ID: 946226607

View in Genome Browser
Species Human (GRCh38)
Location 2:218267217-218267239
Sequence TAGAGTGGACAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 1, 2: 0, 3: 50, 4: 630}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946226607_946226621 30 Left 946226607 2:218267217-218267239 CCTTCCCCCTTCTGTCCACTCTA 0: 1
1: 1
2: 0
3: 50
4: 630
Right 946226621 2:218267270-218267292 TGGCCTTCTCTGGCCTTTCCTGG 0: 1
1: 2
2: 5
3: 30
4: 375
946226607_946226616 10 Left 946226607 2:218267217-218267239 CCTTCCCCCTTCTGTCCACTCTA 0: 1
1: 1
2: 0
3: 50
4: 630
Right 946226616 2:218267250-218267272 CGCCTGCTCCTATACCAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 41
946226607_946226619 20 Left 946226607 2:218267217-218267239 CCTTCCCCCTTCTGTCCACTCTA 0: 1
1: 1
2: 0
3: 50
4: 630
Right 946226619 2:218267260-218267282 TATACCAATGTGGCCTTCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946226607 Original CRISPR TAGAGTGGACAGAAGGGGGA AGG (reversed) Intronic
900465395 1:2822766-2822788 TAGAGTGGACAGAGGCTGGGAGG + Intergenic
900634020 1:3652935-3652957 GAGAGGGGACAGCAGGAGGAGGG - Intronic
901138238 1:7011463-7011485 CAGAGTGGATAGGAGGGCGAAGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901234634 1:7661351-7661373 GAGAGTGGACAGGAGGCTGAGGG - Intronic
901451229 1:9338083-9338105 TTGAGTGCTCAGATGGGGGAGGG + Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
903234585 1:21941509-21941531 GAGAGTAGAGTGAAGGGGGATGG - Intergenic
903675304 1:25060894-25060916 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904216824 1:28927646-28927668 ATGAGAGGAAAGAAGGGGGAGGG - Intronic
904410291 1:30320873-30320895 AAGTGTGGGCAGAAGGGGGGTGG + Intergenic
904492484 1:30869717-30869739 TACAGGGGAGAGAAGGGGCAGGG + Intronic
904947029 1:34206853-34206875 AGGAGTGGACAAAAGTGGGAGGG + Intronic
905529235 1:38663451-38663473 TAGGATGGATAGCAGGGGGAAGG + Intergenic
905757936 1:40527500-40527522 TGGAGTGGGGGGAAGGGGGAAGG + Intergenic
906243223 1:44255357-44255379 TAGAGTGTCAAGAAGGGAGAAGG - Intronic
906255689 1:44348184-44348206 TAGGGAGGACAGAATGGGGTGGG - Intronic
906454648 1:45983448-45983470 TAGAATGGACAGAATAGAGAGGG - Intronic
907330289 1:53666581-53666603 AAGAGTGGGCAGAGTGGGGATGG - Intronic
908792016 1:67792141-67792163 TAGAGTGCCAGGAAGGGGGAAGG - Intronic
909343562 1:74558605-74558627 CAGAAGGGACAGAAGGGAGAAGG - Intergenic
910159536 1:84258738-84258760 GAGAGAGGAAAGAAGCGGGAAGG - Intergenic
910545755 1:88415683-88415705 TTGAGTGGCCAGAAGGTGGTGGG + Intergenic
911200546 1:95039312-95039334 GAGAATGGACAGAAGGGGAGAGG + Intronic
911463743 1:98224245-98224267 TAGAGTGAGGAGAAGCGGGAAGG + Intergenic
912164584 1:107028267-107028289 GAAAGTGGAGAGAAAGGGGAAGG - Intergenic
912207444 1:107524090-107524112 AAAAGAAGACAGAAGGGGGAAGG - Intergenic
913286017 1:117227480-117227502 CATAATGGACAGAAGTGGGAGGG + Intergenic
914780370 1:150780320-150780342 TTGAGGGGCCAGAAGTGGGAGGG - Intergenic
914825046 1:151133747-151133769 TACAGGGGCCAGAAGTGGGATGG - Intronic
914860532 1:151382123-151382145 TAGGGTGGACTGAGGGGAGAGGG - Intergenic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
915541677 1:156571198-156571220 GAGAGGGGAGAGAAGGGAGAAGG - Intronic
915561872 1:156692505-156692527 TAGACAGGAGAGGAGGGGGAGGG + Intergenic
915928050 1:160039284-160039306 TAGAATAGACAGCAGGGGAATGG + Exonic
917080544 1:171252807-171252829 GTGAGGGGACAGAAGAGGGAGGG + Intronic
917155565 1:171994941-171994963 TGGAGGGGACAGAATGGGGTTGG - Intronic
918357728 1:183721543-183721565 TGCAGAGGACAGAAGGGGAAAGG - Intronic
918429932 1:184449190-184449212 TAGGGTGGGGGGAAGGGGGAGGG - Intronic
918720147 1:187842101-187842123 TAGAGGGGAGGGAAGGAGGAGGG - Intergenic
918874815 1:190027062-190027084 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920949444 1:210558521-210558543 TAGAGGGAGCATAAGGGGGAAGG + Intronic
920995077 1:210982410-210982432 TGGAGTGGGGGGAAGGGGGAGGG - Intronic
921378096 1:214494779-214494801 TGGAAGGGAGAGAAGGGGGAAGG + Intronic
921657272 1:217754802-217754824 TAGAGTGCACAGAGTAGGGAGGG - Intronic
922109745 1:222545519-222545541 GAGAGTGGACAGAATGAGCAAGG - Intronic
922434140 1:225586290-225586312 AAGAGGGGAGAGGAGGGGGAAGG + Intronic
922617103 1:226967340-226967362 TAGAGTGAAAGGAAGAGGGAGGG - Intronic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922822980 1:228497147-228497169 TGGAGAGGACACAAGGGAGACGG - Intergenic
924071449 1:240284514-240284536 AAGAGTGGACAGCTGGGGAAGGG - Intronic
1063522711 10:6755365-6755387 TAGATTTGAAAGAAGGGGGCTGG + Intergenic
1063563969 10:7155842-7155864 TTGAGTGCACAGCAGGTGGAAGG - Intergenic
1064102505 10:12475889-12475911 AAGAGTTGACAGGAGAGGGAGGG + Intronic
1064283643 10:13972761-13972783 TGGAAGGGAAAGAAGGGGGAGGG + Intronic
1064392456 10:14953833-14953855 GAGAGAGGACAGGAGGGGGCCGG - Intronic
1064795506 10:19007344-19007366 TAAAGTGGGCAGAAGTTGGAAGG - Intergenic
1065245116 10:23748547-23748569 GAGAGGGGAGAGGAGGGGGAGGG + Intronic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1065493654 10:26307669-26307691 GAGAGTGGGCAGGATGGGGAAGG - Intergenic
1065536406 10:26719079-26719101 TAGAGGGGAAAAAAGGGAGAGGG - Intronic
1066212271 10:33251881-33251903 TAAATGGTACAGAAGGGGGAAGG + Intronic
1069071221 10:63992166-63992188 TAAAGGGGACAGAATGGGCAGGG + Intergenic
1069807928 10:71137604-71137626 ATGAGGGGACAGGAGGGGGAAGG - Intergenic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070731266 10:78830150-78830172 TAGAGAGGGCAGAAGGGGAATGG - Intergenic
1071089951 10:81906583-81906605 TAGAGTGGAGCGAAGTGGGCTGG + Intronic
1071917469 10:90310699-90310721 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1072101248 10:92231492-92231514 GAGAGTGGACAGAAGGGAAAAGG - Intronic
1073518113 10:104097397-104097419 TGGAGTGGACAGAATGAGGTCGG - Intergenic
1073616125 10:104997973-104997995 TAGACTGTACAGAATGGGAAAGG + Intronic
1074042553 10:109806126-109806148 GAGAGTGGAGAGTAGGAGGAGGG + Intergenic
