ID: 946228468

View in Genome Browser
Species Human (GRCh38)
Location 2:218277348-218277370
Sequence GGCCCTCCATGCCCTCACCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946228452_946228468 24 Left 946228452 2:218277301-218277323 CCGGGGTCCGGGCCTGATAAGAA 0: 1
1: 0
2: 0
3: 4
4: 64
Right 946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG 0: 1
1: 0
2: 1
3: 16
4: 281
946228456_946228468 17 Left 946228456 2:218277308-218277330 CCGGGCCTGATAAGAAAGGGGAG 0: 1
1: 0
2: 2
3: 15
4: 171
Right 946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG 0: 1
1: 0
2: 1
3: 16
4: 281
946228458_946228468 12 Left 946228458 2:218277313-218277335 CCTGATAAGAAAGGGGAGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG 0: 1
1: 0
2: 1
3: 16
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946228468 Original CRISPR GGCCCTCCATGCCCTCACCT TGG Exonic
900309095 1:2024824-2024846 GGCCCCCCATGCCCTGGCCCAGG + Intronic
900389682 1:2428542-2428564 GGTCCTCCGTGGCCTCGCCTAGG + Intronic
900438059 1:2640836-2640858 GGCCCTCTTGGCCCACACCTGGG - Intronic
900637852 1:3674664-3674686 GGCCCTCCTGGCCCTCACTCCGG + Intronic
900887298 1:5423954-5423976 GGCACTCCTGGCCCTCACCTGGG + Intergenic
901490924 1:9595811-9595833 GGACCTCCATGCCCTGCCCCAGG - Intronic
901843038 1:11965589-11965611 TGCCCACCCTGGCCTCACCTCGG - Exonic
901859499 1:12064824-12064846 AGCTCTGCAAGCCCTCACCTGGG + Intronic
901869621 1:12130326-12130348 GGCTCTCCCTGACCTCATCTGGG - Intronic
902335340 1:15751284-15751306 TGGCCTCCATGCCCTCCCCTCGG - Intergenic
903468343 1:23568080-23568102 GGCCCTCCCTGCCCGCGCCCCGG + Intergenic
903779206 1:25810779-25810801 AGCCCTCCATCTGCTCACCTAGG + Intronic
904273897 1:29367891-29367913 GGGCCTCCATGCCCTAACTCGGG - Intergenic
905342631 1:37289757-37289779 TGCCCTCCCTGATCTCACCTGGG - Intergenic
905382672 1:37574325-37574347 GGCCCACCCTGCTCTTACCTGGG + Exonic
905644054 1:39612182-39612204 GGCCAGCCATGCCCTCAGCACGG - Intergenic
907615534 1:55921006-55921028 GCACCTCCATGCCCACCCCTTGG + Intergenic
908509392 1:64839506-64839528 GGCACTCCGTGGCCTTACCTGGG - Intronic
914054764 1:144160121-144160143 GGCCTTCCCCGCCCTCACCACGG + Intergenic
914124382 1:144806240-144806262 GGCCTTCCCCGCCCTCACCACGG - Intergenic
920033646 1:203051873-203051895 ATCCCTCCACCCCCTCACCTTGG - Exonic
920712892 1:208311828-208311850 GGTCCTGCATCCCCTCACCATGG - Intergenic
922748140 1:228058762-228058784 AGCCCCCCAAGCCCTGACCTGGG + Intronic
924466001 1:244299831-244299853 GGCCCTCCATGTCCTCCTTTGGG + Intergenic
1065898915 10:30187820-30187842 GGCCCTTCCTAGCCTCACCTGGG + Intergenic
1066005366 10:31141748-31141770 GGGCCTCCATGCCAGCCCCTTGG - Intergenic
1066362383 10:34743858-34743880 GACCCACCATGCCCTTATCTGGG - Intronic
