ID: 946226936

View in Genome Browser
Species Human (GRCh38)
Location 2:218269244-218269266
Sequence CGCTGGAGGAGCCCACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946226936_946226946 29 Left 946226936 2:218269244-218269266 CCCACCTGTGGGCTCCTCCAGCG 0: 1
1: 0
2: 1
3: 21
4: 181
Right 946226946 2:218269296-218269318 CCCCCATAACGTTCTGTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946226936 Original CRISPR CGCTGGAGGAGCCCACAGGT GGG (reversed) Intronic
900350300 1:2231205-2231227 GGCTGGAGGAAGCCACATGTCGG + Intronic
900577678 1:3391760-3391782 GGCTGGAGGAGACCACAGTCAGG - Intronic
901303596 1:8217109-8217131 AGAAGGAGGAGCCCCCAGGTGGG + Intergenic
901428990 1:9201018-9201040 GGCTGGAGGAGCTCCCAGGCTGG - Intergenic
901632243 1:10653599-10653621 GGCTGGGGGTGCCCACAGGCAGG + Exonic
904003261 1:27350315-27350337 GGCTGGGGGAGCCCACAGGCAGG + Intronic
904575327 1:31501727-31501749 AGCTGGAGGACCCCACAGCTTGG - Intergenic
905291916 1:36927740-36927762 TGGTGGAGGAGACCAAAGGTCGG + Intronic
906540706 1:46583673-46583695 GGCTGGAGGATGTCACAGGTGGG - Intronic
907400007 1:54219315-54219337 AGCTGGAGGAGCTCTCAGCTAGG + Intronic
907514292 1:54983535-54983557 CACTGGAGGAGCACACACCTAGG - Intronic
915593805 1:156885082-156885104 TGCAGGAGGAGCCCACACGGCGG + Intergenic
915734762 1:158077792-158077814 AGCTGGAGGAGCAGACAGGAGGG - Intronic
920207401 1:204302555-204302577 CACTGGAGGGGACCAGAGGTGGG + Intronic
922036637 1:221854764-221854786 TGCTAGAGGAGCTCAGAGGTAGG + Intergenic
922782030 1:228260143-228260165 CACAGGGGGAGCCCTCAGGTCGG - Intronic
923215777 1:231846301-231846323 CCATGGAGGGGCCCACAGGACGG + Intronic
923464927 1:234239929-234239951 AGCTGTGGGAGCCCACAGGAGGG - Intronic
924408302 1:243775542-243775564 CTTTGGTGGATCCCACAGGTGGG - Intronic
1069012210 10:63386640-63386662 TGCTGCAGGTGCCCACATGTGGG - Intronic
1070892761 10:79954340-79954362 CGCTGTTGGTGACCACAGGTGGG + Intronic
1073543048 10:104327941-104327963 CCCTGGAGGAGCTCACAGTGAGG - Intronic
1075999486 10:126904186-126904208 GGCTGGGAGAGCCCACAGGGAGG - Intergenic
1076355790 10:129852177-129852199 CGCTGGAATAGCCTACAGCTCGG + Intronic
1076865245 10:133163379-133163401 CCCTGGAGGGGCACACAGCTGGG + Intronic
1077042078 11:529312-529334 CACTGGAGGAGCCACCAGGATGG + Intergenic
1078775369 11:14389049-14389071 CTCTGGAGTAGCGCACAGGGAGG - Intergenic
1079002969 11:16773159-16773181 CCTTGGAGAAGCCCACAGGCTGG + Intergenic
1079742402 11:24079315-24079337 AGCTGGAGGATTCCACAGCTGGG - Intergenic
1083074265 11:60020336-60020358 CGCTGCAGGAGCCCACGGTGGGG + Intergenic
1083712984 11:64560111-64560133 CGCAGAAGGGTCCCACAGGTTGG - Intronic
1084659402 11:70538187-70538209 GGCTGCAGGAGCCCCCGGGTGGG - Intronic
1085013311 11:73156458-73156480 GCCTTGAGGAGCCCACAGCTTGG + Intergenic
1085283080 11:75343422-75343444 CCCTGGGGGAGCTCACAGCTGGG + Intronic
1085784799 11:79440076-79440098 CGCTGGAGGAGCCCGCGAGGCGG - Intronic
1086859273 11:91906150-91906172 AGCTGGAGGAGACAACAGCTAGG - Intergenic
