ID: 946227027

View in Genome Browser
Species Human (GRCh38)
Location 2:218269658-218269680
Sequence CCGCGCGCCCCCGCGGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 293}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946227027_946227043 28 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227043 2:218269709-218269731 AGAGACCGTGCGGTAAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 185
946227027_946227040 24 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227040 2:218269705-218269727 GGCCAGAGACCGTGCGGTAAGGG 0: 1
1: 0
2: 0
3: 4
4: 48
946227027_946227033 -10 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227033 2:218269671-218269693 GGGCGCGCGGGACACAGGACGGG 0: 1
1: 0
2: 1
3: 5
4: 151
946227027_946227035 -1 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227035 2:218269680-218269702 GGACACAGGACGGGAGGCCACGG 0: 1
1: 0
2: 4
3: 37
4: 415
946227027_946227038 18 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227038 2:218269699-218269721 ACGGCTGGCCAGAGACCGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 96
946227027_946227039 23 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227039 2:218269704-218269726 TGGCCAGAGACCGTGCGGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 52
946227027_946227042 27 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227042 2:218269708-218269730 CAGAGACCGTGCGGTAAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 83
946227027_946227034 -7 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227034 2:218269674-218269696 CGCGCGGGACACAGGACGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 69
946227027_946227036 3 Left 946227027 2:218269658-218269680 CCGGGGTCCGCGGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 47
4: 293
Right 946227036 2:218269684-218269706 ACAGGACGGGAGGCCACGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946227027 Original CRISPR CCGCGCGCCCCCGCGGACCC CGG (reversed) Intronic
900313700 1:2047043-2047065 CCACCCGCCCCGGAGGACCCAGG + Intergenic
900799440 1:4728276-4728298 CCCTGGGCCCCAGCGGACCCTGG + Intronic
901489443 1:9589137-9589159 CCGCGCGCCCGCGGGCAGCCCGG - Intronic
901577252 1:10210812-10210834 CCCCGCGCCCCCGCGCGCCGCGG + Exonic
902385524 1:16073472-16073494 CCCCGCGGCCCCACGCACCCCGG - Exonic
903349741 1:22710688-22710710 CCGCGCGCCGCCGCGAGCCCGGG - Intergenic
903420848 1:23217191-23217213 CCCCGGGCCCCCGAGGCCCCAGG + Intergenic
903925201 1:26826853-26826875 CGGCGCGCCCCCGGGGAGGCGGG - Exonic
903928450 1:26848630-26848652 CCGGCCACCCCCTCGGACCCGGG + Exonic
905037980 1:34929781-34929803 CCCCGCCCCCGCGCGGACCCAGG + Intergenic
905044421 1:34984907-34984929 CCTCCCACCCCCCCGGACCCTGG - Intronic
905414389 1:37794402-37794424 CCGCCCCGCACCGCGGACCCTGG + Exonic
905548575 1:38818391-38818413 CGCCGCGCAGCCGCGGACCCGGG - Intergenic
906640574 1:47438430-47438452 CCGCGGGCCGCCGCGGCGCCTGG - Exonic
907278001 1:53327606-53327628 CCCCCCGCCCCCGCGGGCCTCGG - Intronic
907540880 1:55214901-55214923 CCGCGGGCCCCCGCCGGGCCCGG + Exonic