1067222127 10:44351956-44351978 GGAACCCCATGCTCTCACCTGGG - Intergenic
1069660790 10:70122198-70122220 GGCCCTCCAGCCCCTCCCATTGG - Intronic
1069839073 10:71327923-71327945 GGGCCTCCTTGCCCTCCCCCAGG + Intronic
1070793616 10:79204213-79204235 TTCCCTTCCTGCCCTCACCTTGG + Intronic
1074184389 10:111088133-111088155 CGTCCTCAATGCCTTCACCTGGG - Intergenic
1074291715 10:112142604-112142626 GGCCAACCATGGCCTCACCTGGG - Intergenic
1075044885 10:119139123-119139145 GACCCTCCAGGTCCTCACATGGG - Intergenic
1076278422 10:129225064-129225086 GGCCTTCCATGCCCTCCCAGCGG + Intergenic
1076584295 10:131534856-131534878 GTCCTTCCCTGGCCTCACCTGGG + Intergenic
1076597222 10:131631354-131631376 CGCTGTCCATGCTCTCACCTTGG + Intergenic
1077077606 11:708565-708587 TGCCCTCCAGTCCCTCCCCTAGG + Intronic
1077152265 11:1077630-1077652 TGCCCTCCCTGCCCTCCCTTGGG - Intergenic
1077230707 11:1457127-1457149 GGCCCTCCATGCCCACCCACAGG + Intronic
1078400616 11:11023206-11023228 GGCCCCTCCAGCCCTCACCTTGG + Intergenic
1079095289 11:17505973-17505995 ACCCCACCATGACCTCACCTGGG - Intronic
1079114873 11:17634686-17634708 GACCCTCAATGACCTCATCTAGG + Intronic
1081062653 11:38499912-38499934 GGCCATCTATACCATCACCTTGG - Intergenic
1081488075 11:43547252-43547274 GGCCCTCCATGTCAGCACCCAGG + Intergenic
1083147089 11:60767756-60767778 GTGCCTCCAGGCCCCCACCTAGG - Intronic
1084126681 11:67103678-67103700 GGCCTTCCATGCCCTTTCCATGG + Intergenic
1084214651 11:67640761-67640783 GCCCCTCCATGCCCCCTCTTAGG - Intergenic
1084450304 11:69232874-69232896 GCCCCTCCATCCTCCCACCTGGG - Intergenic
1085780143 11:79400892-79400914 AGCCCTGCATGCCATGACCTAGG + Intronic
1089097046 11:115927776-115927798 GGGCATCCATGCCCTCATTTTGG + Intergenic
1090253661 11:125268155-125268177 GCCCCTCCCTGCTCTCATCTCGG + Intronic
1091974933 12:4816894-4816916 GACCCTCCCTTCCCTCTCCTTGG + Intronic
1092282945 12:7110848-7110870 GGCCCACCTTGGTCTCACCTAGG + Intergenic
1092792414 12:12081480-12081502 TGCCCTTCATGCGCACACCTTGG + Intronic
1096238377 12:49944976-49944998 GGCCTTCCCTGCCTCCACCTGGG + Intergenic
1096659990 12:53118345-53118367 GGGCCTGGATCCCCTCACCTGGG - Exonic
1098840067 12:75467345-75467367 GGCCCTCCCTGCCCTAGCCAAGG - Intergenic
1099862327 12:88235452-88235474 ACCCCTGCCTGCCCTCACCTGGG + Intergenic
1099989269 12:89707222-89707244 GGCCCTCCATTCACTCACGTGGG + Intronic
1101259251 12:103012510-103012532 GGGCCTCCAGACCCTCATCTGGG + Intergenic
1101633256 12:106516111-106516133 GGCCTTCCAAGCACTCACTTAGG - Intronic
1102111012 12:110365938-110365960 GCCCCTCCCTGGCCTCCCCTAGG + Intergenic
1102691272 12:114763020-114763042 CACCCTCCCTGCCCCCACCTCGG + Intergenic
1103924347 12:124415277-124415299 GGCCTGCTGTGCCCTCACCTGGG + Intronic
