ID: 946223260

View in Genome Browser
Species Human (GRCh38)
Location 2:218247223-218247245
Sequence TGGAGTAAGTGGATCACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946223260_946223265 0 Left 946223260 2:218247223-218247245 CCAGCCGTGATCCACTTACTCCA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 946223265 2:218247246-218247268 CTTTTTCGCGGAATAAATTCAGG 0: 1
1: 0
2: 1
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946223260 Original CRISPR TGGAGTAAGTGGATCACGGC TGG (reversed) Intronic
906480188 1:46194529-46194551 TGGAGTTAGTGGAGCATGGATGG - Intronic
909282533 1:73773097-73773119 TGGAGGAAGGGGAACACTGCTGG + Intergenic
915316247 1:155030627-155030649 TTGAGCAACTGAATCACGGCTGG + Exonic
915858976 1:159422188-159422210 TGGAGTTGGTGGATCTGGGCTGG + Intergenic
918150583 1:181795090-181795112 GAGAGTAAGTGCATCAGGGCAGG - Intronic
919012525 1:191983475-191983497 TGGAGGTAGTGGGTCACTGCTGG + Intergenic
1063689402 10:8272126-8272148 GGTAGTAAGTGGTTCACAGCAGG - Intergenic
1075281253 10:121140575-121140597 TGGAGCCAGTGGAACATGGCCGG - Intergenic
1075581326 10:123620666-123620688 TGGAGGAAGTGGATGGCGGCTGG - Intergenic
1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG + Intronic
1076036814 10:127205529-127205551 TGGCGTAAGTGGATGGAGGCAGG + Intronic
1078023272 11:7672699-7672721 GGCAGTAAGTGGATGATGGCTGG - Intronic
1078128697 11:8594048-8594070 TGGAGTCACTGGCTCAGGGCGGG - Intronic
1079984642 11:27187691-27187713 TGGAGGAAGTGCATCAGGACTGG - Intergenic
1083414111 11:62514218-62514240 TGGGGTAAGTGGGTGACGGTGGG - Intronic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1096251197 12:50033509-50033531 TGGAGTGAGAGGATCTTGGCTGG + Intergenic
1101145906 12:101840202-101840224 TGGAGTGAGTGAGTCAAGGCAGG + Intergenic
1102528986 12:113532398-113532420 TGGAGTATGTGGATGGCGGCGGG - Intergenic
1108791258 13:53971997-53972019 TGATGTAAGTGGAGCACTGCAGG + Intergenic
1110206867 13:72924937-72924959 TGGAGGAAGTGGAACTCGACGGG + Intronic
1120951919 14:90049566-90049588 TGGAGTAATTGGATCAGGAAAGG - Intergenic
1121665534 14:95669308-95669330 TGGAGTTAGTGGATAACCACAGG + Intergenic
1129932258 15:79421681-79421703 TGGAGTAAGTGAATGAGGGAGGG + Intronic
1129938963 15:79477426-79477448 TGGAGGAAGAGGGTCACAGCAGG - Intergenic
1136004395 16:27318760-27318782 TGGAGGAAGTGGGTCCCGGGAGG + Intronic
1137937557 16:52649165-52649187 TGAAGTAAGTGGGTCACTGGAGG + Intergenic
1143625617 17:8108924-8108946 TGGAGTCAGAGTATCAGGGCTGG - Intronic
1144414221 17:15031237-15031259 TGGAGAAAGTGGATAACAGTTGG - Intergenic
1146152569 17:30488068-30488090 TAGAATAATTGGATCAGGGCTGG - Intronic
1150894422 17:69194675-69194697 TGGAGAAATTGGATCAAGACTGG + Intronic
1151361853 17:73593682-73593704 TGCAGTAATCGGATCACGGAAGG + Intronic
1155721187 18:29013825-29013847 TGGAGTCAGAGGATCAAGGATGG - Intergenic
1157533463 18:48441524-48441546 TGGAGGAAGCCGACCACGGCCGG - Intergenic
1161339000 19:3730455-3730477 TGGAGGAGGTGGACCAGGGCCGG + Exonic
1161918307 19:7247233-7247255 TGGAGGAAGTGGATTAAGGATGG - Intronic
1164052594 19:21595912-21595934 TGGGGTAAGTGGATCACTCGAGG - Intergenic
926471123 2:13259580-13259602 TGGAGGAAGTGTATTAGGGCAGG - Intergenic
927574646 2:24190942-24190964 TGGAGTAAGTGGAAAATGGTAGG - Exonic