909548040 1:76868684-76868706 CCGCGGTCCCGCGGGGACCCCGG - Exonic
910145680 1:84077920-84077942 CCGCCCGCCCCCGGGGTCCCGGG + Intergenic
912492620 1:110070472-110070494 CCGCGCCGCCCCGCGGCCCGCGG - Exonic
914753142 1:150549299-150549321 CCGCGCCCCTCGGCGGCCCCGGG - Intergenic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
915543958 1:156585373-156585395 CCTCGCGCCACCCCTGACCCTGG + Intronic
917974255 1:180229403-180229425 GCGCGCGTCCCCGCAGACCGCGG - Intergenic
921177374 1:212607067-212607089 CTTTGCGCCCCGGCGGACCCGGG - Intronic
922307581 1:224357296-224357318 CCGCTCGTCCCCGCGGCGCCCGG + Intronic
923007920 1:230067082-230067104 CCGCGCGGCGCCGCCGGCCCGGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
1062843805 10:689765-689787 TCGCGCGCCCCCGCGCCCCACGG + Intergenic
1063664050 10:8051349-8051371 CCGCACGCCGCCCCGGGCCCCGG + Intergenic
1063930015 10:11018606-11018628 CCGCCCGCCCCACCGGACCCCGG - Intronic
1069761679 10:70815865-70815887 CCGCGCGCACGCCCAGACCCGGG - Intergenic
1072591680 10:96832899-96832921 CCGCGCGTGCACGCAGACCCGGG - Intronic
1075999985 10:126906160-126906182 CCGAGCGCCCCAGTGGCCCCAGG + Intronic
1076209322 10:128627772-128627794 CAGCGTGCCCCTGCTGACCCTGG - Intergenic
1076372308 10:129963605-129963627 CCGGCCGCCCCCGCGCGCCCTGG - Intronic
1076402026 10:130190770-130190792 CCCCTCGTCCCCGGGGACCCGGG + Intergenic
1076724192 10:132405685-132405707 CCTCGCGTCCCTGTGGACCCTGG - Exonic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1077124503 11:926288-926310 CCGCCCGCACCCCCAGACCCTGG - Intronic
1077544902 11:3165057-3165079 CGCCGCAGCCCCGCGGACCCTGG - Intronic
1079361997 11:19777273-19777295 CCGCGCGCAGCAGCGGCCCCGGG + Intronic
1081528520 11:43942875-43942897 CCGCCCGGCCCCGCAGACGCCGG + Exonic
1081636883 11:44727326-44727348 CGCCGCGCCCCCGGGGACCTGGG + Intronic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083670942 11:64299674-64299696 CCGTGCGGCCCCGCGGCCCCGGG + Exonic
1084028485 11:66467159-66467181 CCGCGCGTCCCTGCGGTCGCGGG + Intronic
1084151286 11:67289111-67289133 CAGGCCGCCCCAGCGGACCCGGG + Intronic
1084567539 11:69939967-69939989 CCACGCGCTGCCTCGGACCCTGG - Intergenic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1084973123 11:72781943-72781965 GCGCCCGCCCCCGCCGGCCCTGG + Intronic
1085596965 11:77820008-77820030 CCGCTGGCCCCCGCCCACCCAGG + Intronic
1087138117 11:94740513-94740535 CCGCGCGCCCTCGGGCCCCCGGG + Intronic
1088495801 11:110430240-110430262 CCGCGCTCCCGCCCGGCCCCCGG - Exonic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1089527584 11:119107432-119107454 GCGCGGGCCCCGCCGGACCCTGG - Exonic
1090799084 11:130159671-130159693 CTGCCCGCCCCCGCCGGCCCTGG - Exonic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1094855526 12:34401180-34401202 GCGCGGGGCCCAGCGGACCCGGG + Intergenic
1095476260 12:42589863-42589885 GCGCGCGCCCACGCGTACCCCGG + Intronic
1096430373 12:51538165-51538187 CAGCAGGCCCCCGCGCACCCAGG - Intergenic
1096459384 12:51814041-51814063 GCGCGCGCCCCCGGGGGCCTGGG - Intergenic
1097439920 12:59596481-59596503 CCGCGCGCCCCCTCAGTTCCCGG - Intronic