1091235701 11:134020786-134020808 CGGTGGAGGAGAGCACAGGGAGG - Intergenic
1092006477 12:5074520-5074542 CAGTGCAGGAGCCCACAGGTGGG - Intergenic
1094012062 12:25820368-25820390 CACTGGAGGAGCCAACACCTGGG - Intergenic
1096411007 12:51377168-51377190 GGCTGGAGGGGCCCAGAGGAGGG - Intronic
1098589233 12:72190253-72190275 CGCTTCATGAGGCCACAGGTGGG - Intronic
1102172576 12:110853339-110853361 GGCTAGAGAAGCCCACAGATGGG - Intronic
1102952748 12:117041155-117041177 GGCTGGAGGAGCCATCAGGGAGG + Intronic
1103252520 12:119512518-119512540 TGCTGCAGGAGTCCACAGGTGGG + Intronic
1104609442 12:130216379-130216401 GCCTGGAGGAGCCCACAGGCAGG + Intergenic
1104649401 12:130520932-130520954 CCCTGAAGAAGCCCAGAGGTGGG + Intronic
1104685455 12:130781774-130781796 AGCTGGAGGGGACCACAGGGTGG - Intergenic
1104920039 12:132285940-132285962 GGCAGGAGGGCCCCACAGGTGGG + Intronic
1104926722 12:132317726-132317748 GGCTGGAGGGGCCCGAAGGTGGG - Intronic
1108117036 13:47140116-47140138 CCCAGAAGAAGCCCACAGGTAGG - Intergenic
1110464644 13:75787336-75787358 TGCTGCAGGAGCCGAAAGGTGGG - Intronic
1112000815 13:95208185-95208207 CCCTCGAGGAGCTCACAGGTGGG + Intronic
1112411998 13:99172728-99172750 CCCAGTAGGAGCCGACAGGTGGG - Intergenic
1112971433 13:105267459-105267481 CGATGGAGGTGCCAAGAGGTTGG - Intergenic
1116325858 14:43533337-43533359 CGCTGCATGAGCCCACAGTGGGG - Intergenic
1119177842 14:72582315-72582337 CCCTGTAGGAGCCCACAAGCAGG - Intergenic
1119856449 14:77904683-77904705 GGCAGGAGGAGCCCACAGGAGGG + Intronic
1122447395 14:101780118-101780140 TGTTGGAGGATACCACAGGTGGG - Intronic
1122745583 14:103895482-103895504 CGCTTAAGGAACCCACAGGACGG - Intergenic
1123924138 15:25091702-25091724 TGCTGGTGGATCCCACAGGTTGG + Intergenic
1124721192 15:32112277-32112299 CACTGCTGGAGCCCACAGTTTGG + Intronic
1125358588 15:38842015-38842037 CTCTGAAGGAGGCCACAGATGGG - Intergenic
1125476886 15:40053814-40053836 CCCTGGAGGAGCTCACAGGCTGG - Intergenic
1131744656 15:95434158-95434180 GACTGGAAGAGCCCACAGATAGG + Intergenic
1132555004 16:568482-568504 CGCGGGAGGAACCCTCAGGATGG + Exonic
1132951899 16:2567533-2567555 AGCTGGAGGAGAGCACAGCTGGG + Intronic
1132962451 16:2632637-2632659 AGCTGGAGGAGAGCACAGCTGGG - Intergenic
1134063360 16:11211941-11211963 GGCTGGGGGAGCCCACCGGAGGG + Intergenic
1136399327 16:30009347-30009369 CCCTGGAGGAGCCCAGAAGGAGG + Intronic
1138553995 16:57761778-57761800 ACCTGGTGTAGCCCACAGGTAGG + Intronic
1140070995 16:71649470-71649492 CGCTGAAACAGCCCAGAGGTGGG + Exonic
1141946230 16:87311562-87311584 CCCTGGCGGAGCACACAGGTTGG + Intronic
1144052458 17:11508616-11508638 CCTTGGGGGTGCCCACAGGTGGG + Intronic
1144621660 17:16822297-16822319 CTCTGGGGGAGCCTACAGGCTGG - Intergenic
1144884759 17:18450417-18450439 CTCTGGGGGAGCCTACAGGCTGG + Intergenic
1144944029 17:18960697-18960719 CTCTTGAGGGGCCCACAGATTGG - Intronic
1145060782 17:19731889-19731911 TGCTGGAGGAACCCATAGGTGGG + Intergenic