1104581235 12:130012260-130012282 GTCCCTCCGTGCCCACACCAGGG + Intergenic
1104951785 12:132444427-132444449 TCCCCTCCATGCCCTGTCCTGGG + Intergenic
1104994079 12:132643191-132643213 GGCCCTCCATGGCAGCACATTGG - Intronic
1105278582 13:18950194-18950216 GGCCCTGTCTGCCCTCATCTTGG + Intergenic
1106547524 13:30743516-30743538 TGCCCTCCATTCCCCCTCCTTGG + Intronic
1107020688 13:35747798-35747820 GGTCTTCAATGCCCTCTCCTGGG + Intergenic
1107975425 13:45683835-45683857 GGCCCTACATGACCTCTCCCAGG + Intergenic
1109267926 13:60221834-60221856 GGCCAGCGATGCCCCCACCTAGG - Intergenic
1110035053 13:70672701-70672723 GGCCCTCAAGGACCTGACCTGGG + Intergenic
1110835121 13:80074406-80074428 GGCCCGCCATGCCCCCATCCTGG + Intergenic
1112975586 13:105313793-105313815 GGCCTTTTATGGCCTCACCTTGG + Intergenic
1113255421 13:108499987-108500009 GGCCCTCTGTGCCCTCGCTTTGG + Intergenic
1113428468 13:110229583-110229605 CCACCTCCATGCCATCACCTTGG - Intronic
1113454313 13:110437255-110437277 GGCCCTCCCTGCCGTCTCCCAGG - Intronic
1113836251 13:113330371-113330393 GGGCTTCCATGCACACACCTGGG - Intronic
1113836362 13:113330850-113330872 GGGCTTCCATGCACACACCTGGG - Intronic
1116764153 14:49050512-49050534 GGCCCTCCTTGCCTTGACCTAGG + Intergenic
1117180191 14:53183472-53183494 GGCCTTCCATGCCCTCTCCTGGG - Intergenic
1117784092 14:59264743-59264765 GGTCATCCATCCCATCACCTAGG + Intronic
1117959330 14:61147765-61147787 GTCCCTCCAAGCCCTCAGCAAGG - Intergenic
1119473411 14:74912968-74912990 GCCTCCACATGCCCTCACCTGGG - Intronic
1121180663 14:91926223-91926245 TGCCCTCGGTGCCCACACCTGGG + Intronic
1122601204 14:102922825-102922847 AGCCCTCCCTGCCCACTCCTCGG - Intronic
1122633098 14:103116813-103116835 GGCCTGCCATGCCAGCACCTGGG - Intergenic
1122797424 14:104212951-104212973 GGCACCCCATGCCGGCACCTAGG + Intergenic
1125461069 15:39907383-39907405 TGCCCTCCAAGCCCTGAGCTTGG + Intronic
1129686592 15:77689523-77689545 GGCCATCCAGGCCCTCCCATGGG + Intronic
1130512528 15:84601184-84601206 GGCCCACTATTCCCTCACCTCGG - Exonic
1131183276 15:90254989-90255011 GACCCTCCATGTCCTAACCAAGG - Intronic
1132617982 16:851810-851832 GGCCCTCGAGGCCCCCAGCTGGG + Intergenic
1132679323 16:1133272-1133294 GGCCCTCACTCCCTTCACCTGGG - Intergenic
1132845876 16:2000568-2000590 GACGCTCCAGGCCTTCACCTGGG - Intronic
1136413547 16:30090840-30090862 GGCCCTCCATTCCCTCCCGGGGG - Exonic
1137267904 16:46884123-46884145 GGCTCTCCAGCCCCTCAACTGGG + Intergenic
1137484394 16:48879657-48879679 ATCACTCCATGCCTTCACCTAGG + Intergenic
1138454944 16:57115787-57115809 GCCCCTGCCTGCCCTCCCCTGGG + Intronic
1138506456 16:57480584-57480606 GGCCCTCCATGTCCTGAGCATGG + Intronic
1139905748 16:70364641-70364663 AGCCCCGCAAGCCCTCACCTGGG - Exonic
