ID: 946229038

View in Genome Browser
Species Human (GRCh38)
Location 2:218280359-218280381
Sequence GTGGCGTGGGCTGGGCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 793}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229038_946229054 10 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229038_946229058 29 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG 0: 1
1: 1
2: 5
3: 95
4: 814
946229038_946229056 19 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229056 2:218280401-218280423 CACGATGTAGTGGGGAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 129
946229038_946229057 23 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229057 2:218280405-218280427 ATGTAGTGGGGAAGCCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 255
946229038_946229047 -9 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229047 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 77
946229038_946229048 -8 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229048 2:218280374-218280396 CACGCCACTGGGGGTTCACTGGG 0: 1
1: 0
2: 0
3: 7
4: 48
946229038_946229055 11 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229055 2:218280393-218280415 TGGGGGGTCACGATGTAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
946229038_946229051 -5 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229051 2:218280377-218280399 GCCACTGGGGGTTCACTGGGGGG 0: 1
1: 0
2: 2
3: 17
4: 173
946229038_946229049 -7 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229049 2:218280375-218280397 ACGCCACTGGGGGTTCACTGGGG 0: 1
1: 0
2: 0
3: 6
4: 74
946229038_946229053 9 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229053 2:218280391-218280413 ACTGGGGGGTCACGATGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
946229038_946229050 -6 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229050 2:218280376-218280398 CGCCACTGGGGGTTCACTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229038 Original CRISPR GTGGCGTGGGCTGGGCACAC AGG (reversed) Intronic
900031058 1:373552-373574 GTTGGGGGGGGTGGGCACACAGG + Intergenic
900098026 1:948269-948291 GAGGCTGGGGCTGGGCACTCAGG + Intronic
900142561 1:1144799-1144821 GTGGTGTGTGCTGTGCAGACGGG + Intergenic
900242579 1:1624089-1624111 GTGCCATGGGCAGGGCACAGAGG + Intronic
900407470 1:2498902-2498924 GAGGCCTGGGCAGGGCACCCGGG - Intronic
900457183 1:2782872-2782894 CAGGCCTGGGCTGAGCACACAGG + Intronic
900484035 1:2913101-2913123 GAGGCCTGGGCTGGGGCCACTGG - Intergenic
900647924 1:3717364-3717386 GTGGGGAGGGATGGGCACAGTGG + Intronic
900702738 1:4058332-4058354 GCCGCGTGGGCGGGACACACGGG - Intergenic
900919691 1:5662453-5662475 GTGGGCAGGGCTGGCCACACGGG + Intergenic
900934770 1:5758358-5758380 GTGGCTTGGGCCGGGCACTCAGG - Intergenic
901016557 1:6235374-6235396 GTGGGTGGGGCTGGGCGCACAGG - Intronic
901334743 1:8439783-8439805 ATGGTGTGAGCTGGGCACAGTGG + Intronic
901493725 1:9609620-9609642 GAGGCTTGGGCTGGGCGCAGTGG - Intronic
901513967 1:9732901-9732923 GTGTCTTTGGCTGGGCACAGTGG + Intronic
901823667 1:11846899-11846921 GGGGGGGGGGCTGGGCACAGTGG - Intronic
902439213 1:16418328-16418350 GTGGCGTGATCTCGGCTCACTGG + Intronic
902922435 1:19674691-19674713 GTGGTTTAGGCTGGGCACAGTGG - Intronic