1145147466 17:20493960-20493982 CTCTGGGGGAGCCTACAGGCTGG - Intergenic
1145290606 17:21542673-21542695 AGCAGGAGGTGGCCACAGGTAGG - Intronic
1147184937 17:38707910-38707932 CGTTGGAGGAACCCATAGATGGG - Intronic
1147333858 17:39715342-39715364 CTCTGGAAGAGATCACAGGTGGG + Exonic
1147557686 17:41489750-41489772 CCCTGCAGGAGCCCACAGAACGG + Exonic
1149560345 17:57604010-57604032 CTTTGGGGGAGCCCCCAGGTGGG + Intronic
1150443990 17:65214456-65214478 AGCTGGAGGAACCCAGAGGTGGG + Intronic
1151990249 17:77570114-77570136 CCCTCGTGGTGCCCACAGGTGGG - Intergenic
1152465518 17:80464160-80464182 TGCTCCAGGAGCCCACAGCTGGG + Intergenic
1152514103 17:80812058-80812080 ACCTGGAGGAGGCCCCAGGTAGG - Intronic
1154345780 18:13542579-13542601 CCCTGGAGGAGCCCACGGTAGGG - Intronic
1154353118 18:13603696-13603718 TGCTGCAGGAGCACACAGGAGGG - Intronic
1155235696 18:23816812-23816834 AGCAGGAGGAGCCCACAGATAGG + Intronic
1155310563 18:24518799-24518821 CGCTGGAGGAGGCCCCAAGACGG - Intergenic
1157766029 18:50298332-50298354 CGCTCCAGGAGCTCACAGTTGGG + Intergenic
1160221589 18:76981821-76981843 CTCTGGAGTAGCCCAGAAGTTGG + Intronic
1160450743 18:78964889-78964911 CGCTGGTGCAGCCTGCAGGTCGG - Intergenic
1162398317 19:10430687-10430709 CGCTGGAGCCGCCCCCAGGGCGG - Intronic
1162919052 19:13889709-13889731 CGCTGATGGAGGCCACAGGAGGG - Exonic
1164239648 19:23373737-23373759 TGGTGGATGAACCCACAGGTAGG - Exonic
1164632183 19:29769040-29769062 AGCTGGAGGAGGCCACAGGATGG - Intergenic
1165154601 19:33779369-33779391 CGCTGGACGTGCCGACAGCTGGG - Intergenic
1165520598 19:36311227-36311249 GCCTGGAGGTGCCCACAGGAGGG + Intergenic
1165623473 19:37267357-37267379 GCCTGGAGGTGCCCACAGGAGGG - Intergenic
1165709839 19:38003249-38003271 CCCTGGTGGAGCCCACAGCCAGG + Intronic
1165821840 19:38681692-38681714 CCCTGGAGGAGTGCACAGCTCGG - Intronic
1165828474 19:38718978-38719000 GGTGGGAGGAGCTCACAGGTGGG - Intronic
1165859021 19:38897423-38897445 CCCTGGAGGAATCCACAGGCTGG - Intronic
1166339320 19:42128142-42128164 CTCCTGAGGAGCCCACAGTTGGG - Intronic
1166746124 19:45142639-45142661 GGCTGGTGGAGCCCAGAGGCGGG + Intronic
1168231166 19:55032460-55032482 CGCTGGCGGATCCCGCAGGAGGG + Intronic
1168354925 19:55695013-55695035 CTCTGGTGGAACCCACAGGAAGG - Intronic
926359326 2:12070789-12070811 TGCTTGAGGAGCCCAGAGATGGG + Intergenic
926689044 2:15720162-15720184 CGCTGGAGAAGCCCTCTGGTTGG + Intronic
927107762 2:19842462-19842484 CTCTGGAGCAGCTTACAGGTGGG + Intergenic
930191323 2:48463164-48463186 GGCTGGAGGAGCCCTCATGTTGG + Intronic
931705442 2:64942905-64942927 GGCTGCAGGAGCCCACAGGAGGG - Intergenic
935158923 2:100512125-100512147 GGATGGAGGAGCCCAGAGCTGGG - Intergenic
935175173 2:100642788-100642810 GGCAGGAGGAGCCAACCGGTAGG + Intergenic
936278474 2:111119739-111119761 CGCGGGAGGAGCAGACAGGAGGG + Intronic
937237382 2:120438874-120438896 GGCTGGAGGGGCCCCCAGGAAGG - Intergenic
938262762 2:129907051-129907073 CGCAGGAGGGGCCCGCAGGCTGG + Intergenic