1140272645 16:73480534-73480556 GCCACTCCATCCCCACACCTGGG - Intergenic
1140372587 16:74421195-74421217 GGCCCTCCTTGGCACCACCTGGG - Exonic
1141957880 16:87384385-87384407 GCCCCTCCAAGCCCTCCCCGGGG - Intronic
1142024509 16:87805211-87805233 GGCTCTCCCCGCCCTGACCTTGG + Intergenic
1142114675 16:88350414-88350436 GGGCTTCCCTGCCCTCCCCTAGG - Intergenic
1142265253 16:89061492-89061514 GTCCCTCCATGTGCTCACCTTGG + Intergenic
1142301010 16:89257727-89257749 GGCCCGCCATGCCCCCATCCTGG - Intergenic
1142378042 16:89716998-89717020 GCCCCCCCATCCCCTCACCCCGG + Intronic
1142378072 16:89717075-89717097 GCCCCCCCATCCCCTCACCCCGG + Intronic
1142760872 17:2041459-2041481 GTCCCTCCCTCCCCTCCCCTAGG + Exonic
1143319183 17:6056858-6056880 GGCCCACCCTGCCCTCATCTGGG - Intronic
1144717885 17:17446993-17447015 GGCCTTCTGTGCCCTCACCTGGG + Intergenic
1144765473 17:17730261-17730283 GGCCTTCCATGCTCTGACCTCGG - Intronic
1145289438 17:21531484-21531506 GGCCCTGCATGGCCTCCGCTGGG - Exonic
1147323806 17:39660885-39660907 GGCCCGGCATGGACTCACCTTGG - Exonic
1147571966 17:41576884-41576906 GTCCCTCCCTGGCCCCACCTGGG - Intergenic
1147948053 17:44091629-44091651 GGTCCTGCATGCCCCCAGCTGGG - Intronic
1147977521 17:44256290-44256312 GGCCCTCCCTGCCTAAACCTAGG - Intronic
1148123388 17:45224940-45224962 GCCCCTTCATGCCTTCCCCTGGG + Intronic
1148191450 17:45681422-45681444 GGCCCTCCAAGCTCTTTCCTGGG + Intergenic
1148449947 17:47770447-47770469 TGCCCTCCATGGCCAGACCTAGG - Intergenic
1150133567 17:62681933-62681955 CCCCCACCTTGCCCTCACCTCGG - Exonic
1150627011 17:66848317-66848339 AGCCCTCCATCTTCTCACCTGGG - Intronic
1150645251 17:66973811-66973833 GGCCCTCCCTGGCCTCTCCCTGG - Intronic
1151364056 17:73605689-73605711 GTGCCTCCATGCACTGACCTTGG + Intronic
1151499529 17:74480095-74480117 TGCCCTCCCTGTCCCCACCTGGG - Intronic
1151656890 17:75500344-75500366 GGCTCTCCCTGCCCTCAGGTGGG + Exonic
1152154327 17:78622894-78622916 TGCCCCCCATGCCCACACATCGG + Intergenic
1152580978 17:81165554-81165576 GGCTTTCCATGGCCTCTCCTGGG - Intronic
1152595226 17:81234540-81234562 GGCCCCCCAAGCCTACACCTGGG + Intronic
1152622631 17:81372891-81372913 GGCCCTGCATCCCCTCCACTTGG + Intergenic
1152623341 17:81377141-81377163 GGCACTCCAAGCCCTGACCAGGG - Intergenic
1153523108 18:5970140-5970162 AGCGCACCATGACCTCACCTGGG + Intronic
1154383163 18:13870522-13870544 GCCCCTCCATTCCCTGCCCTGGG + Intergenic
1156460212 18:37317485-37317507 GGGCCTCCATCTCCTTACCTGGG - Intronic
1157766197 18:50298964-50298986 GGTCCTACAAGCCCACACCTGGG + Intergenic
1157848993 18:51030335-51030357 GGCCCTTCCTGCTCTCCCCTAGG + Exonic
1158928657 18:62298153-62298175 GGACCTCCATGCCCAAACATGGG + Intronic
1159208772 18:65287825-65287847 GATCCTCCCTGCTCTCACCTGGG - Intergenic
