGTGTGGCTTTTATCTGG + Intronic
1141784735 16:86191551-86191573 CATATTCTGATTCAGTTAGCTGG + Intergenic
1142061696 16:88034143-88034165 AAAATTCTGGGGCTTTTAGAGGG + Intronic
1143220992 17:5261766-5261788 CAAATTCTGAGTCAGTGAGAGGG - Intergenic
1144049413 17:11485784-11485806 CAAATCCAGAGTCATTTAGAAGG - Intronic
1146370436 17:32262801-32262823 CATATTCTGTGGCATTTTGGGGG - Intergenic
1148066239 17:44872367-44872389 CAATTTCTGAGTCATTCAGCAGG + Intronic
1151386259 17:73757189-73757211 CACATTCTCAGGCCATTAGCTGG + Intergenic
1156809304 18:41227088-41227110 CATCTGCTGAGGCATTTGGCTGG + Intergenic
1159787993 18:72738169-72738191 CATATTCTGTGTCATTTATCAGG + Intergenic
1160095338 18:75866579-75866601 CAAATGCCTAGGCTTTTAGCAGG - Intergenic
1162432803 19:10639292-10639314 CAAACTCTAAGGCCTTTAGAGGG - Intronic
1165438592 19:35810980-35811002 CATATCCTGAAGCATTTAGGGGG + Intronic
1167954629 19:53054887-53054909 CTAATTTTAAAGCATTTAGCAGG + Intergenic
925985589 2:9212426-9212448 CAAATGCTAAGGCACTAAGCTGG + Intronic
927834274 2:26379545-26379567 CACATTAGGAGGCATGTAGCGGG + Intronic
931046188 2:58356214-58356236 CAAATTTCTAGGCATTTAGAAGG - Intergenic
932651301 2:73560846-73560868 CAAATGTTGAGGGATTTAGGAGG + Intronic
932942415 2:76183345-76183367 AAAATTATGAGGCATAAAGCAGG + Intergenic
932996630 2:76863030-76863052 CAAAATTGGAAGCATTTAGCTGG + Intronic
933614220 2:84467576-84467598 CATTTTATGAGGCATTTAGGAGG + Intergenic
938398944 2:130972225-130972247 CAAATTCTGAGGGCTTGGGCAGG + Intronic
940599880 2:155845395-155845417 CAAACTCTGCGGCATTCTGCTGG - Intergenic
941229893 2:162898677-162898699 TAGAATCTTAGGCATTTAGCAGG + Intergenic
941301236 2:163804619-163804641 CGAGTTCTGAGGCATTTATGAGG - Intergenic
941660473 2:168191269-168191291 CAAGCTCTGATGCAATTAGCTGG - Intronic
946221912 2:218235003-218235025 CAAATTCTGAGGCATTTAGCAGG + Intronic
1169322642 20:4646143-4646165 CAACTTCTGATGGATTTATCAGG - Intergenic
1169798247 20:9488615-9488637 CCAATTCTGCGGCATTAAGTAGG - Intergenic
1170669768 20:18421002-18421024 GAAATTCTGAGGCATATAGATGG + Intronic
1171225965 20:23442376-23442398 CCTATTCTGAGGCACTTTGCAGG - Intronic
1173421604 20:42906281-42906303 CAAATTCTGTGTCATTTTGACGG - Intronic
1174346986 20:49937342-49937364 CCAATTCTGAGGCAAGAAGCAGG - Intronic
1175045642 20:56102515-56102537 GATAATCTGAGCCATTTAGCTGG - Intergenic
1176910717 21:14561565-14561587 CAGATTCTGAAGCATTTGGATGG + Intronic
1177117415 21:17103287-17103309 CAAATTTTAACACATTTAGCAGG + Intergenic
1177205725 21:18008824-18008846 CTAATTCTGAGCCATTTATCTGG - Intronic
1177381860 21:20354573-20354595 CAAATTCTGTGCCAGGTAGCAGG + Intergenic
1177784772 21:25659819-25659841 CTAATTTTGATGCATTTAACTGG - Intronic