1100869349 12:98894655-98894677 CCGCCAGCCCTCGCGGATCCCGG - Intronic
1101254714 12:102965749-102965771 CCCTGCTCCCCCGCGGGCCCGGG + Intergenic
1102197141 12:111033934-111033956 CCGTGCGCCCCCCCGACCCCCGG - Intergenic
1102457181 12:113077983-113078005 CGGGGCGCCCCCACGGAGCCCGG + Exonic
1102521272 12:113478732-113478754 GCGCCCACCGCCGCGGACCCCGG + Intergenic
1103364006 12:120369315-120369337 CCGCGCTCGCCCGCGAGCCCGGG + Intergenic
1104049446 12:125186154-125186176 CCGCGAGCGCCCGCGACCCCCGG + Intergenic
1104882772 12:132084140-132084162 GCGCGCGCCGGCGCGGACCGAGG + Intergenic
1104941230 12:132396341-132396363 CCCCACCCCTCCGCGGACCCTGG + Intergenic
1105031481 12:132887401-132887423 CCGCCCCACCCCGCGGGCCCCGG + Intronic
1105557247 13:21459018-21459040 CCGCGCCCCGCCGCAGTCCCCGG + Intronic
1105578650 13:21674502-21674524 CCGCGCTCCCGCGCACACCCCGG - Intronic
1106109069 13:26760884-26760906 CCGCGCGCCCCCACGGGTCAGGG + Intergenic
1106328675 13:28718805-28718827 CCCCGCGGCCCTGCGGACCTCGG + Exonic
1108648880 13:52455927-52455949 CCCCGCCCCCAAGCGGACCCAGG - Intronic
1112291033 13:98143787-98143809 CCGCTCGCCTCCCCCGACCCCGG + Intronic
1112494826 13:99896239-99896261 CCCCGTGTCCCCGCGGAGCCCGG + Exonic
1113379051 13:109786460-109786482 CCGAGCGCCCGGGCGCACCCCGG - Exonic
1113874409 13:113585180-113585202 CTGCGCGCTCCGGCCGACCCTGG - Intronic
1114219270 14:20682658-20682680 CCCCCCGCCCCCGCGGTCCGTGG + Intergenic
1114473778 14:22980864-22980886 CCGCGCCCCCACCCGGGCCCAGG - Intronic
1115752930 14:36508407-36508429 CCCCGCGTCTCCGCGTACCCAGG - Intronic
1115852662 14:37599856-37599878 GCGCGCGGCCGCGGGGACCCAGG - Intronic
1119046350 14:71321198-71321220 CCCCGCTCCCCCCAGGACCCGGG - Intronic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1119487717 14:75002740-75002762 CCGCGCGCCCCCGCGCCTCGGGG - Intergenic
1119742951 14:77026217-77026239 CAGCGCACCCCCGGGGACCGGGG - Exonic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122220805 14:100238439-100238461 CCGCGCGGCCCCGGGCACCACGG - Intronic
1122399740 14:101459388-101459410 CCGCCCACCCCCTCGGACCCCGG + Intergenic
1123021224 14:105398764-105398786 CCCCGTCCCTCCGCGGACCCCGG + Intronic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1123047586 14:105526480-105526502 CCGCGAGCCCCGCCGGACCTGGG - Intergenic
1125674259 15:41494088-41494110 CCGCTTGGCCCCGCGGGCCCGGG - Exonic
1126150923 15:45522892-45522914 CCGCGCGCCCCCGCCCATCGCGG - Intergenic
1127763598 15:62164512-62164534 CCGGCCACCCCCGCGGCCCCCGG - Exonic
1127988810 15:64096080-64096102 CCGGCCGCCCCCTCGGACTCCGG - Exonic
1128304423 15:66588699-66588721 CTGCGCCCCCAAGCGGACCCTGG - Intronic
1130296133 15:82647963-82647985 CCGCGCGCAGCCCCGCACCCCGG + Intronic
1130348120 15:83067294-83067316 GCGCGCGCCCCCGCACGCCCGGG + Exonic
1131560179 15:93432702-93432724 CGGCGCGACCCTGCGGAGCCGGG + Intergenic
1131969270 15:97875750-97875772 CCGCGCGCAGCCGCGGCTCCCGG - Intergenic
1132056119 15:98650687-98650709 CCCCGCGCCGCCGCAGACCCTGG - Intronic
1132683292 16:1152619-1152641 CCCCGCCCCTCCGCCGACCCGGG + Intergenic
1132741184 16:1414273-1414295 CCAAGCGCCACCCCGGACCCTGG + Intronic