928024914 2:27731387-27731409 TTCAGTAAGTGGATCATAGCAGG - Intergenic
928425732 2:31176248-31176270 GGGAGTCAGTGGATCTCAGCTGG - Intronic
933768478 2:85728007-85728029 TGGAGTAGGTGGATCTGGGTTGG - Intergenic
935537757 2:104314281-104314303 TGGAGTCAGTGGATCACCCGAGG - Intergenic
941147161 2:161862798-161862820 TGGACTCAGTGGTTCACGGCTGG + Intronic
943632635 2:190271521-190271543 TGGAGGCAGTGGATCACCTCAGG - Intronic
946223260 2:218247223-218247245 TGGAGTAAGTGGATCACGGCTGG - Intronic
946800252 2:223407446-223407468 TGCAGTAATTGGAACACGGGAGG + Intergenic
1173563040 20:44019956-44019978 TGGAGGGTGTGGATCACAGCCGG + Intronic
1182310093 22:29398220-29398242 TGGGGTCAGTGGATCACTGTTGG - Intronic
1182768230 22:32774275-32774297 TGAAGTCAGTGGATTAGGGCGGG + Intronic
951002779 3:17583427-17583449 TAGAGAAAGTGGAACCCGGCTGG + Intronic
951056914 3:18157968-18157990 TTGAGTAAGTTGACCACTGCAGG + Intronic
951803715 3:26623870-26623892 TGAAGTAAGTGGCTCAGGGAGGG + Intronic
962618370 3:137151024-137151046 TGGAGTCATTGGAGCAGGGCTGG + Intergenic
964346790 3:155761906-155761928 GGGTGTAAGTGGATTACTGCTGG + Intergenic
964503523 3:157374073-157374095 TGGAGTAAATGAATAACAGCTGG + Intronic
964658107 3:159090533-159090555 TGGAGTCAGTGGACCATGGGAGG + Intronic
969939063 4:10712294-10712316 TGGAGTATATGGATCAGGGGTGG + Intergenic
970323356 4:14897515-14897537 TGGAGTAAGTGTTTCACTGGAGG + Intergenic
976608244 4:87002639-87002661 TGAAGTAAGTGGATCACTTGAGG - Intronic
982227982 4:153183131-153183153 TGGAGGAAGTGGACTATGGCAGG - Intronic
982722167 4:158870161-158870183 TCAAGTAAGTGGATCACAGGTGG - Intronic
984209210 4:176825130-176825152 TGGTGTAAGAGGGTCAGGGCAGG - Intergenic
995998377 5:118327874-118327896 TGGAGTGAGTGGAGTAGGGCGGG + Intergenic
997878244 5:137568157-137568179 TGGAGTTTGTGGAAGACGGCAGG - Intronic
998762703 5:145449889-145449911 TCCAGCAAGTGGAGCACGGCAGG - Intergenic
1004082904 6:12413149-12413171 TGGACTAAGGGGATCATGGGTGG + Intergenic
1011145909 6:84216465-84216487 TGGAATCAGTGGCTCACTGCAGG + Intronic
1013309745 6:108882032-108882054 TGAAGGAAGTGGATCACAGAAGG + Intronic
1017453267 6:154574536-154574558 TGAGGTAAGTGGATCACTGGAGG + Intergenic
1018728521 6:166631677-166631699 TGGTGTCAGCGGAGCACGGCTGG + Intronic
1019079965 6:169423731-169423753 TGGAGAAAGCGGCTCACGGGAGG + Intergenic
1022864847 7:34406739-34406761 TGAAGTCAGTGGAGCAGGGCGGG - Intergenic
1031119321 7:117703351-117703373 TGGAGTAAGTGGATAATAGGAGG - Intronic
1032456138 7:132074928-132074950 TGGAGGGAGTGGAACATGGCGGG - Intergenic
1038686875 8:29727079-29727101 TGGAAGAAATGGATCATGGCCGG - Intergenic
1040903654 8:52442357-52442379 TGGAACAAGTGGATCAGGCCAGG - Intronic
1044923863 8:97193071-97193093 TGGAGCAAGTGCAGCATGGCTGG - Intergenic
1045734511 8:105279400-105279422 TGGGGTAAGTGGATCACTTGAGG - Intronic
1046893322 8:119446965-119446987 TGAAGTGGGTGGATCACGGGTGG - Intergenic
1052086415 9:24271869-24271891 GGGAGTATGTGGATTATGGCTGG + Intergenic
1055156275 9:73066714-73066736 TGAAGGAACTGGATCACTGCTGG + Intronic
1057210246 9:93197277-93197299 TGGAGTGCCTGGAGCACGGCAGG - Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1198128332 X:133669503-133669525 TGGAGCACGTGGTTCACGACAGG + Intronic
1200234964 X:154463780-154463802 TGGAGAAAGTGGAGGAGGGCGGG - Intronic