1182763062 22:32738473-32738495 CAAATTCAGAGTCATGCAGCAGG - Intronic
949383096 3:3467571-3467593 GAAATCATGAGGCATTTGGCAGG + Intergenic
952876924 3:37953648-37953670 CAAATTCAGAAGCATTAAACAGG + Intronic
957457419 3:80470135-80470157 CAGATTTTGAAGCAATTAGCAGG + Intergenic
965423608 3:168493902-168493924 GAAAGTCTGAGCCCTTTAGCTGG - Intergenic
969233635 4:5849890-5849912 CATATTCTGTGGCATGTAGGTGG - Intronic
969972148 4:11058868-11058890 CAGAGGCTGAGGCAATTAGCTGG + Intergenic
970620051 4:17809126-17809148 CAAAGTTTGAGGAATTAAGCAGG + Intronic
970845625 4:20534587-20534609 CAAACTCTGAAGCCTTTAGAAGG + Intronic
971356962 4:25903791-25903813 CTAATTCTGAGGCCTTCAGCTGG - Intronic
972412076 4:38805585-38805607 CAACTTCAGAGGCAGTCAGCTGG - Intronic
975281347 4:72567026-72567048 CAACTTCTGTAGCATTTAGGAGG - Intronic
975542261 4:75526122-75526144 GAAACTCTCAGGCAGTTAGCTGG + Intronic
985526175 5:403164-403186 CAAATTCGGAGGCAGAAAGCGGG + Intronic
986113790 5:4749735-4749757 CAAGATCTGATGGATTTAGCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
990399510 5:55423921-55423943 TAAATTCTGAGTCATTAAACAGG - Intronic
990414877 5:55576503-55576525 CAAGTTCTGGGGCATTTATTTGG + Intergenic
992884766 5:81147354-81147376 AACAGTCTGAGGAATTTAGCTGG + Intronic
997450342 5:133977498-133977520 CAAATTCTGAGAGCTTAAGCAGG - Intronic
998977237 5:147661772-147661794 CAAATTCTGAGTCATAGATCTGG - Intronic
999668327 5:153935975-153935997 TAAATCCTGAGGCCTGTAGCTGG - Intergenic
1000374048 5:160562965-160562987 CAAATTGTCAGGCATCTAGCAGG + Intergenic
1001738521 5:174028432-174028454 GAAAGTCTAAGGCATTTACCAGG - Intergenic
1002009502 5:176265941-176265963 CATATCATGAGGCATTTTGCAGG - Intronic
1002217224 5:177646354-177646376 CATATCATGAGGCATTTTGCAGG + Intergenic
1008218040 6:48819725-48819747 CAAATTCTTATTCATTGAGCAGG - Intergenic
1008659122 6:53647274-53647296 GAAACTCTGAGGCATCTGGCTGG + Intergenic
1009315354 6:62212471-62212493 CATATTCTGAGGTACTTAGAGGG - Intronic
1010016228 6:71107563-71107585 TAAATTCTAAGGAATTTGGCAGG - Intergenic
1010518718 6:76806593-76806615 CAAAATCTGAGATGTTTAGCAGG - Intergenic
1011222447 6:85069800-85069822 CAAATTTTGATGCACTAAGCAGG + Intergenic
1013648673 6:112171267-112171289 CAACTTGTGAGCCATTTCGCGGG - Intronic
1014170710 6:118276214-118276236 CAAATTCTGAGGCAATAGTCAGG - Intronic
1014627227 6:123741864-123741886 CAAGTTCTGAGGCCTTTTGCCGG - Intergenic
1016069344 6:139720765-139720787 GAAAATCTGAGGCATTTTCCAGG + Intergenic
1021633299 7:22667041-22667063 CAAATTTTCAGGCTTTTAGTGGG - Intergenic
1024255182 7:47535555-47535577 GCAATGCTGAAGCATTTAGCAGG + Intronic