1074045202 10:109831692-109831714 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
1075575219 10:123572809-123572831 GAGAGGGGAGAGAAGGGGAAGGG + Intergenic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1076475351 10:130747942-130747964 TACACTGGAAAGAATGGGGAAGG + Intergenic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1078406132 11:11071428-11071450 TGGGGTGCACAGAAGGTGGATGG + Intergenic
1078624720 11:12944220-12944242 TAGATTGGAGAGATGGGGGTGGG + Intronic
1078672451 11:13377146-13377168 CAGCGTGGACAGCAGGGGCAGGG - Intronic
1080895523 11:36446276-36446298 TAGAGGGGACAGAGGAGAGAGGG - Intronic
1080985652 11:37461237-37461259 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1081069291 11:38589985-38590007 TAGAGTGGGGGGAGGGGGGAGGG + Intergenic
1081279205 11:41187509-41187531 TGGGGAGGCCAGAAGGGGGATGG - Intronic
1081574470 11:44310518-44310540 AAGAGTGGAGAGGAGGGGGCAGG - Intergenic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1081993081 11:47347915-47347937 AAGGGTGGAGAGATGGGGGAAGG + Intronic
1082297438 11:50459474-50459496 TGGAGTGGGGGGAAGGGGGAGGG - Intergenic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083836326 11:65270943-65270965 GAAAGAGGACAGAAGGAGGAGGG - Intronic
1084346557 11:68554230-68554252 TAGAGTGGCAAGCAGGGGGTCGG - Exonic
1084915222 11:72423900-72423922 TAGAGGGAACAGCAGGTGGAAGG - Intronic
1085161775 11:74354427-74354449 TAGACATGACAGCAGGGGGAAGG - Intronic
1085864567 11:80274404-80274426 TAGAGTGGAGGGCAGGAGGAGGG - Intergenic
1086168252 11:83805581-83805603 GAGAGTAGACAAAAGGGAGAGGG - Intronic
1086319467 11:85629398-85629420 TTGAGTGGCCTTAAGGGGGAAGG + Intronic
1086605909 11:88696114-88696136 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1087151508 11:94864354-94864376 TAATGTAGTCAGAAGGGGGAGGG + Intronic
1087209608 11:95433361-95433383 TTGAGTGGACAGAATGTGTATGG - Intergenic
1087663728 11:101017936-101017958 TAGAGTTCAGAGAAGGGAGAAGG - Intergenic
1087711218 11:101554895-101554917 TAGAGAGGACAGAGAGGGAAGGG - Intronic
1088363518 11:109016243-109016265 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363563 11:109016415-109016437 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363599 11:109016547-109016569 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088826215 11:113496433-113496455 GAGAGTGGCTTGAAGGGGGAAGG + Intergenic
1088920273 11:114255496-114255518 TGGAGTGGACAGAAATGAGACGG - Intergenic
1089089378 11:115856782-115856804 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1089499171 11:118922675-118922697 GGGAGGGGGCAGAAGGGGGATGG - Intronic
1089829246 11:121310753-121310775 TAGAAGGGACAGAAGGGGCTGGG - Intergenic
1090410890 11:126508904-126508926 TCGAGTGGAGAGAAGAGAGAAGG - Intronic
1090754503 11:129777982-129778004 TGGAGTGGAAGGAAGGGTGAAGG + Intergenic
1092315224 12:7405280-7405302 GAGAGATGAGAGAAGGGGGAAGG - Intronic
1092730564 12:11529647-11529669 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1092972644 12:13712229-13712251 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1092999640 12:13982125-13982147 TAAGGTGGATGGAAGGGGGACGG + Intergenic
1093145987 12:15567464-15567486 AAGAATGGACATAAGGGAGAAGG - Intronic
1093427356 12:19043630-19043652 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1093792359 12:23266983-23267005 TCGAGTGGGGGGAAGGGGGAGGG + Intergenic
1093906897 12:24703796-24703818 GAGAGTGGACAGAAGAGGTAAGG - Intergenic
1094334606 12:29334637-29334659 TAGAGTGGTCAACAGGGAGAGGG + Exonic
1094822906 12:34240818-34240840 CACAGGGGACAGAAGTGGGAGGG + Intergenic
1095609920 12:44115308-44115330 TCGGGTGGGGAGAAGGGGGAGGG + Intronic
1096635800 12:52958327-52958349 TAGGGGGGAAACAAGGGGGAAGG + Intergenic
1096796617 12:54081941-54081963 TAGAGAAGACAGTGGGGGGAGGG + Intergenic
1097218408 12:57431562-57431584 TAGAATGGACAAAACGGGGGAGG - Intergenic
1097294683 12:57949857-57949879 TTGAGTGGGGAGATGGGGGATGG - Intronic
1097741375 12:63246375-63246397 TGGAGTGGGGAGAGGGGGGAGGG + Intergenic
1097944252 12:65349049-65349071 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1098249759 12:68557214-68557236 GAGAGAGGAAAGAAGTGGGAGGG - Intergenic
1098260755 12:68668038-68668060 CAGAGTGGAAGGATGGGGGAGGG - Exonic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1100909641 12:99344150-99344172 TAGAGTTCACAGCAGGGGAATGG - Intronic
1101231186 12:102743240-102743262 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1102781208 12:115566383-115566405 GAGAGTGGAGAGGAGGAGGAGGG + Intergenic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103472331 12:121191856-121191878 GAGATTGGACAGAACGGGGAAGG - Intergenic
1103948712 12:124540642-124540664 GGGAGTGGACTGGAGGGGGATGG + Intronic
1104301726 12:127570603-127570625 AAGAGAGGAAAGAAGGAGGAAGG + Intergenic
1104904977 12:132208293-132208315 TAGTGTGGCCAGGAAGGGGAGGG - Intronic
1106352194 13:28942794-28942816 TAGAGAGGACAGCAGGGAGGAGG + Intronic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1106455118 13:29920109-29920131 TAGAGGGAACAGAGGGGGGTTGG - Intergenic
1107000979 13:35545321-35545343 TAGAGTGGAATGCAGTGGGATGG - Intronic
1107823405 13:44306323-44306345 GAGAGTGGAGAGAACTGGGATGG + Intergenic
1108127612 13:47261503-47261525 TAGAGAGGACAGAGTGGGGCTGG - Intergenic
1108169808 13:47729560-47729582 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1108243936 13:48496743-48496765 AAGAGAGGACAGGAGAGGGAGGG + Intronic
1109981739 13:69916590-69916612 TGGAGTGGGGGGAAGGGGGAGGG + Intronic
1110699677 13:78532035-78532057 TAGGGTGGAGGGACGGGGGAGGG + Intergenic
1111304406 13:86388200-86388222 TGGAGTGGGGAGAGGGGGGAGGG + Intergenic
1111584583 13:90268298-90268320 TGGGGAGGCCAGAAGGGGGATGG + Intergenic
1111808826 13:93072059-93072081 TACAGTGGAAAGTAGGAGGAGGG + Intergenic
1112207229 13:97336925-97336947 AGGAGTGGACAGAAGAAGGAGGG - Intronic