1132778868 16:1612314-1612336 CCCCGCGCGCCCGCGCACCCCGG + Exonic
1133031636 16:3013931-3013953 TCGAGCGGCCCCGCGGACCTCGG + Exonic
1133771479 16:8869104-8869126 CCGCCCGCCCCCACCGTCCCGGG - Intergenic
1135942700 16:26836318-26836340 CCGGCCAGCCCCGCGGACCCCGG - Intergenic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136505151 16:30698440-30698462 GCGCACGCCCCCGAGGACGCAGG + Intronic
1137285704 16:47014227-47014249 CCACGCGCCGCCGCTGGCCCAGG + Intergenic
1137618156 16:49858725-49858747 CCCCACGCCCCCGCGGCCCAGGG + Intergenic
1137787829 16:51152136-51152158 CTCCGCGCCCCCGCGAGCCCGGG - Intergenic
1139472132 16:67184022-67184044 CGGCGCGCCCCCGAGGCCACTGG + Exonic
1139496930 16:67326761-67326783 GCGCGCGCCGCCGCGACCCCGGG - Exonic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1140221666 16:73048334-73048356 CCGCCCGCCCGCAGGGACCCGGG + Exonic
1141430617 16:83968787-83968809 CCCGCCGCCCCCGCGGACCCCGG + Exonic
1142335915 16:89489879-89489901 CCGCGGGCCCCCGGCCACCCAGG + Intronic
1142376800 16:89710802-89710824 CAGCGCAGCCCCGCGGCCCCAGG - Exonic
1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG + Exonic
1142752875 17:1998756-1998778 CCTCGCGCGCACGGGGACCCCGG + Intronic
1143026619 17:3945025-3945047 CCGCCCGCCCGCGCGTCCCCTGG + Intronic
1143063359 17:4222216-4222238 CCCCGCCGCCCCGCGGACCCCGG + Intronic
1143111407 17:4555000-4555022 GTGCACGCCCCCGCGCACCCTGG + Intronic
1143166366 17:4899162-4899184 CCGCGCGGCCCCCCGGGCCAGGG + Intronic
1146052831 17:29566870-29566892 CGGCGCGCCCCCAGGGTCCCCGG + Exonic
1147150449 17:38510889-38510911 CCGCCCGCGCCCGGGGACACGGG + Exonic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1149833662 17:59893333-59893355 CCTCGGGCCCCCGGGGACCCCGG - Intronic
1149993744 17:61396538-61396560 CCGGGCTCCCCCGCGGTCCCAGG - Intergenic
1150904965 17:69327284-69327306 CCGCGCGTCCCGGCGCACGCAGG + Intergenic
1152345604 17:79748663-79748685 CCTCGCGCACCCGCGGAGCCGGG + Intergenic
1152683927 17:81684355-81684377 CCTCGCTCCTCCGCGGGCCCGGG + Intronic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1153911339 18:9708580-9708602 CCGCGCGCCCCCTGGTTCCCCGG + Intronic
1153935141 18:9914356-9914378 CCGCGCGCCCCACCCCACCCGGG - Intronic
1154151242 18:11908348-11908370 CCGCGCGCTACCGCGGAAACAGG - Exonic
1155055256 18:22176877-22176899 CCGCGTCACCCCGGGGACCCCGG - Intronic
1156171746 18:34493999-34494021 CTGCGCGGCCCCGCGCCCCCGGG - Intronic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157610142 18:48950716-48950738 CGGCGCGCCCCGGAGGAACCCGG + Intergenic
1158579731 18:58671292-58671314 TCGCCCTCCCCCGCGGTCCCGGG - Intergenic
1158643180 18:59220313-59220335 CCGCTCGCCCCCGGGGCGCCAGG - Exonic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160719191 19:590067-590089 CCGCGCCCCCCCCGGGCCCCGGG + Exonic
1160809522 19:1007412-1007434 CCCCCCGCCCCAGGGGACCCTGG + Intronic
1160842774 19:1154015-1154037 CCACCCGCCCCCGTGGGCCCTGG - Intronic
1160864375 19:1250551-1250573 CCGGCCGCCCCCTCGGGCCCCGG + Intronic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161022126 19:2015507-2015529 CCGCCCGCCCCGCCGGGCCCCGG - Exonic