1160373942 18:78396685-78396707 TGCCCTCCAGCCTCTCACCTTGG - Intergenic
1160681204 19:412423-412445 GGCCCTCCATCCCCCCAGGTGGG + Intergenic
1160726467 19:619873-619895 GGCCCCAGGTGCCCTCACCTTGG - Intronic
1161302821 19:3551248-3551270 CTCCCTCCATGTCCTCACCCTGG - Intronic
1161435618 19:4261031-4261053 GGGCCTACATCCCCTTACCTGGG - Intronic
1162439290 19:10682700-10682722 CGCCCACCATGTGCTCACCTCGG - Exonic
1162526148 19:11207902-11207924 GGACCTCCATTCTGTCACCTAGG - Intronic
1162574368 19:11490284-11490306 GGGCTTCCATGCCCTCTCCGGGG + Intronic
1162986410 19:14273069-14273091 AACCCTTCATGACCTCACCTAGG - Intergenic
1163631134 19:18418421-18418443 GGCCCTTCATCCCCCCACCAGGG - Intergenic
1163847837 19:19647239-19647261 GGCGCTCAATGCCCTCATCCTGG - Exonic
1164753386 19:30672037-30672059 GGCCGTCCAGGCCTTCACTTGGG + Intronic
1165461280 19:35945556-35945578 AGCCCTCCCTGACCACACCTGGG - Exonic
1165477544 19:36039926-36039948 GGACCTCCCAGCGCTCACCTTGG + Exonic
1166219181 19:41354007-41354029 GCCCCCCCATGCCCTCCCCCTGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1166693671 19:44839789-44839811 GCCCCTCCTTGCCCTGCCCTTGG + Intergenic
1167740212 19:51320206-51320228 GGCCCTGCAGCCCCTCACCCTGG - Intronic
1168283183 19:55316912-55316934 GGCCTTCCTTGCCTTCATCTTGG - Exonic
926165241 2:10518851-10518873 TGCCCTCTCTGCCCTGACCTCGG - Intergenic
926476492 2:13329063-13329085 GGCCCAGCATGTCTTCACCTGGG + Intergenic
926571872 2:14537765-14537787 TCCCCTTCTTGCCCTCACCTGGG - Intergenic
926760334 2:16273053-16273075 GAGCCTCCTTGGCCTCACCTGGG - Intergenic
929668617 2:43852482-43852504 TGCCCCCCAGGCCCTCACCTGGG - Exonic
930089354 2:47520628-47520650 GGCCCCCCAGGCCCACACCCAGG - Exonic
931368392 2:61639475-61639497 GGGCCCACATGCCCTAACCTAGG - Intergenic
931693995 2:64858694-64858716 GCCCCACCAGGCCCTCACCCTGG - Intergenic
934876358 2:97924453-97924475 GGACCCCCATGTCCTGACCTTGG - Intronic
935747886 2:106205068-106205090 GGACCTCCAAGCCTTCATCTGGG - Intergenic
936122239 2:109757021-109757043 GGACCTCCAAGCCTTCATCTGGG + Intergenic
936153706 2:110035309-110035331 GGCCCTCCACCCTCTCTCCTTGG + Intergenic
936190979 2:110336106-110336128 GGCCCTCCACCCTCTCTCCTTGG - Intergenic
936222454 2:110614453-110614475 GGACCTCCAAGCCTTCATCTGGG - Intergenic
936953747 2:118003795-118003817 TTTCCTCCATGTCCTCACCTTGG - Intronic
937880071 2:126858297-126858319 GTCCCTCCCTTCCCCCACCTTGG + Intergenic
937973150 2:127565476-127565498 TGCCCCCCATGCCCTCACTGAGG + Intronic
937998596 2:127713988-127714010 GGCCCTCCAAACCATCACATGGG - Exonic
938133388 2:128735638-128735660 GCCCCTCCGCGCCCACACCTAGG - Intergenic
941691239 2:168502735-168502757 GGAACTACATGCCCTCACTTGGG - Intronic
946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG + Exonic