1112254330 13:97815646-97815668 TAGAGTGGGGAGAAGGGAGGAGG + Intergenic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1113278109 13:108757620-108757642 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1113298954 13:108995580-108995602 TGGAGTGGGGAGAGGGGGGAGGG - Intronic
1114555766 14:23561436-23561458 CAGAAGGGACAGAAGGGGCAGGG + Intronic
1114829158 14:26118377-26118399 TAGAGTGGAGGGTAGGCGGAGGG + Intergenic
1114996619 14:28361192-28361214 TAGAGCGGAGAGAAAGGGAAGGG + Intergenic
1115996843 14:39203764-39203786 GAGAGTGGGCAGAAGAGTGAGGG + Intergenic
1116515009 14:45794751-45794773 TGGGGTGGGGAGAAGGGGGATGG - Intergenic
1118654723 14:67934328-67934350 AAGAGAGGAAAGAAGTGGGAGGG + Intronic
1118865703 14:69701976-69701998 TAGATTGGAAAGAAGAGGCATGG + Intronic
1118975843 14:70675965-70675987 TAGAGAGGACTGAAGGGCTAAGG - Intergenic
1119052571 14:71384393-71384415 TTGAGTTGGCAGAAGGGAGAGGG + Intronic
1119535564 14:75400168-75400190 TAGAGGCAAAAGAAGGGGGAAGG - Intergenic
1119948578 14:78720623-78720645 GAGAGTGGACAGATGCAGGATGG - Intronic
1119951649 14:78751699-78751721 TGGAGGGGACGGAAGGGGGAAGG + Intronic
1120608402 14:86608617-86608639 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1121240601 14:92427351-92427373 TAGAGTGGGCACCATGGGGAAGG + Intronic
1121378065 14:93431540-93431562 AAGAAGGGAGAGAAGGGGGAGGG + Intronic
1121413520 14:93763555-93763577 TGGAGTGGAAGGAAGGAGGAGGG - Intronic
1121899858 14:97684191-97684213 AACTTTGGACAGAAGGGGGAAGG - Intergenic
1121963476 14:98282832-98282854 TAGAGTGGAGACAAGGGAGTTGG + Intergenic
1122287454 14:100660038-100660060 TGGAGGGGACAGAAGGGACAGGG + Intergenic
1122902514 14:104787681-104787703 GAGAGTGGACAGAATGTGGGTGG - Intronic
1123678645 15:22739490-22739512 AAGAGAGGAAGGAAGGGGGAAGG - Intergenic
1124067742 15:26361844-26361866 TTGAGTGGAGAGAAGGGTGCCGG + Intergenic
1124330851 15:28813771-28813793 AAGAGAGGAAGGAAGGGGGAAGG - Intergenic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1124808918 15:32914684-32914706 TAGTGTGGACAGAAAGGATAGGG + Intronic
1125037962 15:35149065-35149087 AAGGGAGGAGAGAAGGGGGATGG - Intergenic
1125303900 15:38288481-38288503 AATAGTGGAGAGAAGGTGGATGG + Intronic
1125727464 15:41875387-41875409 TGGGCTGGACAGAACGGGGAGGG - Intronic
1125891068 15:43267629-43267651 GAGAGAGGGCAGGAGGGGGAAGG + Intergenic
1125892375 15:43276181-43276203 GAGAGAGGACAGGAGGGGAAGGG + Intergenic
1126812526 15:52422390-52422412 TAGGGTGGGGAGTAGGGGGAAGG - Intronic
1126841701 15:52723567-52723589 TAGTGTGGAAAGGAGGGAGAAGG - Intergenic
1128291382 15:66481043-66481065 AAGAGTGCAAGGAAGGGGGATGG + Intronic
1128472686 15:67968301-67968323 TGGAGTGGGGAGAAAGGGGAGGG + Intergenic
1129198772 15:73986307-73986329 TAGAGAGGACACACGGGGGTGGG + Intronic
1131418776 15:92285787-92285809 TAGATGGGAGAGAAGGTGGATGG - Intergenic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1134523208 16:14927828-14927850 GAGAGGGGAGAGAAGGGGGAGGG - Intronic
1134523221 16:14927858-14927880 GGGAGGGGAGAGAAGGGGGAGGG - Intronic
1135110034 16:19683443-19683465 TAGAGTGGGGAGGAAGGGGAGGG - Intronic
1135282591 16:21165557-21165579 GAGAGGGAAGAGAAGGGGGAGGG - Intronic
1136631157 16:31489990-31490012 TAGACTGGACAGAGGTGGGTAGG + Exonic
1137246666 16:46711474-46711496 TGGAGTGCACCGAAGGGGTAAGG - Intronic
1137685814 16:50386098-50386120 AAGAGGTGACAGAAGGGAGAAGG - Intergenic
1138350721 16:56344986-56345008 GACAGAGGACAGCAGGGGGATGG + Exonic
1139239567 16:65377258-65377280 TTGAGTGAATAGAAGGGTGATGG + Intergenic
1139381826 16:66537331-66537353 TAGAATACACAGAAGAGGGATGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1141289638 16:82705992-82706014 GAGAGAGGACAGGAGGGGGAAGG - Intronic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143591362 17:7887402-7887424 TCGACTTGCCAGAAGGGGGAGGG - Intronic
1143734041 17:8897838-8897860 TGGAGTGGAAAGATGAGGGAAGG + Intronic
1144641282 17:16938575-16938597 TGCAGTGGACAGGAAGGGGAGGG - Intronic
1145231665 17:21177650-21177672 GAGATGGGACAGAAGGTGGAGGG - Intronic
1145704362 17:26858424-26858446 TAGAATGGACAGCAGTGGAATGG + Intergenic
1145757480 17:27403343-27403365 TAGAGTGGAAAGCGGGGGAAGGG - Intergenic
1146110949 17:30089081-30089103 TGGGGTGGAGGGAAGGGGGAGGG - Intronic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1146593835 17:34152837-34152859 TAGAGTGGAAGGAAGGAGGAGGG - Intronic
1147059598 17:37864653-37864675 GAGAGTGGTGAGCAGGGGGAGGG - Intergenic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147418363 17:40309525-40309547 AAGAGTGGGGAGTAGGGGGAAGG + Intronic
1148389746 17:47262818-47262840 TAGAGTGAAAGTAAGGGGGAAGG + Intronic
1148408870 17:47447143-47447165 GAGAGTGGTGAGCAGGGGGAGGG - Intergenic
1148509027 17:48153280-48153302 AAGAGAGGACAAAAGGGAGAGGG - Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149017823 17:51929414-51929436 TAGAGAGGACAGCAGAGGGCAGG - Intronic
1149285606 17:55160790-55160812 TTGGGTGCAGAGAAGGGGGAAGG - Exonic
1149537150 17:57441911-57441933 TGGGGAGGACAGAAGGGTGAAGG + Intronic
1149566529 17:57644374-57644396 GAGAGTGGAAAAAAGGTGGATGG - Intronic
1149806675 17:59624375-59624397 TATAGTAGACAGAACAGGGAGGG + Intronic
1149952588 17:61005938-61005960 TGGAGTGGGGGGAAGGGGGAGGG - Intronic
1151070616 17:71206303-71206325 TGGGGTGGAGGGAAGGGGGAGGG + Intergenic
1151109230 17:71655272-71655294 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1151458651 17:74241794-74241816 GAGAGTGGACAGAGGAGGGGCGG - Intronic
1152048265 17:77953253-77953275 TAGAGGGGCCACAAGGGGAATGG - Intergenic
1152223135 17:79080219-79080241 CGGAGTGGAATGAAGGGGGAAGG + Exonic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1203198075 17_KI270729v1_random:250419-250441 TAGAATGGACACAAAGGGAATGG + Intergenic
1203207679 17_KI270730v1_random:51173-51195 TAGAATGGACACAAAGGGAATGG + Intergenic
1153227992 18:2912366-2912388 AAGAGTGGACATAAAGCGGAGGG - Intronic
1154101926 18:11483737-11483759 TAGAGTGGGGAGAAGTGGGAAGG + Intergenic
1156227921 18:35127400-35127422 TAGAATGGCCAGAAGTGGGCAGG - Intronic