1024769998 7:52711489-52711511 TAAATTTTGTGGTATTTAGCCGG + Intergenic
1025211595 7:57022219-57022241 TAAATACTGAAGCATTTGGCTGG - Intergenic
1025660361 7:63554608-63554630 TAAATACTGAAGCATTTGGCTGG + Intergenic
1027293390 7:76740492-76740514 CAAATTCTGAGGGAGTGAGGTGG - Intergenic
1031219423 7:118945841-118945863 CGAACTCTGAGACATTTTGCTGG - Intergenic
1031640988 7:124162982-124163004 CATATCCTGAGTCATTTATCTGG - Intergenic
1032380799 7:131478701-131478723 CAAATGCTAGGGCATCTAGCTGG - Intronic
1033074590 7:138236592-138236614 CTATTTCTGATGAATTTAGCTGG + Intergenic
1037380849 8:18283850-18283872 CACATTCTGAGACATTTCCCAGG + Intergenic
1038547867 8:28439788-28439810 CAAATTCTGATGCACTTCTCAGG - Intronic
1042381966 8:68126651-68126673 CATAATCTTGGGCATTTAGCAGG + Intronic
1042452358 8:68962760-68962782 CAAAGTCTGAGGCCTTGAGGTGG + Intergenic
1043548123 8:81337981-81338003 CAAATACTATGGCCTTTAGCAGG + Intergenic
1044643926 8:94417748-94417770 TAAATTTTCAGGCATTTGGCAGG - Intronic
1044702127 8:94974550-94974572 CAAATCCTGAGGGCTTGAGCTGG - Intronic
1045585136 8:103526153-103526175 CAAAGCCTGGGGGATTTAGCAGG - Intronic
1050810833 9:9745431-9745453 CATAGTCTGAGTCATTTTGCTGG - Intronic
1051619652 9:19037506-19037528 CAAGTTCTGATGGATTTATCAGG + Intronic
1052389983 9:27868511-27868533 CATATTCAGAGACATTTACCTGG + Intergenic
1052581273 9:30358004-30358026 TACATTCTGAGGAATTTAACAGG - Intergenic
1055450080 9:76423062-76423084 CAATTTATGATGGATTTAGCAGG + Intronic
1055459295 9:76502806-76502828 GAAATTCTGAGGCATATAGATGG - Exonic
1062161300 9:135081636-135081658 CACATGCTGAGACATTTAACGGG - Intronic
1186004025 X:5047828-5047850 CAAAATCTGTGGCATTAAGCTGG + Intergenic
1187078709 X:15963467-15963489 GAAATTATGAGGCAATTGGCTGG - Intergenic
1187250598 X:17594588-17594610 CAAATTCTAAGGCAATTCGGAGG + Intronic
1192693352 X:73388095-73388117 CATATTCTGAGGAATCTAGAAGG + Intergenic
1192812223 X:74557503-74557525 TAAGTTCTGAGGCTTTTAGCTGG - Intergenic
1193187980 X:78536151-78536173 CAGATCCTGAAGAATTTAGCAGG - Intergenic
1194894366 X:99421454-99421476 AAAATTCTGAGCTATTTAGCTGG + Intergenic
1195234014 X:102879128-102879150 CATATTCTGAGGCATAAAGTGGG + Intergenic
1195300927 X:103529202-103529224 CATATTCTGAGGCATAAAGTAGG - Intergenic
1195928450 X:110049670-110049692 AAAGTTCAGAGGCATTTAGGAGG + Intronic
1196392981 X:115228649-115228671 TAAATTCTGAAGCATTTATTTGG - Intronic
1196427134 X:115582214-115582236 CAATTTCTGAGGTAATAAGCTGG + Intronic
1197536620 X:127696634-127696656 CAAATTATGAAGCCTTTAACTGG - Intergenic
1197804164 X:130383449-130383471 CAAATTCTGAGGCACTGGGAGGG - Intergenic
1199490758 X:148397892-148397914 CAAAATCTCAGGCAGTTATCTGG + Intergenic