1161101818 19:2425277-2425299 CCCCGCACCACCGCGGCCCCGGG - Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161495622 19:4584380-4584402 CCCCGGGCCTCCTCGGACCCGGG - Intergenic
1162398644 19:10432004-10432026 CCGTGCGCCCCCGGGGAAACGGG - Intronic
1162572413 19:11480876-11480898 CTGCGCGGCCCCGCGGGGCCCGG + Exonic
1162951315 19:14073456-14073478 CCCCGCGCTCCCGCGCGCCCTGG + Exonic
1163026831 19:14517754-14517776 AGGCGCCGCCCCGCGGACCCCGG + Intronic
1163427090 19:17245733-17245755 CCGCGGGCGCCGGGGGACCCAGG - Exonic
1163441612 19:17324836-17324858 CCGCCCGCCCCGTTGGACCCAGG + Exonic
1163715183 19:18869127-18869149 CCGCGCGCACTGGCGGCCCCAGG + Exonic
1164995773 19:32719883-32719905 CCAGGAGCCCTCGCGGACCCCGG - Intronic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1167262971 19:48469436-48469458 CCGCGGGCCAACGCGGATCCAGG + Exonic
1167385000 19:49157903-49157925 CTCCGCGCTCCCGCAGACCCTGG - Intronic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1168307219 19:55442324-55442346 GCCCTCGCCCCCGCGGCCCCCGG + Exonic
925785933 2:7431394-7431416 CTGCGCGGCCCCACGGAGCCCGG - Intergenic
926077377 2:9951935-9951957 CCGCCCGCCCGCGCGGCCTCGGG - Intronic
926090116 2:10043943-10043965 CTCCTCGCCCCCGCCGACCCGGG - Intronic
927357071 2:22186441-22186463 CCGCGGGCCCCGCCGGCCCCGGG + Intergenic
927472102 2:23384894-23384916 CCGGGCGCGGCCGCGGAGCCAGG + Intergenic
927851595 2:26503330-26503352 CCGCGCCCTCCAGCGGCCCCAGG + Intronic
930046263 2:47175878-47175900 CCGCCCGCCCGCGCGCCCCCTGG + Intronic
930096462 2:47570347-47570369 CCGAGCGCCGCCCCGGCCCCGGG - Exonic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
932771526 2:74503217-74503239 CCCCACGCCCACCCGGACCCCGG - Intronic
933772756 2:85754467-85754489 CCGAGAGCCCCCGCGCTCCCCGG - Exonic
935196734 2:100820544-100820566 CTGCGCGGCACCGGGGACCCCGG + Intronic
935815524 2:106843185-106843207 CCGCGCGCGCGTGCGGACGCTGG - Exonic
937950910 2:127387575-127387597 TCGCGCGCCCCTCCGGTCCCCGG - Intronic
938406329 2:131035113-131035135 CGGCGCGGCCCCGCGGCGCCCGG + Intronic
942314056 2:174682456-174682478 CCGCTGGACTCCGCGGACCCGGG - Intronic
942451086 2:176108168-176108190 CCCCCCTCCCCCGCGGCCCCCGG - Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946412638 2:219522737-219522759 CCGCCCGCCCCCGCGGCGGCCGG - Intronic
947641639 2:231710470-231710492 CCGCTCCGCTCCGCGGACCCCGG - Intronic
948945699 2:241217976-241217998 CTGCGCGCCCCCGCTGCCCCCGG - Intronic
1168757151 20:325699-325721 CGGCGCGCCCCCGCCGCCTCCGG - Exonic
1169278434 20:4248722-4248744 CCGCCCGCGCCCGCGCTCCCCGG + Exonic
1169336407 20:4760725-4760747 CCGCGCGCCCCCTCGTGGCCCGG - Intergenic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1172274991 20:33674476-33674498 CGCCCCGCCCCCGCGGACGCCGG + Intergenic
1174128464 20:48325797-48325819 CCCCGTGCACCCACGGACCCTGG + Intergenic
1174204477 20:48828486-48828508 ACGCGCGCCTCCGCGGCCCCGGG + Intergenic
1174467766 20:50731008-50731030 GCGCGAGCCCCGGCGGAGCCGGG + Intergenic
1174611280 20:51800776-51800798 CAGCGCGCACCCGAGGTCCCAGG - Intronic