1156514932 18:37671387-37671409 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1156633407 18:38996711-38996733 TAGAGTGGGCAGATGGGGTCGGG - Intergenic
1156707204 18:39897718-39897740 TAGAGTAGGCTGAAGGGAGAAGG + Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156920207 18:42513135-42513157 TAGTGTGGAAAGAAGGAGCAGGG + Intergenic
1156922089 18:42534221-42534243 TAGAGGGAACAGAAAGGAGAGGG + Intergenic
1157415653 18:47500629-47500651 TGGAGTGTACAGAGGGGGGAAGG + Intergenic
1157763877 18:50283376-50283398 TAGAGAGGGCAGTAGAGGGAGGG + Intronic
1159601075 18:70429393-70429415 TGGAGTGGTCAAAATGGGGATGG + Intergenic
1159679726 18:71333513-71333535 TAGAGTGGGAAGAAAGGGAAGGG + Intergenic
1159800583 18:72894629-72894651 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1160001880 18:75032503-75032525 TAGAGTCGAGAGAAGAGAGAAGG - Intronic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1160999162 19:1900714-1900736 GAAAGTGGAGAGAATGGGGAAGG + Intergenic
1162242320 19:9365213-9365235 TAGAGTTGATATAAGGAGGAAGG + Intronic
1162964391 19:14149122-14149144 TAGAGTTGAGGGAAGGGGGCTGG + Exonic
1163110392 19:15157204-15157226 TAGAGTGGACAAAATGGGTAGGG + Intergenic
1163327985 19:16617602-16617624 TGGGGTGGAGAGAAGGGAGAGGG - Intronic
1164646582 19:29862734-29862756 TAGTGTGGACTGAAGGGGACAGG + Intergenic
1164896516 19:31881978-31882000 TAGACTGGACAGACTGGGGGCGG - Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165311529 19:35031562-35031584 GAGAGTGGACAAAAAGTGGAGGG + Intronic
1165724144 19:38100853-38100875 TGGAGTGGAAGGGAGGGGGAGGG + Intronic
1165732664 19:38156404-38156426 TCCAGGGGACAGAAGAGGGAAGG - Intronic
1165844269 19:38808255-38808277 AAGAGAGGAGGGAAGGGGGAAGG + Intronic
1166159539 19:40941521-40941543 TAGAGAGGTGAGAAGAGGGAGGG + Intergenic
1166317542 19:41997557-41997579 CAGAGTGGGCGGGAGGGGGATGG - Intergenic
1166412909 19:42568529-42568551 TGGGGTGGAGGGAAGGGGGAGGG + Intergenic
1166747774 19:45149887-45149909 TCAAGTGGGCAGATGGGGGAAGG + Exonic
1168172313 19:54596885-54596907 AAGAGTGGAGTGAAGGGGGAAGG + Intronic
1168179477 19:54651059-54651081 GAGGGTGGAGAGGAGGGGGATGG - Intronic
925274755 2:2640939-2640961 TAGAGGGGACAGAGGCAGGAGGG + Intergenic
926240499 2:11081198-11081220 AGGAGGGGACAGAAGGGAGAAGG - Intergenic
927842240 2:26453151-26453173 AAGAGTGGGAAGAAGGGGGATGG - Intronic
928323026 2:30298442-30298464 TAGAGTTTAAAGAAAGGGGAAGG + Intronic
928778664 2:34794358-34794380 TAGAGTGGATATAAGGAGAAAGG - Intergenic
929826568 2:45313531-45313553 TAGATTGGAGGGAAGGGAGATGG + Intergenic
930358030 2:50346006-50346028 CAGAGTGGATGGAAGGGGAATGG + Intronic
930931734 2:56892986-56893008 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
931217925 2:60263688-60263710 CAAAGTGGAGAGAAGGGTGAGGG - Intergenic
931218181 2:60265366-60265388 GCGAGTGGAAAGAAGGGGGTGGG + Intergenic
932319105 2:70808066-70808088 TACAGTGGAAAGAAGAGTGAAGG - Intergenic
932878097 2:75474219-75474241 TAGGGTGGCCAGGAGGGGAACGG + Intronic
933177972 2:79197290-79197312 TAGAGTGAACAAAAGTGGTAAGG + Intronic
933338564 2:80992268-80992290 TGGAGTGGAGAGAGTGGGGATGG + Intergenic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933811670 2:86036507-86036529 CAGAGAGGAAGGAAGGGGGAGGG + Intronic
935174756 2:100640057-100640079 GGCAGTTGACAGAAGGGGGAAGG - Intergenic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
935784263 2:106534572-106534594 TGAATTTGACAGAAGGGGGATGG + Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937872993 2:126799066-126799088 TTCAGTGGGCAGAAGGGGGCAGG - Intergenic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
938811028 2:134852808-134852830 TCGAGTGGGCACTAGGGGGATGG + Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
940497470 2:154451377-154451399 TAGAGTGAAGAGAAAAGGGATGG - Exonic
941287423 2:163631517-163631539 TAAAGAGGAGAGAAGTGGGAGGG - Intronic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
942785633 2:179698041-179698063 TGGAGTGGAGTGAGGGGGGAGGG + Intronic
942914726 2:181291389-181291411 CAAAGTGGAGAGAAGAGGGACGG - Intergenic
943665280 2:190602620-190602642 TAGAGTGGAAAGATGGGGAGGGG - Intergenic
943732508 2:191317619-191317641 TGGGGTGGAGGGAAGGGGGAGGG - Intronic
944121070 2:196241461-196241483 GAGAGAGGACAGAGGAGGGACGG - Intronic
944944658 2:204669750-204669772 TAGAGCCGACAGAAATGGGAAGG + Intronic
945269424 2:207923658-207923680 GAGAGTAGAGACAAGGGGGATGG + Intronic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
946277533 2:218642731-218642753 CAAAGTGGACAGAAGTGGGTAGG + Exonic
947606125 2:231486919-231486941 TGGAGTGGACAGTAGAGGGAGGG + Intergenic
947811873 2:233009870-233009892 TGGAGTGGAGGGAAGGTGGAGGG - Intronic
948344325 2:237282649-237282671 GGGAGGGGAGAGAAGGGGGAGGG + Intergenic
949002991 2:241628095-241628117 GATAGTGGAGAGAAGGGGGTTGG - Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1169082732 20:2807091-2807113 CAGAGTGGTGGGAAGGGGGATGG - Intergenic
1170585446 20:17730752-17730774 CAGAGTGGACAGAAAGGAGTTGG - Intronic
1170633242 20:18083104-18083126 TAGAGTTGACAGAGTGTGGAGGG - Intergenic
1170792019 20:19516374-19516396 TAGAATGGAATTAAGGGGGAGGG - Intronic
1171848078 20:30289956-30289978 TAGAGAAGACAGTGGGGGGAGGG + Intergenic
1171869580 20:30514301-30514323 GAGAGTGGACAGGAGTGGCAGGG - Intergenic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1171962114 20:31502372-31502394 AAGAGGGTACAGAAAGGGGAGGG + Intergenic
1172263888 20:33593842-33593864 ATGTGTGGACAGAAGGGGAAAGG - Intronic
1172486574 20:35301907-35301929 TGGAGGGGACAGGAGAGGGAGGG + Intergenic
1172781300 20:37438416-37438438 GAGAGTGGAGGGAAGAGGGAGGG - Intergenic
1173216862 20:41093449-41093471 GAAAGGGGACAGAAGAGGGAAGG - Intronic
1173402977 20:42741058-42741080 TAGAGAGGACAGAAGGTGTAAGG + Intronic
1173848802 20:46204795-46204817 TAGGGTGGAGAAAATGGGGAGGG + Intronic
1174138336 20:48395839-48395861 GAAAGTGGAGAGAAAGGGGAAGG - Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175116942 20:56689402-56689424 TGGAGAGGGCAGAAGTGGGAGGG + Intergenic