944395699 2:199263618-199263640 AGCTGGAGTTGCCAACAGGTGGG + Intergenic
946226936 2:218269244-218269266 CGCTGGAGGAGCCCACAGGTGGG - Intronic
948110978 2:235455720-235455742 CAGTGGAGCAGCCCAGAGGTTGG + Intergenic
948439406 2:237977115-237977137 AGCTGGAGGGGCGCCCAGGTTGG - Intronic
948484365 2:238271184-238271206 AGCTGGCGGCCCCCACAGGTGGG + Intronic
948569688 2:238909926-238909948 CGCTGGTGGAGGGCAGAGGTGGG - Exonic
1169041242 20:2497348-2497370 CTCTGGAGGACTCCACAGTTAGG + Intronic
1172359515 20:34302697-34302719 GGGTGGGGGACCCCACAGGTTGG + Intronic
1172993906 20:39055878-39055900 CCCTGGTGGAGCCCCCAGGCTGG + Intergenic
1174524167 20:51158042-51158064 TACTGGAGCAGCCCACGGGTAGG - Intergenic
1175214549 20:57384820-57384842 CACCGAAGGGGCCCACAGGTTGG - Intergenic
1175529457 20:59664432-59664454 CCCTGGAGGAGCCTCCAGGAGGG - Intronic
1178351367 21:31874445-31874467 AGCTGCCGGAGCCCACAGGTGGG - Intronic
1180043943 21:45294204-45294226 GGCTGGAGGAGCCCAGGTGTGGG - Intergenic
1180228417 21:46412061-46412083 CGCGGGGGGAGCCCACCTGTGGG - Exonic
1181698004 22:24603510-24603532 TGCAGAAGGATCCCACAGGTGGG + Exonic
1181715398 22:24723588-24723610 GGCTGGAGGAGCCAGCTGGTGGG - Intronic
1182357891 22:29730446-29730468 CCCTGGAGGAGCCCCCTGGCTGG - Exonic
1183218364 22:36495922-36495944 GGTCTGAGGAGCCCACAGGTTGG + Intronic
1183689067 22:39377950-39377972 GGCTCCAGGAGCCCACAGGCTGG + Intronic
1184252382 22:43268122-43268144 CTCTGGAAGAGCTCACAGGCTGG - Intronic
1185027641 22:48424820-48424842 CCCTGGAGGAGCCCACCAGGAGG + Intergenic
950306090 3:11916054-11916076 GGCGGGAGGGGACCACAGGTGGG - Intergenic
950363448 3:12466240-12466262 CCCTGGAGGGACCCACAGTTGGG - Intergenic
954763877 3:52897213-52897235 CGCAGGAGGGGCCCCCAGGGGGG + Intronic
955070425 3:55568242-55568264 GGCACGAGGAGCCCACGGGTTGG + Intronic
955754655 3:62215462-62215484 CTGTGGAGGAGCTCTCAGGTTGG - Intronic
956486783 3:69731554-69731576 CCCTGTAGGAGCTCACAGTTTGG + Intergenic
961219422 3:125187892-125187914 CACTGGAGGAGCCCAGAGAAAGG - Intronic
967261520 3:187647498-187647520 CACTGGAGAAGGCCAGAGGTGGG - Intergenic
972872730 4:43320334-43320356 CTCTGCAGGAGCCCACATTTGGG - Intergenic
973653849 4:53025028-53025050 CCGTGGAGATGCCCACAGGTTGG - Intronic
976608613 4:87006773-87006795 CTCTCGAGGAGCCCGCAGGCGGG + Intronic
986494828 5:8331777-8331799 AGCTGCAGGTGCCCACAGGGCGG - Intergenic
986772859 5:10989239-10989261 AGCTGCAGGTGCCCACAGGGTGG - Intronic
992110333 5:73486758-73486780 CACTGGAGAAGCTCACAGCTGGG - Intergenic
995546919 5:113241881-113241903 AGCTGGATTAGCCAACAGGTGGG - Intronic
996567254 5:124892724-124892746 CCGGGGAGGAGCCCACCGGTGGG - Intergenic
996918463 5:128738038-128738060 AGCTGCAGAAGCCCTCAGGTAGG - Intronic
1000302246 5:159966624-159966646 GGCTGAAAGAGCCCAGAGGTGGG + Intronic
1000609175 5:163356098-163356120 CTGCGCAGGAGCCCACAGGTTGG - Intergenic
1001476572 5:172054880-172054902 CCCTCGAGGAGCCCCCAGGCTGG + Intronic
1002595237 5:180317882-180317904 CTCTGGAGGTACCCACAGGCAGG + Intronic