1174846285 20:53946266-53946288 CCGCTCCCCACCGCAGACCCTGG + Intronic
1175394736 20:58650498-58650520 CCCCGCGCCCCCCCGTGCCCCGG - Intergenic
1175859621 20:62143363-62143385 CCGCGCGCACCCGCGACTCCCGG + Exonic
1176101280 20:63365668-63365690 CCTCGCCCTCCCGTGGACCCGGG + Intronic
1176232351 20:64038875-64038897 CCGCGCTCCCCGGAGGGCCCAGG + Intronic
1176414746 21:6467867-6467889 CCACCCCCACCCGCGGACCCCGG + Intergenic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176550192 21:8217423-8217445 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1176569120 21:8400461-8400483 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1176577034 21:8444693-8444715 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1177011044 21:15730327-15730349 CCTCGCGCCTCCGCCGGCCCTGG - Exonic
1178487451 21:33027871-33027893 CCTCGCTTCCCCGCGGCCCCTGG - Exonic
1179466826 21:41581431-41581453 CCGCCCGCCGCCCAGGACCCAGG + Intergenic
1179511944 21:41879173-41879195 CCGCGAGCCCCGGCGCGCCCTGG - Intronic
1179690246 21:43076189-43076211 CCACCCCCACCCGCGGACCCCGG + Intronic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1181006626 22:20016644-20016666 CCCCGCGCGCCAACGGACCCGGG - Exonic
1181652968 22:24271062-24271084 CCGGGCGTCCCCGCAGACCCCGG + Intronic
1181965969 22:26657138-26657160 CTGCGCGCGACCGCGGACCAGGG - Intergenic
1183537736 22:38412991-38413013 CCGCGGGCCCCTGCGGGCCCCGG - Intergenic
1184101463 22:42343643-42343665 CCGCGCGCCCCGGCCGGCCCGGG + Intergenic
1184697955 22:46150369-46150391 CCGCGCGCCCTCCGGGCCCCGGG - Intergenic
1184698057 22:46150648-46150670 CCGCCCGCCCCCGGGCACCTGGG - Intronic
1185259640 22:49854165-49854187 ACCCGCCCCCGCGCGGACCCCGG + Intronic
1185343059 22:50300074-50300096 CCGCGCCCTCCCGGGGACTCCGG + Intronic
1185397560 22:50600671-50600693 CCCCGCGCCGCCGCGGAGTCCGG + Exonic
1185409644 22:50674899-50674921 CCCCGCGCCTCCGCGAACCGCGG - Intergenic
1203255087 22_KI270733v1_random:133761-133783 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1203263143 22_KI270733v1_random:178840-178862 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
950021710 3:9792415-9792437 CCGCCCCCTCCCGCGGCCCCTGG - Exonic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
953705431 3:45226476-45226498 CCGCCCGCCCGCACGCACCCCGG - Intergenic
955195594 3:56802148-56802170 CCGGGCGCCCCCGCAGAGCGTGG + Intronic
955246267 3:57227800-57227822 CCGCCCGCCGCAGCTGACCCCGG - Exonic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
967859741 3:194141715-194141737 CCGCGCGGCCCCGCCGGGCCTGG + Intergenic
968161641 3:196432028-196432050 CCGTCCGCCCCCGCCGGCCCGGG - Intronic
968225434 3:196969518-196969540 CCGCGCGCCGTCGCCGACCCCGG - Intergenic
968258156 3:197297900-197297922 CCGCTCGGCTCCGCGGGCCCCGG - Intronic
968729059 4:2261323-2261345 CCGGCAGCCCCCGCAGACCCTGG + Intronic
970195635 4:13547773-13547795 CTGCGCGCCCCCGAGGGCCGGGG - Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
973246744 4:48017377-48017399 ACGCCCACCCCCGCGGCCCCGGG - Intronic
976388073 4:84482863-84482885 CCCTGCGCCTCCGCTGACCCCGG - Intergenic