1176154856 20:63613944-63613966 TGGTCTGGACAGGAGGGGGAGGG + Intronic
1177159298 21:17530266-17530288 AAGAGTGGAAAAAAGGGTGAAGG - Intronic
1177228915 21:18293617-18293639 CAGAGTGGATGGAAGGGGGTGGG - Intronic
1177571633 21:22894741-22894763 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1178137297 21:29641927-29641949 TATAGTGTAAAGAAGAGGGAGGG - Intronic
1178203287 21:30432908-30432930 GAGATTGGACTGAAGGGGGATGG + Intergenic
1178204866 21:30453273-30453295 TAGAATGGACTGAAATGGGATGG - Intergenic
1178444235 21:32623973-32623995 GATAGTGGATAGAAGGGGGATGG + Intergenic
1178697491 21:34807260-34807282 TAGAGTGGACAGTCAGAGGAGGG - Intronic
1179264636 21:39792379-39792401 TAGGGTGGGGGGAAGGGGGAAGG + Intronic
1179626749 21:42653509-42653531 GAGAGAGGAGAGACGGGGGAGGG + Intergenic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180790338 22:18572333-18572355 GGGAGGGGACTGAAGGGGGACGG - Intergenic
1181139671 22:20795309-20795331 GAAAGTGGAGAGAAAGGGGAAGG - Intronic
1181231400 22:21422982-21423004 GGGAGGGGACTGAAGGGGGACGG + Intronic
1181247250 22:21511886-21511908 GGGAGGGGACTGAAGGGGGACGG - Intergenic
1181528421 22:23502698-23502720 TGGAGTGGAGGGATGGGGGATGG - Intergenic
1181595767 22:23913611-23913633 TGGAGGGGAAAGAAGGGAGATGG - Intergenic
1181737415 22:24892590-24892612 TTGAGTGGATAGGTGGGGGAAGG + Intronic
1182208892 22:28656763-28656785 TGGCGTGGAGAGAGGGGGGAAGG + Intronic
1182218715 22:28741310-28741332 TAGGGTGGCCAGAAGTGGGTAGG - Intronic
1183050596 22:35257749-35257771 TGGAGCGGGCAGAAGGAGGAGGG + Intronic
1183230756 22:36580484-36580506 AGAAGTGGAGAGAAGGGGGAAGG - Intronic
1184325761 22:43783024-43783046 TGGAGTGGACAGAACAGGGCTGG + Intronic
1184327998 22:43806171-43806193 AAGAGAGGAGAGGAGGGGGAGGG + Intronic
1184753438 22:46502391-46502413 TAAAGTGGAAAGAAGAGGGAAGG + Intronic
1184753456 22:46502442-46502464 TAAAGTGGAAAGAAGAGGGAAGG + Intronic
1203296563 22_KI270736v1_random:47901-47923 TGGAGTGGACAGGAGGGGAATGG + Intergenic
1203296828 22_KI270736v1_random:49405-49427 TGGAGTGGAAAGGAGGGGAATGG + Intergenic
1203299010 22_KI270736v1_random:64100-64122 TGGAGTGGACAGGATGGGAATGG + Intergenic
1203299384 22_KI270736v1_random:66389-66411 TGGAGTGGACAGAAGTGGAATGG + Intergenic
1203300120 22_KI270736v1_random:71308-71330 TAGAATGGAGAGAAGTGGAATGG + Intergenic
1203300301 22_KI270736v1_random:72500-72522 TAGAATGGAAAGAATGGAGACGG + Intergenic
1203300452 22_KI270736v1_random:73452-73474 TGGAGTGGGCAGAAGTGGAATGG + Intergenic
1203301096 22_KI270736v1_random:77650-77672 TGGAGTGGAGAGCAGTGGGATGG + Intergenic
1203309518 22_KI270736v1_random:132871-132893 TGGAGTGGACAGGAGTGGAATGG + Intergenic
1203309928 22_KI270736v1_random:135620-135642 TAGAGTGGAGAGGAGTGGAAGGG + Intergenic
1203310319 22_KI270736v1_random:138147-138169 TGGAATGGACTGAAGTGGGATGG + Intergenic
1203310374 22_KI270736v1_random:138532-138554 TAGAGTGGAGTGAAGTGGAATGG + Intergenic
1203310551 22_KI270736v1_random:139657-139679 TGGTGTGGACGGAAGTGGGATGG + Intergenic
1203311977 22_KI270736v1_random:149108-149130 TAGAATGGAGAGAAGTGGAATGG + Intergenic
949195188 3:1296904-1296926 TAGAGGGGATAGAAGAAGGAAGG - Intronic
949287498 3:2424206-2424228 TAGGGTGGAGGGAGGGGGGAGGG - Intronic
949444132 3:4115254-4115276 TGGGGAGGACAGAAGGGAGATGG - Intronic
949879830 3:8652511-8652533 GAGAGAGGAAAGAAAGGGGAAGG + Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950918234 3:16666854-16666876 TAGAGTGGAGTGAAATGGGAGGG + Intronic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952489268 3:33850905-33850927 AAGAGAGGAAGGAAGGGGGAAGG - Intronic
953016537 3:39082205-39082227 TAGGGTGGGAACAAGGGGGATGG + Intronic
953201651 3:40783264-40783286 TTGAGAGGATAGAAGGGGAAGGG - Intergenic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
955281721 3:57600438-57600460 AAAAGGGAACAGAAGGGGGAAGG - Intergenic
956204076 3:66738127-66738149 TAGGATGGCCAGAAAGGGGATGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
958026877 3:88059210-88059232 TAGGGAGGAGGGAAGGGGGAGGG + Intronic
958429245 3:94018708-94018730 TAGAGTTGCCAGAAGAGAGATGG - Intronic
959182532 3:102999997-103000019 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
959264431 3:104119611-104119633 TGGAGTGGGGAGAGGGGGGAGGG - Intergenic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959719150 3:109468214-109468236 TAGATTGGAAAAAAGGGGGAAGG - Intergenic
959993854 3:112659288-112659310 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
960262904 3:115588572-115588594 GAGAATAGACTGAAGGGGGAGGG + Intergenic
962445164 3:135457315-135457337 TAGAGTTCCCAGAAGGGCGAGGG - Intergenic
962595844 3:136942743-136942765 AAGCCTGGACAGAAAGGGGATGG - Intronic
962682554 3:137815290-137815312 TAGAGTTGTCAGGAGGAGGAGGG + Intergenic
962777093 3:138671921-138671943 AAAAGTGGAGAGAAAGGGGAAGG + Intronic
963437111 3:145286036-145286058 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
963632065 3:147745757-147745779 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
963960021 3:151299416-151299438 AAGAGAGGAGAGGAGGGGGAGGG - Intronic
963970639 3:151425902-151425924 TAGAGTGGAACGAAGTGGGGAGG + Intronic
964517586 3:157529666-157529688 TGGAGTGCACAGAATGGGGTGGG + Intronic
966876843 3:184327269-184327291 TAGAGCGGAGTGAACGGGGAGGG + Exonic
968266960 3:197369878-197369900 AAGCGGGGAGAGAAGGGGGAGGG - Intergenic
969200396 4:5599571-5599593 TGGGGTGGGCAGAGGGGGGAGGG + Intronic
969346507 4:6573858-6573880 TGGACAGGACAGAAGGAGGAGGG + Intergenic
969619567 4:8272314-8272336 TCGAGGGGACAGAAGGGAGGAGG + Intronic
969625598 4:8303693-8303715 AAGACTGGACAGAGGTGGGATGG - Intronic
969982104 4:11168312-11168334 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
970121186 4:12754132-12754154 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
970664495 4:18321172-18321194 TGGAGTGGAGAGAAGGGGGTAGG + Intergenic
970983548 4:22129145-22129167 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
971318703 4:25588220-25588242 GAGAATGGACAGAAGGGAGGGGG - Intergenic