946260523 2:218486665-218486687 GGCCTCCCTTGGCCTCACCTTGG + Intronic
947341940 2:229149813-229149835 GTCCCACCAGCCCCTCACCTAGG - Intronic
947596090 2:231412513-231412535 GGCGCTCCCTGCCCTCTTCTGGG - Intergenic
948332930 2:237184296-237184318 GGCTCTGCATGCTCTCAGCTCGG + Intergenic
948661424 2:239508920-239508942 GACCCTCCCTGGCCTCTCCTGGG + Intergenic
948902954 2:240965376-240965398 GGCCTTCAGTGTCCTCACCTGGG - Intronic
1168763711 20:367587-367609 TGCCCTCCATGCCCACCCCAGGG + Intronic
1169191163 20:3660062-3660084 GGCCCTTCATGCCTCCACCCAGG + Intronic
1170613759 20:17933550-17933572 TGCTCTCCATCCCCTCCCCTGGG - Intergenic
1170831820 20:19849399-19849421 GCACTTCCATGCCCTGACCTTGG - Intergenic
1173522911 20:43712405-43712427 GGTCCTCCCTGGCCTCTCCTTGG + Intronic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1179823936 21:43953249-43953271 GGCCCTGCATCCCCGCAGCTAGG + Intronic
1180038668 21:45264633-45264655 GGCCGTCCCTGCCCTCGCCCCGG - Exonic
1180937218 22:19633626-19633648 GGCCCACCAGGCCCGCACCTTGG + Intergenic
1181431120 22:22882475-22882497 GGCCCTCCCTGTGCTCACCCTGG + Intronic
1181473776 22:23156446-23156468 GGCCCTGCTGGCCCCCACCTGGG - Intronic
1182052831 22:27326075-27326097 GAGCTTCCATGCCCTCGCCTGGG - Intergenic
1183615804 22:38944668-38944690 TGCCCTCCTTCCCCTCTCCTGGG + Intergenic
1183903481 22:41022643-41022665 GTCCCTCCCTGCCCCCACCGCGG - Intergenic
1183976531 22:41515531-41515553 GTCCCTCCCCACCCTCACCTTGG - Exonic
1184257720 22:43296614-43296636 GGCCCTCCATGCCCGGTCCTGGG + Intronic
1184688640 22:46107625-46107647 GGCCCTCCCAGCCCTCATCCAGG + Intronic
1184703839 22:46196608-46196630 GGCCTTCCCTGGCCTCACCCCGG + Intronic
1185331904 22:50255737-50255759 GGCCCCCACTGCCCCCACCTGGG + Intronic
950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG + Intronic
950673405 3:14540363-14540385 GGCCCTCCCTCCCCTCCCCAGGG + Exonic
950707842 3:14793927-14793949 GGCCCTTCCGGACCTCACCTAGG + Intergenic
961479688 3:127171840-127171862 CTCCCTCCATGCCCTTTCCTGGG - Intergenic
961649696 3:128411189-128411211 GGACGTGCATGCCCACACCTTGG - Intergenic
962244762 3:133783735-133783757 GGCCCTCCAGGCCCTCCGCCCGG + Intergenic
962254381 3:133860448-133860470 GGCCCTCCATGCCTTGATTTTGG + Intronic
962985378 3:140531434-140531456 GGGCTTTGATGCCCTCACCTTGG + Intronic
966794193 3:183698140-183698162 GATCCTCCCTGCCCTCCCCTCGG - Intronic
968657934 4:1786673-1786695 CGCCAGCCAGGCCCTCACCTTGG + Intergenic
969620573 4:8276828-8276850 GGCCCCGCAAGCCCTGACCTGGG - Intronic
969974352 4:11082688-11082710 GGCCCTCCATAAGCTCCCCTTGG + Intergenic
973336128 4:48958604-48958626 CCCCCTCCACTCCCTCACCTAGG - Intergenic
976088361 4:81429569-81429591 GGCCCACCACGCCCCCATCTTGG + Intronic
980993354 4:139757898-139757920 AGCCCTCCCTGCCATCACCGTGG + Intronic
981920416 4:150079207-150079229 GACCCTGCAGGCCCTCAGCTCGG + Exonic
984263692 4:177471382-177471404 GGCCCACCATGCCCCCATCCTGG - Intergenic
984586379 4:181569240-181569262 GGCACACCATGTTCTCACCTCGG - Intergenic
985759341 5:1737146-1737168 GGCCCTGCTGGCCCTCAGCTCGG + Intergenic
985800479 5:2002507-2002529 GCCCCTCCAAGCCCTGCCCTGGG - Intergenic
986483961 5:8217027-8217049 GGCCCTCCAAGCCCCCACCCTGG + Intergenic
991370296 5:65911659-65911681 TGCCTTTTATGCCCTCACCTGGG + Intergenic
994533238 5:100993096-100993118 GGCCCTCCACGCCCCTATCTTGG - Intergenic
995571837 5:113488997-113489019 GGCCCTCGCAGCCCTCATCTTGG + Intergenic
999231466 5:150064701-150064723 GCCCCTCCCTGCCCCCAGCTGGG + Intronic
1001751809 5:174137097-174137119 GGCCCTACCTGCCCACCCCTCGG - Intronic
1002535704 5:179874297-179874319 GGCCCACCATGCCCTTTCCCTGG - Intronic
1003049282 6:2765542-2765564 GGCCTTCGATGCCCTCCGCTAGG - Exonic
1006116903 6:31780423-31780445 TGCCCACCAGGCCCTTACCTGGG + Exonic
1007255177 6:40523374-40523396 GCCCCACCATGCCCTAACCATGG + Intronic
1008730916 6:54481449-54481471 GGCCCACCATACCCCCATCTTGG - Intergenic
1011175059 6:84551139-84551161 GGACCTGCATGGCATCACCTAGG - Intergenic
1013292038 6:108728168-108728190 GGCCCTGCCTTCCCTCCCCTGGG - Intergenic
1013514124 6:110870147-110870169 GGTTCTCCATACCCTCAGCTGGG - Intronic
1013538664 6:111087217-111087239 GGCCCACCGCGCCCGCACCTAGG + Intergenic
1015414460 6:132932924-132932946 GTCCCTCCATCACCCCACCTGGG + Intergenic
1016024957 6:139277646-139277668 GGCCTTCCTTTCCCCCACCTAGG + Intronic
1017874869 6:158516215-158516237 GGCCGGCCATGGCCTCAGCTTGG - Intergenic
1018297356 6:162363204-162363226 GGCCCTCCATGCCCCTGCCCAGG + Intronic
1019194634 6:170273928-170273950 GGCCCTCTGCGCCCCCACCTTGG - Intergenic
1019468067 7:1201444-1201466 GGCCCGCCATGCCCCCATCCTGG + Intergenic
1019709494 7:2511766-2511788 TGCCATCCCTGCCCTCACCAAGG + Intergenic
1020070866 7:5226159-5226181 GGCCCTCCATGCCCTACGCGAGG - Intronic
1022655883 7:32319086-32319108 CGCCCTCCACGCCGTCACCCGGG + Intergenic
1022950261 7:35331922-35331944 GGACCGCCCTGCCCCCACCTGGG - Intergenic
1023502273 7:40863637-40863659 TGCCCTCCATACCCTAACCCTGG + Intergenic
1025820142 7:64955297-64955319 GGCCCACCATGCCCCCATCCTGG + Intergenic
1026902295 7:74043916-74043938 TTCCCTCCTTGCTCTCACCTGGG - Exonic
1027769844 7:82392608-82392630 GGCCAGCAATGCCCCCACCTAGG - Intronic
1029038602 7:97549482-97549504 GGCCTTCCATGCCCCCATCCTGG + Intergenic
1034456614 7:151174293-151174315 TGCCCTCCAGGCCCCCACCAGGG - Intronic
1037898522 8:22674114-22674136 GGCCCTCTTTGCTCCCACCTTGG + Intergenic
1039433977 8:37547077-37547099 GACCCTTCCTGCCCTCACTTGGG - Intergenic