979832180 4:125316524-125316546 CGGCTCGGCCCCGTGGACCCAGG - Exonic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
981782880 4:148445562-148445584 CCGCGCGCCCCCGCGTCTCCTGG + Intergenic
985068446 4:186144978-186145000 TCACGCGCCCCCGCGGCCCCGGG - Exonic
985688414 5:1294210-1294232 CCCCGCGCCTCCTCGCACCCGGG + Exonic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
986858948 5:11904233-11904255 CCGGGCGCCGCGGCGGCCCCAGG - Intergenic
987374013 5:17217832-17217854 CCCCGCGCCGCCGCGGACCCGGG + Intronic
988437579 5:31194033-31194055 CCGCGCGCCCGCCCCGACCCGGG - Intronic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
995224663 5:109689651-109689673 CTGCGCCTCCCCGCGGAGCCTGG + Exonic
997266290 5:132496985-132497007 CGGCGCGGCCCCGCGGAACCCGG - Intergenic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
998850421 5:146345930-146345952 CTGCGCGCGCCCGGGGACGCGGG - Intergenic
1001773413 5:174312020-174312042 CCCCGCGCCCCCGCGCGCCCGGG - Intergenic
1002176342 5:177403463-177403485 CGGGGCGCCCCCACGCACCCAGG + Exonic
1002185863 5:177454610-177454632 CCGGCCGCCGCCGCGGAGCCCGG - Intronic
1002401675 5:178994663-178994685 CCGCGCGCCCAGGCGCACGCCGG + Exonic
1002508771 5:179699070-179699092 ACGGGCACCCCCGCGGTCCCCGG + Exonic
1002692433 5:181059580-181059602 GCGCGTGCCCCCGCGGCGCCTGG + Exonic
1002896393 6:1382718-1382740 CCGCGCAGCCCCGAGGCCCCAGG + Intergenic
1002925805 6:1605093-1605115 CCCGGCGCCGCAGCGGACCCAGG - Intergenic
1004228991 6:13814248-13814270 CCTCGCGCCCCGGCGGCCCGCGG - Exonic
1005546234 6:26875527-26875549 CCCCGCGCCCCCCCCAACCCCGG - Intergenic
1006594466 6:35182585-35182607 CCGCGGACCCCAGGGGACCCCGG + Intergenic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1012401413 6:98845242-98845264 CCGCCCCGCCCCGCGGGCCCCGG + Intergenic
1013170792 6:107634942-107634964 CCGCCCGCCGCCGGCGACCCAGG + Exonic
1013803296 6:113970821-113970843 CCGCGCGCCCACCCCGACACCGG + Intronic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1014778167 6:125533977-125533999 CCGCACTCTCCCGCGGGCCCCGG + Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1017690718 6:156961495-156961517 CCGCGCAACGCAGCGGACCCGGG - Intronic
1017738130 6:157381659-157381681 CCGCTCGGCCCCGCAGCCCCCGG - Exonic
1019112291 6:169725178-169725200 CGGCGGGCCGCCCCGGACCCAGG - Intronic
1019303699 7:322392-322414 CCCCGCCGCCCCGCAGACCCAGG + Intergenic
1019395732 7:816746-816768 CCCCGCGTCCCCCCGGCCCCCGG - Intronic
1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG + Intergenic
1022230550 7:28409175-28409197 CGCCCCGCCCGCGCGGACCCTGG - Intronic
1027311933 7:76959994-76960016 CCGCGCCCCCCCGCGCCCCTGGG - Intergenic
1028856143 7:95596361-95596383 CGCCGCGCCCCCTCGGAACCAGG - Exonic
1029491938 7:100875377-100875399 GCGCCCGCCCCCGTGGACCCCGG - Intronic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1029549987 7:101232529-101232551 CCGCGCCCCCGCTCTGACCCCGG - Intronic
1029746394 7:102517742-102517764 CCGCCCGCCACCCCGGACCCCGG - Exonic
1029764333 7:102616721-102616743 CCGCCCGCCACCCCGGACCCCGG - Exonic