972687935 4:41369183-41369205 TAGACTGGGAAGATGGGGGAGGG - Intronic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
972984209 4:44744130-44744152 TGGGGTGGAGAGATGGGGGAGGG - Intergenic
973038067 4:45432728-45432750 TAGAATGGCTAGAAGTGGGATGG + Intergenic
974260343 4:59518170-59518192 TAGAGGGGACAGAGGCGGCAGGG + Intergenic
975036762 4:69694242-69694264 TAGGGTGGAGGGAGGGGGGAGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975662844 4:76704783-76704805 TGGAGGGGACAGAAGTGGAAGGG + Intronic
976261213 4:83146585-83146607 TAAAGTGGAAAGAAGAGGGCAGG + Intergenic
977081949 4:92541143-92541165 TAGGGTGGGGAGAGGGGGGAGGG + Intronic
977091447 4:92681540-92681562 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
977363381 4:96034782-96034804 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
977478520 4:97542974-97542996 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
978703398 4:111675635-111675657 TGGGGAGGACAGAAGCGGGAGGG - Intergenic
978744736 4:112179558-112179580 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
978981093 4:114946424-114946446 TAGAGTGGAATCAAGGGGTACGG + Intronic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979560145 4:122092616-122092638 TAGAGTAGAGAGAATGGGTACGG + Intergenic
979818033 4:125134390-125134412 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
980187094 4:129475681-129475703 TAGAGTAGGCAGATAGGGGAAGG - Intergenic
980438299 4:132809539-132809561 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
980867530 4:138570757-138570779 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
982157481 4:152536154-152536176 CAGAGCGGAAAGAAGAGGGAGGG - Intergenic
982410354 4:155069086-155069108 TGGGGTGGAGAGAAGAGGGAGGG + Intergenic
982488446 4:155998321-155998343 GAGGGTGGAAAGAAGGGTGAAGG - Intergenic
983502590 4:168516348-168516370 AAGAGTGGAGAGAACAGGGAAGG - Intronic
984433507 4:179679795-179679817 TGGGGTGGACGGAAGGGGGAGGG - Intergenic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
985388259 4:189467438-189467460 TAGAGTGTACAGCAATGGGAGGG - Intergenic
1202750686 4_GL000008v2_random:2742-2764 TAGAGTGGACTGGAGTGGAATGG + Intergenic
985856957 5:2435709-2435731 TAGAGAGGACAGGAAGGGAATGG - Intergenic
988773176 5:34451919-34451941 TAGATTGGTCAGAATGGGCAGGG - Intergenic
990123346 5:52483609-52483631 AAGAGTGGGCAGTAGGGGAAAGG + Intergenic
990643164 5:57811036-57811058 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
990731078 5:58810144-58810166 GAGACTGGACTGAAGGAGGAGGG - Intronic
991748165 5:69768470-69768492 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991799747 5:70348315-70348337 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991828850 5:70661723-70661745 TAGGGTGGAGGGATGGGGGAGGG + Intergenic
991892103 5:71347746-71347768 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
993888851 5:93448049-93448071 TGGGGTGGAGGGAAGGGGGAGGG + Intergenic
994083451 5:95732145-95732167 GGAAGTGGGCAGAAGGGGGAGGG - Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996276932 5:121678177-121678199 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
997222204 5:132178766-132178788 TCCAGGGGACAGAAGAGGGAAGG - Intergenic
997968352 5:138378747-138378769 TTGAGTGGACAGGAGAGGTAGGG + Intronic
998212306 5:140209174-140209196 GAGAGAGGACAGAAGGGGACTGG + Intronic
998399541 5:141841397-141841419 GAGAGAGGAGGGAAGGGGGAAGG + Intergenic
998454864 5:142264082-142264104 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999026376 5:148236427-148236449 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
999641833 5:153680226-153680248 TACAGCGGAGTGAAGGGGGAGGG - Intronic
1000091481 5:157933062-157933084 TAGAGTGGGCAGCAGGAGGCTGG + Intergenic
1000370253 5:160528328-160528350 AAGAGGGGACAGGATGGGGATGG - Intergenic
1000664589 5:163979549-163979571 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1001450108 5:171818058-171818080 TGTAGTGGCCAGAAGGGGCAAGG - Intergenic
1002175561 5:177399350-177399372 GATAGTGGACAAAAGTGGGAGGG - Intergenic
1002453189 5:179331238-179331260 GGGAGAGGACAGAAGGGGCAGGG + Intronic
1002958956 6:1896453-1896475 TAGAGTGGACAAATGGGCAAAGG + Intronic
1004333616 6:14743832-14743854 AAGAAAGGAGAGAAGGGGGAAGG + Intergenic
1004746192 6:18511223-18511245 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1005269817 6:24151566-24151588 TGGGGTGGGCGGAAGGGGGAGGG + Intronic
1005589298 6:27308804-27308826 AAGAGTGGACAGGAAGGGGAAGG + Intronic
1006101129 6:31687073-31687095 AACAGTGGTGAGAAGGGGGATGG + Exonic
1006303696 6:33207196-33207218 TAAGGTGGAGAGAAAGGGGAGGG - Intergenic
1006668231 6:35713154-35713176 TAGAGTGGGCATAAGCGGGTGGG + Intronic
1006809891 6:36813152-36813174 CAGAGTGGACTGCAGGGGAAAGG - Intronic
1007307634 6:40919252-40919274 TAGAATGGAAAGAAGGGAGAGGG + Intergenic
1008248728 6:49210716-49210738 TTGAGAGCACAGAAGGGAGATGG - Intergenic
1008333767 6:50275078-50275100 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1008517159 6:52328922-52328944 TAGAGTGGAGTGTGGGGGGAGGG + Intergenic
1009610221 6:65931271-65931293 TAGAGGGGACTGAGGTGGGAGGG + Intergenic
1009662942 6:66636823-66636845 TGGGGTGGGCGGAAGGGGGAGGG + Intergenic
1010582185 6:77613648-77613670 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011325600 6:86147635-86147657 TAGAGGGGACACAAGGTAGAAGG + Intergenic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1014699030 6:124660499-124660521 TAGAGTGCAAAGAAGATGGATGG + Intronic
1015647088 6:135404181-135404203 GGGAGTGGACAGAAGAGGGAAGG + Intronic
1015697595 6:135998877-135998899 GAGAGAGGAAAGAAGGAGGAGGG + Intronic
1016021002 6:139236046-139236068 TGGGGAGGCCAGAAGGGGGAAGG - Intergenic
1016066581 6:139689099-139689121 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1016223941 6:141710617-141710639 TAGAGTGGGGAGAAGGGAGTGGG + Intergenic
1016783528 6:147986099-147986121 TGGGGAGGACAGAAGTGGGATGG - Intergenic