1040711574 8:50195319-50195341 AGCCCATCATGCCCTCTCCTTGG - Intronic
1040787344 8:51181352-51181374 GGCCCACCATGCCCCCATCCTGG + Intergenic
1040906238 8:52472345-52472367 GGGCCTCAATGCCCACACTTGGG + Intergenic
1041016085 8:53594462-53594484 GGCCCTCCATGCCAACCCCAGGG - Intergenic
1042096168 8:65218048-65218070 GACCCTCCATGCCCTCTCTGGGG - Intergenic
1043523730 8:81073944-81073966 GCCCCTCCATGTGCCCACCTTGG + Intronic
1045305509 8:100953005-100953027 GGCCCACCTCGCCCCCACCTCGG - Intronic
1046229561 8:111335375-111335397 GGCCCGCCATGCCCCCATCCTGG - Intergenic
1047079378 8:121442934-121442956 GGCCCGCCATGCCCCCATCCCGG - Intergenic
1049214258 8:141400583-141400605 GGCTGTCCATGGCCTCACTTAGG - Intronic
1049944196 9:578902-578924 TGCCCTCCATCCCCTCCCCATGG - Intronic
1052778456 9:32756070-32756092 GGCCCGCCATGCCTCCACCCTGG - Intergenic
1053021268 9:34695917-34695939 GACCATCCATGCCCTCATCAAGG - Intergenic
1053731789 9:41064416-41064438 TCCCCTCCATGCCCACCCCTTGG - Intergenic
1054716101 9:68559207-68559229 GGCCCTCCATGGCCTCATAGGGG - Intergenic
1055356575 9:75443630-75443652 GGCCTGCCATGCCCTATCCTGGG - Intergenic
1056832138 9:89925530-89925552 GGTCTACCCTGCCCTCACCTGGG + Intergenic
1057274373 9:93668529-93668551 GGCCCTGTCTGCCCTCATCTTGG - Intronic
1057709662 9:97427994-97428016 GGCCCTCTGAGCCCTCAGCTTGG + Intronic
1058077627 9:100667211-100667233 TGCCCTCCTTGGCCTCCCCTTGG - Intergenic
1059672459 9:116504340-116504362 CGTCCTCTTTGCCCTCACCTTGG - Intronic
1060113837 9:120925918-120925940 GCTCCTCCATCACCTCACCTCGG + Exonic
1060533197 9:124360996-124361018 GGCCCTCCTTGTCCTGGCCTGGG - Intronic
1060722652 9:125989149-125989171 GGCCCTCCCTGCCCTCAGCCCGG - Intergenic
1061231220 9:129316939-129316961 GGCCTTCCCTGCCCTGACCCTGG + Intergenic
1061419287 9:130464480-130464502 AGCCATCCCTGCCCGCACCTGGG - Intronic
1061884737 9:133585794-133585816 GGCCCTCTCTGCCCTGGCCTTGG - Intronic
1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG + Intergenic
1062500008 9:136848244-136848266 TGCCCTCCAGGCTCCCACCTGGG - Exonic
1185451739 X:284351-284373 GCCCCACCCTGCCGTCACCTGGG - Intronic
1187405092 X:18996697-18996719 TGCTCTCCATGCCAGCACCTGGG - Intronic
1189238562 X:39507707-39507729 GGCCAATCATGCCCTCTCCTGGG + Intergenic
1192809858 X:74537990-74538012 TGCCCTCCATGCCTCCATCTTGG - Intergenic
1195064366 X:101226658-101226680 AGCCTTCCCTGCCCTCCCCTAGG - Intronic
1196696739 X:118621390-118621412 CTCCCTCCAATCCCTCACCTTGG - Intronic
1198217261 X:134567127-134567149 GGGCCTCCATGTCCTCTCATAGG + Intronic
1201329280 Y:12800297-12800319 AGCCTTCCATTCTCTCACCTGGG - Intronic
1202376832 Y:24246008-24246030 TGCCCTCCATGCCTTCCCCAGGG + Intergenic
1202493948 Y:25424113-25424135 TGCCCTCCATGCCTTCCCCAGGG - Intergenic