1031051864 7:116953405-116953427 CCGCCCGCCGCCGGGGACGCGGG - Exonic
1032344391 7:131106041-131106063 CCGCGCGCCCCGGCAGGCCGGGG + Intergenic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1036205253 8:6800876-6800898 GCGCCCTCCCTCGCGGACCCAGG - Intergenic
1037952488 8:23028154-23028176 CCGTGCACCCCCCAGGACCCTGG - Intronic
1037963601 8:23117232-23117254 CCGTGCACCCCCCAGGACCCTGG + Exonic
1041068172 8:54101966-54101988 CCGCGCGCGCCCGCGCGTCCAGG + Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1041838983 8:62248249-62248271 CCGCGGGCCCCCTCGCATCCGGG + Intergenic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1043857150 8:85276161-85276183 CGGGCCGGCCCCGCGGACCCCGG + Intronic
1045367857 8:101493369-101493391 CCGGCCGCCCCCGCGCCCCCCGG - Intronic
1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG + Intergenic
1049759925 8:144327287-144327309 ACGCGAGCCGCCGCGGACACCGG - Intergenic
1053034093 9:34809922-34809944 CCCCGCGCCCCCGCGCCCCGAGG - Intergenic
1055757776 9:79573241-79573263 CCGCTCGCCCCGGCGGCCCGCGG - Intronic
1056470727 9:86902799-86902821 CCGCGCGCCCCCGCAGAGGCCGG - Intergenic
1056732494 9:89178176-89178198 CCGCGCGCCCGCCCGCTCCCGGG + Exonic
1057208150 9:93185251-93185273 CCCGGAGCCCCCGCGGACGCCGG + Exonic
1057361198 9:94374923-94374945 CCCCGCGCCCGCGCTCACCCAGG - Exonic
1057524195 9:95784607-95784629 CCGCTCGGCCACGTGGACCCTGG - Intergenic
1057662165 9:97013241-97013263 CCCCGCGCCCGCGCTCACCCAGG + Exonic
1058866593 9:109167000-109167022 GCGCGCGTCCCCGGGGTCCCCGG + Exonic
1059061252 9:111037768-111037790 CCGCGCACCCACCCCGACCCAGG + Intronic
1059191852 9:112333885-112333907 GCGCGCGCTCCCGCGAACGCAGG - Intergenic
1060243696 9:121926344-121926366 CCGCGGGTCCCTGCTGACCCAGG + Intronic
1060811327 9:126612919-126612941 CCGCGCGTCCCAGCGACCCCTGG + Intergenic
1061451140 9:130667529-130667551 CAGCTCCCCCCGGCGGACCCTGG + Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062476097 9:136728257-136728279 CAGCGCCCCCCAGCGGTCCCCGG + Intergenic
1062596509 9:137302178-137302200 CCGCGCGGCGCCGCCGTCCCCGG - Exonic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1062600355 9:137316392-137316414 CCCAGCGACCCCGCGGCCCCTGG - Intronic
1203471485 Un_GL000220v1:116898-116920 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1203479306 Un_GL000220v1:160870-160892 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1185623195 X:1465853-1465875 CCGCGCGCCTCCGCTGCTCCCGG + Exonic
1185778813 X:2828862-2828884 CCGCCAGCCCCCGCGGGCGCGGG - Exonic
1189002780 X:36963715-36963737 CTGCGCGCTCCAGCCGACCCTGG + Intergenic
1189331011 X:40145277-40145299 CCGCGCGAACCCGCGGCGCCCGG + Intronic
1189333846 X:40158262-40158284 GCGCGCGCCCCGGCTGACACGGG + Intronic
1190673793 X:52764604-52764626 CCGCGCCCACCCGCCCACCCAGG - Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1193715842 X:84934388-84934410 CCCGACGCCCCCGCCGACCCCGG + Intergenic
1195135822 X:101906617-101906639 CGGCTTGCCCCCGTGGACCCAGG + Intronic
1200128891 X:153830591-153830613 CGGCGCGCCCCCGCGCTCCCTGG - Intergenic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic