ID: 946228490

View in Genome Browser
Species Human (GRCh38)
Location 2:218277509-218277531
Sequence CAAAATCACCACTTCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946228487_946228490 -6 Left 946228487 2:218277492-218277514 CCACGTATGAATGACTTCAAAAT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 946228490 2:218277509-218277531 CAAAATCACCACTTCCAGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946228490 Original CRISPR CAAAATCACCACTTCCAGAG GGG Intronic
903787412 1:25870465-25870487 CAACTTCACCACTCCCATAGTGG + Intronic
905504331 1:38465255-38465277 CAATACCACCACCTACAGAGTGG - Intergenic
905538059 1:38739267-38739289 AAATGTCACCTCTTCCAGAGCGG - Intergenic
907771629 1:57471280-57471302 CAAACTCACCCCTTCCAAATGGG + Intronic
909567124 1:77065535-77065557 AAAAATTACCACTTGCAAAGTGG + Exonic
910265253 1:85331723-85331745 CAAAATGAACACTGCCTGAGAGG + Intronic
911237842 1:95430846-95430868 CAAAATCACTTCTTTCACAGTGG + Intergenic
915744489 1:158145648-158145670 AAATATCACCACTGCCTGAGGGG - Intergenic
919521253 1:198591320-198591342 CAAAGTCACCCCAGCCAGAGTGG + Intergenic
919938145 1:202268430-202268452 CAGAATAACCATTTCCATAGTGG + Intronic
920368193 1:205459495-205459517 CAACATCACAACTGCTAGAGGGG - Intergenic
920735841 1:208532522-208532544 CAGAGGCTCCACTTCCAGAGTGG + Intergenic
921898897 1:220429487-220429509 AAAAATCACCCCATCCTGAGAGG - Intergenic
923065019 1:230509654-230509676 CTGAATCACCACATCCAGACAGG - Intergenic
924585164 1:245355384-245355406 CAAAATCACCATCTCCAGCCTGG + Intronic
1063052986 10:2474095-2474117 CAAAGTCACCTCTTACAGGGTGG + Intergenic
1066804302 10:39228939-39228961 CCAAATCTCCACTTGCAGAAAGG - Intergenic
1066931050 10:41759346-41759368 CAAAATGTCCACTTGCAGAATGG - Intergenic
1067016445 10:42759129-42759151 CAAAAGCCCCACATTCAGAGGGG - Intergenic
1068441828 10:57065719-57065741 CAAAATCACCAGGCCCAGATGGG - Intergenic
1069057741 10:63862435-63862457 CAGAATCACCCCTTCCCCAGGGG - Intergenic
1073619742 10:105034615-105034637 CATAAGCACGTCTTCCAGAGAGG + Intronic
1075601143 10:123770312-123770334 AAAAAAAACCACTTCCGGAGAGG + Intronic
1077421281 11:2451197-2451219 CAAGATCACCACTGCCCGGGTGG - Intronic
1077996253 11:7454846-7454868 CAAACTCACCACTTGGTGAGTGG - Intronic
1079304419 11:19309749-19309771 CAAAATGACCACCACAAGAGAGG + Intergenic
1080897656 11:36459755-36459777 TAACAGCACCACTTTCAGAGGGG - Intronic
1081754769 11:45536743-45536765 CAAAAACACCGCTTCCAAATAGG + Intergenic
1083075458 11:60032538-60032560 AAAAATCCCCATTTCTAGAGGGG - Intergenic
1086562018 11:88178731-88178753 CAAGAGCACCACTGCCAAAGAGG + Intergenic
1086796738 11:91114522-91114544 CAAAATCATAACTGCCACAGAGG + Intergenic
1088757888 11:112901749-112901771 CAAAATCCCCAGCTCCACAGTGG - Intergenic
1089592585 11:119553819-119553841 CAAAATATCCACTTTCAGCGGGG - Intergenic
1093644623 12:21570811-21570833 CTAAATAAACACTTTCAGAGTGG - Intronic
1094546395 12:31408334-31408356 CAAAATCTCCAGGTCCAGCGTGG + Intronic
1094782745 12:33811653-33811675 CAAAATCAGTAGTTCCAGACTGG + Intergenic
1096047182 12:48572621-48572643 CAAAATCTCCCTTTCCAGAGAGG + Intergenic
1101067697 12:101039926-101039948 TAAAAACACCACTGCCAGTGAGG - Intronic
1102249972 12:111380143-111380165 CAAAATCACCTCTTCTAGGAAGG + Intergenic
1102970150 12:117160016-117160038 CAAGATCACCACTTCTGGGGTGG + Intronic
1104310454 12:127650126-127650148 CAGAATCAGCACATTCAGAGAGG - Intergenic
1104543514 12:129688865-129688887 CAAATTCACCTCTTGCATAGAGG - Intronic
1104680540 12:130748208-130748230 CAAAATCACCAGTTGCACATGGG + Intergenic
1105459774 13:20573082-20573104 CTAAATTACCAGGTCCAGAGAGG + Intronic
1107736950 13:43408847-43408869 GAATATAACAACTTCCAGAGTGG + Intronic
1108580516 13:51824549-51824571 TAAAATCACCACATCCACTGCGG - Intergenic
1109489680 13:63080541-63080563 GAAAATCACTTCTGCCAGAGGGG - Intergenic
1111523255 13:89432239-89432261 CAAAGTCACAATTTCAAGAGAGG + Intergenic
1111792742 13:92879278-92879300 GAAAATCACAACTTCCAGAATGG + Intergenic
1111833212 13:93355764-93355786 GAACATCACCATTTCCAGACTGG - Intronic
1113436112 13:110292434-110292456 AAAAATAACCACCTCCAGATTGG - Intronic
1114068991 14:19093637-19093659 CAAAAGCCCCACTGTCAGAGGGG + Intergenic
1114093270 14:19306368-19306390 CAAAAGCCCCACTGTCAGAGGGG - Intergenic
1114502598 14:23182134-23182156 CAAACTCTCCACTTACCGAGAGG + Intronic
1115494912 14:33993884-33993906 CAACATCAAAACTTTCAGAGTGG + Intronic
1115702342 14:35966429-35966451 GAAAATAAGCACTTACAGAGGGG - Intergenic
1117320200 14:54614766-54614788 CAAAGTACCCACTTCCTGAGAGG + Intronic
1117729401 14:58706507-58706529 CAAACACTCCACTTCCAAAGGGG + Intergenic
1117806981 14:59503928-59503950 AATAATCTCCATTTCCAGAGTGG + Exonic
1120009408 14:79396475-79396497 CAAATTCAGTACATCCAGAGCGG + Intronic
1121103078 14:91263514-91263536 CAGAATCACCTCTTCCAGGAAGG - Intergenic
1122662403 14:103306289-103306311 CAAAATCACTCTTTGCAGAGTGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1127750005 15:62027978-62028000 CAAAACCACCGCTATCAGAGAGG + Intronic
1128958901 15:71979091-71979113 CAAAATCACTATTTGCAGATTGG - Intronic
1130151278 15:81313552-81313574 GAAAATCAGCAGGTCCAGAGAGG - Intronic
1131395215 15:92080299-92080321 AAAAATCACCTTTTCCATAGGGG - Intronic
1135707183 16:24685067-24685089 CAAACTCAGGGCTTCCAGAGGGG + Intergenic
1136739657 16:32505519-32505541 CAAAATGTCCACTCACAGAGTGG + Intergenic
1137347217 16:47675290-47675312 CAGAATCACCACATCCAACGAGG - Intronic
1137931386 16:52590971-52590993 AACAATGACCACTTCCAGACCGG + Intergenic