1002924059 6:1594754-1594776 CTCTGGAGGAGCCCCCAGCCTGG + Intergenic
1005832339 6:29680915-29680937 CCCCGGAGGACCCCAGAGGTTGG + Intronic
1007348647 6:41251998-41252020 AGCTGGAGGAGCCCACAGTTGGG + Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1015841365 6:137480642-137480664 TGCTGGGGGAGCACACAGGATGG + Intergenic
1019392171 7:794742-794764 GGCAGGAGGAGCCCAGAGGGTGG + Intergenic
1020142955 7:5622462-5622484 CCCTGGAGGGGCCCACGGTTGGG - Intronic
1022861982 7:34376933-34376955 AGCTGGAGTAGCCCAGATGTAGG - Intergenic
1024301927 7:47893460-47893482 CCCTGGCTGAGCCCACAGGCGGG + Intronic
1024474164 7:49792741-49792763 GGCTGGAGGAGGCCAGATGTTGG + Intronic
1028392714 7:90334699-90334721 CTGCGCAGGAGCCCACAGGTGGG - Intergenic
1028940827 7:96520606-96520628 GGCTGGAAGGGCCAACAGGTAGG + Intronic
1029043782 7:97605037-97605059 ACCCGGAGGAGTCCACAGGTAGG + Intergenic
1029550492 7:101234774-101234796 GGCTGGAGGAGCCCAGGGGAAGG - Intronic
1031893264 7:127320014-127320036 AGCTGGAGAAGTCCAGAGGTTGG - Intergenic
1032482443 7:132257638-132257660 AGCAGCAGGAGCCCACAGGTGGG + Intronic
1034553920 7:151837987-151838009 CCCTGGAGGAGGCCACACCTGGG + Intronic
1034948696 7:155281748-155281770 ATTTGGAGCAGCCCACAGGTAGG + Intergenic
1036037913 8:5040560-5040582 GGCTGGAGGAGCCCAGTGGGAGG - Intergenic
1036574270 8:10011234-10011256 GGCTGGAGGAGCCCAAAGTCAGG + Intergenic
1040954037 8:52961651-52961673 CCCTGCAGGAGCCCACAGCAGGG - Intergenic
1041588426 8:59547408-59547430 AGCCGCAGGAGCCCACAGGGTGG - Intergenic
1041967149 8:63691779-63691801 CCCTGGAGCAGTCCACAGGAAGG - Intergenic
1045634796 8:104172231-104172253 AGCTGGAGGAGCTCTCAGTTAGG + Intronic
1045856337 8:106769636-106769658 AGCAGGAGGAGCCCACATGGAGG - Exonic
1046277401 8:111981940-111981962 CTCTAGAGGAGCACACAGATGGG + Intergenic
1049164161 8:141116396-141116418 CGCAGAAAGAGGCCACAGGTCGG - Intergenic
1049474602 8:142790844-142790866 GGCTGGTGGTGCCCACAGGCGGG + Intergenic
1049571553 8:143372372-143372394 GGCTGGAGAGGCCCACAGGTGGG - Intronic
1051607905 9:18934647-18934669 CTCTGCAGGAGCCCAGATGTTGG - Intronic
1052300237 9:26945750-26945772 AGCTGGAGGAGCAAACAGGAGGG - Intronic
1053478796 9:38400966-38400988 CCCTGCAGGAGCTCACAGTTGGG + Intergenic
1056305803 9:85289333-85289355 CCATGCAGGAGCCCACGGGTGGG - Intergenic
1057129950 9:92648023-92648045 AGCTAGAGTAGCCCACAGCTGGG + Intronic
1058176217 9:101738518-101738540 CGCTGGGGGAGCCTGCAGGAGGG - Exonic
1058884262 9:109311489-109311511 CACCGGATGATCCCACAGGTGGG + Intronic
1060555013 9:124503630-124503652 CGCGGGAGGAGCCCCCCGGACGG - Intronic
1060556051 9:124507646-124507668 CGCTGTGGGAGCCCAGAGGCAGG + Intergenic
1062105844 9:134754370-134754392 CGCTGGAGGAGCCCAAATCTGGG + Intronic
1062195179 9:135269061-135269083 CCTTGGAGGAGCCCGCTGGTCGG - Intergenic
1190360250 X:49642518-49642540 CGATGGAGGAGTCCACAGAAAGG + Intergenic
1191736637 X:64394896-64394918 GGCTGGAGGAGCCAAGAGGATGG + Intronic