1016879804 6:148899901-148899923 TAGATGGCACAGAAGGGTGATGG - Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017081660 6:150675223-150675245 GAGAGGGGACTGAAGGGGGAAGG - Intronic
1017537881 6:155367798-155367820 TAGAGTGGGCAGAGGGGTTATGG + Intergenic
1017540175 6:155393599-155393621 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1018323768 6:162641703-162641725 TAGAGTTAACAGAGGGCGGATGG - Intronic
1018458630 6:163976132-163976154 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1018497647 6:164366371-164366393 TAGAATGGAAAGAAGGTGGCCGG + Intergenic
1020084711 7:5303996-5304018 GTTAGTGGACAGACGGGGGATGG - Exonic
1020749289 7:12120168-12120190 CATAGTGAACAGATGGGGGATGG + Intergenic
1021344160 7:19502947-19502969 TAGAGTGAAGAGAAGAGGAAAGG + Intergenic
1021948563 7:25752541-25752563 TAGAGTGGAAATAGGGCGGAGGG - Intergenic
1022332618 7:29394661-29394683 TAGATTAGACAGTAGGGGCATGG - Intronic
1022761898 7:33364640-33364662 GGGAGTGGAGAGGAGGGGGAAGG - Intronic
1023460592 7:40392134-40392156 TGGAGTGGGGAGATGGGGGAGGG + Intronic
1023461068 7:40397836-40397858 CAGAGTGGACAGAAGGGATATGG - Intronic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1027195506 7:76027302-76027324 AAGAGGGGACAGGAGGGGAATGG + Intronic
1027231105 7:76273001-76273023 CGGAGTGGACAGATGGGTGAAGG - Intronic
1027678533 7:81189463-81189485 TTGAGTGGGAACAAGGGGGAGGG - Intronic
1027823978 7:83087068-83087090 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029216278 7:98952678-98952700 AAGAGTGGGCTGAAGGGGAACGG + Intronic
1030651574 7:112121469-112121491 TAAAGTGGACAAAAGAGAGAAGG - Intronic
1030974956 7:116110076-116110098 TGGAGTGGGGGGAAGGGGGAGGG + Intronic
1033070538 7:138197873-138197895 TAGTGTGGTCAGTAGGTGGATGG - Intergenic
1033130281 7:138740124-138740146 GAGAGGGGACAGAAGGGGAAAGG + Intronic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1033631260 7:143160354-143160376 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1033888655 7:145980058-145980080 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
1033914650 7:146308827-146308849 TAGGGTGGGGAGACGGGGGAGGG + Intronic
1033970620 7:147034691-147034713 TGGGGAGGTCAGAAGGGGGATGG + Intronic
1034228629 7:149501765-149501787 TGGAGAGGCCAGAAGGAGGATGG + Intergenic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1034360487 7:150492495-150492517 TAGGGTGGGGGGAAGGGGGAGGG + Intergenic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034763596 7:153696467-153696489 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1034892820 7:154855602-154855624 TAGAGTGGGCAGAGGGTGGGTGG - Intronic
1035357392 7:158284680-158284702 TAGAGGGGACAGAGGTGGGATGG - Intronic
1037619653 8:20552122-20552144 TACAGTGGAAAGCAGGGGCAAGG - Intergenic
1037627023 8:20617241-20617263 TAGAGTGTAAAGAAGAGGCATGG - Intergenic
1037691100 8:21182335-21182357 GAGAGTGGGGAGAAGGGGAAGGG + Intergenic
1037753467 8:21697114-21697136 GGGAGGGGAGAGAAGGGGGAGGG + Intronic
1038406286 8:27325265-27325287 TGGAGTGGACAGAGGATGGAGGG + Intronic
1039312126 8:36328120-36328142 TGGAATGGACAGAAGGAGTAAGG - Intergenic
1039335467 8:36584371-36584393 TAGAGTGGAGAGAGGGTGGGGGG - Intergenic
1039342438 8:36665633-36665655 AAGAGTGGTCAGAACTGGGAAGG + Intergenic
1039611872 8:38926015-38926037 CTGAGAGGACAGAAGTGGGAGGG - Intronic
1039928139 8:41957956-41957978 TCCAGTGGACAGATGGGGGAAGG - Intronic
1042298810 8:67252704-67252726 TAGAGTGTCTAGAAGGGGGCTGG + Intronic
1042847265 8:73180971-73180993 TAGACTGTAGAGAAAGGGGAGGG - Intergenic
1043046494 8:75330071-75330093 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1043617363 8:82143574-82143596 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1043705402 8:83342441-83342463 TGGGGTGGGCAGAGGGGGGAAGG + Intergenic
1044093967 8:88039394-88039416 TAGAGTGGAGAGAGTGGTGATGG - Exonic
1045154416 8:99451249-99451271 TAGAGAGGACAGATGGTTGAAGG - Intronic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1045688472 8:104736030-104736052 TAGAGTGAATAGGAGTGGGAGGG + Intronic
1045969637 8:108065021-108065043 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
1046242252 8:111511467-111511489 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1048151668 8:131900901-131900923 CAGAGGGGATAGAAAGGGGAAGG + Intergenic
1048183861 8:132220957-132220979 TGGGGTGGAGAGCAGGGGGAGGG - Intronic
1048818307 8:138355001-138355023 TAGGGTGGGAGGAAGGGGGAGGG - Intronic
1049361062 8:142212819-142212841 GAGAGGGGACAGGAGAGGGAGGG - Intronic
1049433697 8:142576688-142576710 CAGAGTGGACAGAACAGAGATGG + Intergenic
1049464975 8:142746946-142746968 GAGACTGGACAGAAGACGGATGG + Intergenic
1049529498 8:143147306-143147328 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529514 8:143147381-143147403 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049543853 8:143220603-143220625 CAGAGGGGAGAGAAGGGGAAGGG - Intergenic
1050505277 9:6341850-6341872 TAGGGTGGGCTGAAGGTGGAGGG + Intergenic
1050517003 9:6455279-6455301 TGGGGTGGAGAGAGGGGGGAGGG - Intronic
1050583784 9:7088746-7088768 TGGAGTGGACAGATGAGGCATGG - Intergenic
1050956255 9:11665402-11665424 TAGGGTGGCAGGAAGGGGGAGGG - Intergenic
1051126158 9:13808072-13808094 CAAACTGGACAGAAGAGGGATGG + Intergenic
1051169680 9:14307792-14307814 TGGGGTGGAAACAAGGGGGATGG - Intronic
1051452880 9:17216721-17216743 TAGAGTGGAAAGGAGCAGGAGGG - Intronic
1052174469 9:25441667-25441689 AAGAATGGAATGAAGGGGGAAGG + Intergenic
1052944156 9:34154176-34154198 TAGAGTGTGCAGAAGAGGAAAGG - Intergenic
1053383243 9:37666489-37666511 TAAAGTGCACAGAAGGGAGATGG - Intronic
1053557260 9:39150110-39150132 TAGAGAGGTGAGAAGGGGCAAGG + Intronic
1053821369 9:41970378-41970400 TAGAGAGGTGAGAAGGGGCAAGG + Intronic
1054090246 9:60838530-60838552 TAGAGAGGTGAGAAGGGGCAAGG + Intergenic
1054111657 9:61114087-61114109 TAGAGAGGTGAGAAGGGGCAAGG + Intergenic
1054449786 9:65397598-65397620 TAGAGAAGACAGCGGGGGGAGGG + Intergenic
1054609200 9:67217038-67217060 TAGAGAGGTGAGAAGGGGCAAGG - Intergenic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1055212743 9:73817034-73817056 GAAAGTGGAGAGGAGGGGGAAGG + Intergenic
1055498919 9:76884072-76884094 GAGAGAGGAGAGAAGGGAGAGGG - Intronic
1055607166 9:77982796-77982818 TGGAGTGGGGAGAGGGGGGAGGG + Intronic
1055762506 9:79624038-79624060 AAGAGAGGACAGATTGGGGAGGG + Intronic
1058163147 9:101592335-101592357 TAGAAGGGGAAGAAGGGGGAAGG + Exonic
1058597867 9:106635032-106635054 AAGAGGGGAGAGGAGGGGGAAGG + Intergenic
1059454098 9:114388784-114388806 TAGAGTGGAGAGCAGGGGACTGG - Intronic
1059811301 9:117858449-117858471 TAGAGGAGACAGGAGGGGGCAGG - Intergenic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060317175 9:122523184-122523206 TAGAGTGGACAGAGTGGGCCAGG + Intergenic
1060534152 9:124369877-124369899 TACAGTGGGCAGTAGGGGTACGG - Intronic
1060777196 9:126383682-126383704 AAGAGAGAACAGATGGGGGAGGG + Intronic
1061006395 9:127930686-127930708 GAGAGAGGACAGGAGAGGGAAGG - Intronic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1062701203 9:137904676-137904698 TTGAGGGGACAGCAGGAGGAGGG - Intronic
1203390183 Un_KI270438v1:90359-90381 TAGAGTGGAAAGAAATGGAATGG + Intergenic
1203343200 Un_KI270442v1:12723-12745 TAGAATGGACAGAAAAGGAATGG + Intergenic
1203343891 Un_KI270442v1:17825-17847 TAGAGTGGAGAGAAGTGGAATGG + Intergenic
1203346278 Un_KI270442v1:36844-36866 TGGAGTGGACTGAAGTGGAAAGG + Intergenic
1203347619 Un_KI270442v1:46271-46293 TAGAGTGGAGTGAAGGGGAGTGG + Intergenic
1185627294 X:1491938-1491960 TGGAATGGACAGAAGGCGGCAGG + Intronic
1185751106 X:2609871-2609893 TGGAGGGGAAAGAAGGAGGAAGG + Intergenic
1186151549 X:6679889-6679911 TAGAGTGGACAGGATGGTGATGG + Intergenic
1186172411 X:6891441-6891463 GAGAATGGAAAGAAAGGGGAAGG - Intergenic
1186454339 X:9699375-9699397 TAAAGTGGACAGAAGTGGGTAGG + Intronic
1186752921 X:12640325-12640347 TAGTAAGGAGAGAAGGGGGAAGG + Intronic
1187283758 X:17883144-17883166 GAGAGGGGAGAGAAGGGAGAGGG + Intergenic
1187704282 X:21993934-21993956 TACAAGGGAGAGAAGGGGGAGGG - Intronic
1189178702 X:38982899-38982921 GAAAGTGGAGAGTAGGGGGAGGG + Intergenic
1191108293 X:56786031-56786053 GAGAGAGGGCAGAAAGGGGAGGG - Intergenic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1192221615 X:69201068-69201090 GAGAGTGGATTGAAGGAGGACGG - Intergenic
1192316242 X:70053936-70053958 TAGAGTGGAGAGATGGTGGAGGG - Intergenic
1192402834 X:70854306-70854328 TAGAGGTGACAGAAGGTGGAAGG + Intronic
1193165574 X:78276810-78276832 GAAAGTGGACAGATGGAGGATGG + Intronic
1193682339 X:84538033-84538055 TAGGGTGGCGGGAAGGGGGAGGG + Intergenic
1193836339 X:86349181-86349203 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1194859560 X:98980032-98980054 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195732419 X:107980729-107980751 AAGATTGGACAGTAGGGGGGCGG - Intergenic
1195887370 X:109653805-109653827 TGGGGTGGGCGGAAGGGGGAGGG + Intronic
1195898700 X:109774570-109774592 TAGAGTGGTGGGAAGAGGGATGG + Intergenic
1196869138 X:120096339-120096361 TGGAGAGGCCAGAAGGGGGATGG - Intergenic
1197621059 X:128749471-128749493 TAGAGGGGACAGAATGGGGCTGG + Intergenic
1198489860 X:137128387-137128409 TGGGGTGGATGGAAGGGGGAGGG + Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199069778 X:143462613-143462635 TGGAGAGGCCAGAAGGGGGATGG - Intergenic
1199080736 X:143574332-143574354 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1200765172 Y:7074929-7074951 TAAAATGGACAAAAGGGGGTAGG + Intronic
1200907698 Y:8501481-8501503 TGGGGTGGGCAGATGGGGGAGGG - Intergenic
1201098676 Y:10654790-10654812 TAGAGTGGAATGAAATGGGATGG - Intergenic
1201100330 Y:10666843-10666865 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201100966 Y:10672433-10672455 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201103014 Y:10692731-10692753 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201103695 Y:10747758-10747780 TGGAGTGGAAAGGAGGGGAATGG - Intergenic
1201104622 Y:10754309-10754331 TGGAGTGGAGTGAAGTGGGATGG - Intergenic
1201106145 Y:10764851-10764873 TGGAGTGGACTGAAGAGGAATGG - Intergenic
1201106239 Y:10765482-10765504 TAGAGTGGAGTGGAGGGGAATGG - Intergenic
1201109266 Y:10787107-10787129 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201109953 Y:10791979-10792001 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201110260 Y:10793985-10794007 TAGAGTGGAGAGTAGTGGAATGG - Intergenic
1201112147 Y:10807374-10807396 TGGAGTGGACAGGAGTGGAAAGG - Intergenic
1201113641 Y:10819235-10819257 TAGAGTGGATTGAAGTGGAATGG - Intergenic
1201115213 Y:10830183-10830205 TAGAGTGGACTGAAGTGCAATGG - Intergenic
1201120474 Y:10868982-10869004 TAGAGTGGACTGGAGTGGAATGG - Intergenic
1201121269 Y:10875391-10875413 TAGAGTGGAAAGAAATGGAATGG - Intergenic
1201122589 Y:10884556-10884578 TGGAGTGGAGAGAAGTGGAATGG - Intergenic
1201123726 Y:10894040-10894062 TGGAGTGGAGAGAAGTGGAATGG - Intergenic
1201124132 Y:10898502-10898524 TGGACTGGACTGAAGGGGAATGG - Intergenic
1201132106 Y:10960281-10960303 TGGAGTGGACTGAAGTGGAATGG - Intergenic
1201132938 Y:10968523-10968545 TAGAATGGACAGAAGTGGAGTGG - Intergenic
1201134484 Y:10980184-10980206 TAGAGTGGAGTGGAGAGGGATGG - Intergenic
1201136171 Y:10991784-10991806 TGGAGTGGAGAGGAGGGGAATGG - Intergenic
1201136520 Y:10994209-10994231 TGGAGTGGAAAGGAGGGGAATGG - Intergenic
1201136889 Y:10996822-10996844 TGGAGTGGACAGAAGGGTAGTGG - Intergenic
1201138392 Y:11008088-11008110 TGGAGTGGACAGGAGTGGAATGG - Intergenic
1201138441 Y:11008400-11008422 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201138649 Y:11009932-11009954 TAGAGTGGAGAGGAGTGGAATGG - Intergenic
1201139809 Y:11018926-11018948 TAGAGTGGACAGCAGTGGAGTGG - Intergenic
1201140216 Y:11021775-11021797 TAGAGTGGAATGAAAAGGGATGG - Intergenic
1201213457 Y:11701600-11701622 TAGAATGGACAGAAAAGGAAAGG + Intergenic
1201952476 Y:19580647-19580669 TAGGGTGGGGAGAGGGGGGAGGG - Intergenic
1202368493 Y:24182574-24182596 CATACTGGACAGAAGGGGGCAGG + Intergenic
1202594990 Y:26529378-26529400 TAGGGTGGGGAGATGGGGGAGGG - Intergenic