1137943326 16:52710106-52710128 CAAAATCAGCACCCCAAGAGAGG + Intergenic
1138639579 16:58373646-58373668 GAAATTCAGCATTTCCAGAGGGG + Intronic
1139868525 16:70084096-70084118 AAAAATTTCCACTTCCATAGAGG - Intergenic
1140668417 16:77249621-77249643 CAAGATCCTAACTTCCAGAGAGG + Intronic
1140684775 16:77422910-77422932 CAAAAACAACTCTCCCAGAGAGG + Intronic
1141618907 16:85226189-85226211 CGAAACCACCACTGGCAGAGAGG + Intergenic
1203013259 16_KI270728v1_random:321818-321840 CAAAATGTCCACTCACAGAGTGG - Intergenic
1203031594 16_KI270728v1_random:594977-594999 CAAAATGTCCACTCACAGAGTGG - Intergenic
1203040127 16_KI270728v1_random:739454-739476 CAAAATGTCCACTCACAGAGTGG + Intergenic
1144008385 17:11122410-11122432 TAAAAAGACCACTTCCAGAGGGG + Intergenic
1153086303 18:1292296-1292318 AACAACCACCACCTCCAGAGAGG - Intergenic
1153610582 18:6880362-6880384 CCACAGCACCACTTCCAGGGAGG - Intronic
1156860674 18:41832678-41832700 CTAACTCACCACTTCCAGAAGGG + Intergenic
1157785845 18:50481886-50481908 CAAAACCACCCCTCCCACAGTGG - Intergenic
1160889107 19:1367794-1367816 CAAAATGAGTATTTCCAGAGGGG - Intronic
1165725375 19:38109250-38109272 CAAAATCACATCTTCCATGGTGG + Intronic
1166771458 19:45285504-45285526 CAGAAGCACCACTTCCCGTGTGG - Intronic
928193052 2:29191630-29191652 CAAAAGCATCACTTTCAGCGTGG - Intergenic
930239001 2:48916319-48916341 CAAAATCACCTTCTCCAGGGAGG - Intergenic
930432688 2:51300507-51300529 AAAGATTACCACTTCCAGTGTGG - Intergenic
931388187 2:61816078-61816100 CACAATCCCCACTCCCTGAGAGG + Intergenic
939090560 2:137775672-137775694 ATAAAACCCCACTTCCAGAGAGG - Intergenic
941394858 2:164961773-164961795 CAAAACTACCACTTTGAGAGAGG - Intergenic
941414537 2:165203612-165203634 ATAAATCACCATTTCCAGACAGG + Intronic
942140292 2:172970474-172970496 AATAGTCACCACTGCCAGAGAGG + Intronic
942266798 2:174235598-174235620 CAAAGTCACCATTCCAAGAGGGG + Intronic
945227522 2:207547266-207547288 CAAAATCACTACATCCAAATGGG - Intronic
945837618 2:214851465-214851487 CCAACACACCACTTCCTGAGAGG - Intergenic
946228490 2:218277509-218277531 CAAAATCACCACTTCCAGAGGGG + Intronic
946238939 2:218342131-218342153 GAAACTCACCACAGCCAGAGAGG - Exonic
947493230 2:230613872-230613894 CATAAACCCCATTTCCAGAGAGG - Intergenic
948851410 2:240709027-240709049 AGAAATCACTAGTTCCAGAGCGG - Intergenic
1172218163 20:33251262-33251284 GAACATCACCACTGCCTGAGGGG - Intergenic
1172411097 20:34723640-34723662 CAACATCACCACTGCCACGGTGG + Intronic
1172995458 20:39066942-39066964 CAAATTCAGCAGTTCCCGAGTGG + Intergenic
1174549786 20:51354067-51354089 CAAAAACACCATCTCAAGAGAGG + Intergenic
1175301433 20:57946016-57946038 CAAAATGAGCACTTGCAGAATGG - Intergenic
1175638915 20:60610384-60610406 CAAAATCCCCACTTTCCGACTGG + Intergenic
1177427377 21:20940948-20940970 CTAAATCAACACTTCCTGACGGG + Intergenic
1177636406 21:23792765-23792787 TAAAATCCCCATTTCCAGTGTGG - Intergenic
1178631213 21:34263116-34263138 CAACATTAACACTTCCAAAGTGG + Intergenic
1180487463 22:15816197-15816219 CAAAAGCCCCACTGTCAGAGGGG + Intergenic
1184342902 22:43895853-43895875 CCACATCTCCACTTGCAGAGGGG - Intergenic
949454409 3:4223716-4223738 CATAATCACCATTTGGAGAGAGG - Intronic
950525624 3:13521082-13521104 CAGAAGCCCCACTCCCAGAGGGG + Intergenic
950833084 3:15894307-15894329 TAAAATCACCACTGCCAGACAGG - Intergenic
952297919 3:32077395-32077417 CCAATTCACCACTTTTAGAGAGG - Intronic
952315626 3:32229780-32229802 CAGATTCACCACGTCAAGAGAGG + Intergenic
953736938 3:45503083-45503105 CAAAATCACCTCTAGCAGAGAGG - Intronic
954857678 3:53660626-53660648 CAAACCCACCACTTTCAGAGGGG - Intronic
955482777 3:59406205-59406227 CAAAATAACCTCTTCCTTAGGGG - Intergenic
956668170 3:71661452-71661474 CAAAGTCATGACTTCCTGAGAGG - Intergenic
957791163 3:84942788-84942810 AAAAATGACCATTTGCAGAGGGG + Intergenic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
964748721 3:160035473-160035495 AAAAATCACTACTTCCAGGCTGG + Intergenic
966623114 3:181987033-181987055 CAACATCAGAACTTCCAAAGTGG + Intergenic
968377675 4:57108-57130 CATAAGCCCCACTTTCAGAGTGG + Intronic
968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG + Intronic
970168755 4:13267285-13267307 CATATTCTCCACTCCCAGAGTGG + Intergenic
970573953 4:17409386-17409408 GAAGATCAGCATTTCCAGAGAGG - Intergenic
972431539 4:38987721-38987743 CATAATCACCACTACCACACAGG - Intronic
976329539 4:83813490-83813512 CAATATCCCCAATTCCAGGGTGG - Intergenic
976565742 4:86548757-86548779 CAAAATCACCAGGGTCAGAGTGG - Intronic
979078173 4:116300917-116300939 TAAAATCTGCACCTCCAGAGTGG - Intergenic
979210009 4:118089008-118089030 CAATATCACAAATTCCAGATAGG - Intronic
979394155 4:120165523-120165545 CAAAATCTCCATCTGCAGAGCGG + Intergenic
981540378 4:145840296-145840318 CAAAAGCACCACATCTAGAGGGG + Intronic
981807815 4:148737330-148737352 CAAAAGCAACCCTTTCAGAGAGG - Intergenic
984325235 4:178242244-178242266 CAAGATGACCATTTGCAGAGAGG + Intergenic
984455028 4:179955181-179955203 AAAAATCACCTTTTCCAGAGAGG - Intergenic
985008905 4:185562365-185562387 CAAAAGCACCACCTCTAGAGTGG + Intergenic
986858048 5:11894465-11894487 TAAAATGCCCACTTCCATAGTGG - Intronic
987907227 5:24092296-24092318 TAAAACCACCACTTCCAGAAAGG + Intronic
989852402 5:46230647-46230669 CAAAATGTCCACTTGCAGAATGG - Intergenic
992075733 5:73191209-73191231 CAAAATCAGCATTTCCAATGTGG + Intergenic
993061339 5:83042560-83042582 CAAAATCACCAGGTGCTGAGAGG + Intergenic
996702663 5:126465750-126465772 CAAAATCAGCGCTTTCAGAAAGG - Intronic
997828980 5:137132769-137132791 CAAAAAAAGCGCTTCCAGAGGGG - Intronic
999313433 5:150568746-150568768 CAGAATCTCCTTTTCCAGAGGGG - Intergenic
1001202873 5:169735302-169735324 GAAAGCCACCAATTCCAGAGTGG - Intronic
1002772124 6:298992-299014 CAAGATGACCATTTCCAGGGAGG - Intronic
1008090164 6:47285818-47285840 CAAAGTCACCCCTTGGAGAGAGG - Intronic
1008706795 6:54171102-54171124 CAAATTAACCCCTCCCAGAGAGG - Intronic
1009402900 6:63277373-63277395 CAATATTCCCACTTCTAGAGAGG - Intronic
1011629176 6:89308182-89308204 CAAGATCAGAACCTCCAGAGAGG - Intronic
1011735987 6:90311105-90311127 CACAATCTCCACTCCCAGGGAGG - Intergenic
1015650708 6:135455818-135455840 TAAAATCAAGACTTCCAGAGTGG - Exonic
1016888184 6:148979108-148979130 ATAACCCACCACTTCCAGAGTGG + Intronic
1021650840 7:22831411-22831433 AAAAAAAACAACTTCCAGAGAGG + Intergenic
1025531131 7:61885419-61885441 CAAAATATCCATTTGCAGAGTGG + Intergenic
1025531167 7:61885932-61885954 CAAAATGTCCACTTGCAGAATGG + Intergenic
1025589006 7:62831488-62831510 CAAAATGTCCATTTCCAGAATGG - Intergenic
1025592850 7:62884746-62884768 CCAAATGTCCACTTGCAGAGTGG - Intergenic
1025596746 7:62938309-62938331 CCAAATCTCCACTTGCAGAATGG + Intergenic
1027140032 7:75650320-75650342 CCAAATTACCACTTACAGGGAGG - Intronic
1027889129 7:83948266-83948288 CACTCTGACCACTTCCAGAGAGG - Intergenic
1032387238 7:131533336-131533358 CAGCATCACCTCTCCCAGAGGGG + Intronic
1040534683 8:48298251-48298273 AATAATGTCCACTTCCAGAGAGG + Intergenic
1040903970 8:52445865-52445887 AAGAATCACCACTTCCACATAGG + Intronic
1045239280 8:100384823-100384845 CAAAAGCACCAGTTACAGAGTGG + Intronic
1047530658 8:125671424-125671446 AGAAATCTCCACTTCCATAGTGG + Intergenic
1047635477 8:126756943-126756965 CAGCAACACCTCTTCCAGAGAGG + Intergenic
1052333989 9:27301137-27301159 CAAAATTATAACCTCCAGAGAGG - Intergenic
1053783100 9:41630973-41630995 AAAAATCACCATTGCCTGAGGGG + Intergenic
1054171053 9:61841115-61841137 AAAAATCACCATTGCCTGAGGGG + Intergenic
1054666480 9:67739697-67739719 AAAAATCACCATTGCCTGAGGGG - Intergenic
1056501429 9:87213698-87213720 CAAAAACACCTCTTTCAGGGTGG + Intergenic
1058642551 9:107101538-107101560 AGAAAACACCACTTTCAGAGAGG - Intergenic
1059598051 9:115744437-115744459 CTAAATCATCACTCTCAGAGAGG + Intergenic
1061594080 9:131617545-131617567 CAAACTCATCATTTACAGAGGGG + Intronic
1062101529 9:134731120-134731142 CAGAATCTCCACTGCCAGAGAGG + Intronic
1203571562 Un_KI270744v1:137139-137161 CATAAGCCCCACTTTCAGAGTGG - Intergenic
1186956950 X:14693394-14693416 CAAAATGATCACTTCAATAGGGG + Intronic
1188120671 X:26303295-26303317 TAAAATCACCACTTCCTTATGGG - Intergenic
1192862167 X:75086512-75086534 TAAATTCACCTCTTTCAGAGTGG + Intronic
1194062048 X:89215611-89215633 CAAAAGAACTACTTCCAGAGAGG - Intergenic
1199419452 X:147627388-147627410 CAAAATCATCACTATCACAGGGG - Intergenic
1200715972 Y:6544912-6544934 CAAAAGAACTACTTCCAGAGAGG - Intergenic