903613152 1:24631738-24631760 GTGGCCTTGGCTGGGCTCAGTGG - Intronic
904014664 1:27410134-27410156 ATGGCTTGGGCTGACCACACTGG + Exonic
904028003 1:27516973-27516995 GGGGCATAGGCTGGGCACAGTGG + Intergenic
904646119 1:31967894-31967916 TGGGCATGGGCTGGGCACAGTGG + Intergenic
904815528 1:33194246-33194268 GTGCAGTGGGCTGGGCACGGTGG + Intergenic
904971981 1:34426438-34426460 GTTGTGTAAGCTGGGCACACAGG + Intergenic
905172947 1:36119735-36119757 GTGGTGGGGGCTGTGGACACTGG + Intronic
905529031 1:38661831-38661853 GGAGGGTGGGCTGGGCACAGTGG + Intergenic
905655567 1:39684255-39684277 GTGGCGGGGGCAAGGCACCCGGG - Intronic
906172045 1:43734595-43734617 GTTAGGTGGGCTGGGCACAGTGG - Intronic
906481896 1:46204535-46204557 TTGGCACAGGCTGGGCACACAGG - Intronic
906530563 1:46521434-46521456 ATGGGGTGGGCTGGGCACTGTGG - Intergenic
906921164 1:50065852-50065874 ATGGCCTTGGCTGGGCTCACTGG + Intronic
907078412 1:51598704-51598726 GTGACATGGGCTGGGCACGGTGG + Intronic
907095502 1:51775896-51775918 GTGGTGGAGGCTGGGCATACTGG - Intronic
907401697 1:54228629-54228651 CCGGCCTTGGCTGGGCACACAGG - Intronic
907929154 1:58982843-58982865 GTGGCCTCAGCTGGACACACTGG + Intergenic
908161632 1:61414268-61414290 GTGAAGTGGGCTGGGCACAGTGG - Intronic
908246714 1:62233183-62233205 CTGACCTGGGCTGGGCACGCTGG - Intergenic
909666729 1:78142582-78142604 GAGGTGTGGGGTGGGAACACTGG + Intergenic
910238416 1:85060136-85060158 GTGGGTTGGGCTGGGGACAGAGG + Intronic
910290460 1:85595573-85595595 CTGGATTGGGCTGGGCACAGTGG + Intergenic
910369085 1:86497013-86497035 GTGGCATGGGCTGGGCACGGTGG - Intronic
910964717 1:92796806-92796828 GTGGTGGGGGCTGGGCACAGTGG + Intergenic
911044752 1:93619231-93619253 ATGGCTTTGGCTGGGCACAGTGG - Intronic
911089779 1:94009330-94009352 GTGGAGTTGGCAGGGCAGACTGG - Intronic
911599603 1:99833787-99833809 GTGACGTAGGCTGGGCGCAGTGG + Intergenic
911697795 1:100912534-100912556 TTTGTGTGGGCTGGGCACAGTGG + Intronic
912350255 1:109005585-109005607 GTTGGGTGGGCCGGGCACAGTGG + Intronic
912544953 1:110444008-110444030 GTGGCCTGTGCTGGGAACACTGG + Intergenic
912757683 1:112337887-112337909 GTAGCCTCGGCTGGGCACAGTGG - Intergenic
912783561 1:112576377-112576399 GGGGTTTGGGCTGGGCACAGTGG - Intronic
912790802 1:112648405-112648427 GTGGCGTGATCTTGGCTCACTGG + Intronic
913314798 1:117540767-117540789 GTGGTGAGGGCTGGGCCCACAGG - Intergenic
914781781 1:150792180-150792202 GTGGCCTGGGCCGGGCGCAGTGG + Intergenic
914833570 1:151189114-151189136 GTGGCTTTGGCCGGGCACAGTGG - Intronic
915195869 1:154189193-154189215 GTGGCTTAGGCTGGGCGCAGTGG + Intronic
915327785 1:155089860-155089882 ATGGGGTCGGCTGGGCACACTGG - Intergenic
915902862 1:159858714-159858736 GTGGTGAGTGCTGGGCACAGGGG - Exonic
916422255 1:164648100-164648122 CTGGGGTGGGCTGGGCACGGTGG - Intronic
917951403 1:180040573-180040595 GTGGTAAGGGCTGGGCACAATGG - Intronic
918153380 1:181818630-181818652 ATGGTGTGGGCTGGGGATACGGG - Intergenic
918463313 1:184797427-184797449 CTGGAGAGGGCTGGGCACAGTGG - Intronic
919704975 1:200668009-200668031 GTGGTTTGGGCTGGGCGCAGTGG + Intronic
919840050 1:201602398-201602420 GTGGCGCGGTCTCGGCTCACTGG + Intergenic
920026926 1:203005847-203005869 GTGGCGTGGCTTGGGCTCAGAGG + Intergenic
920178314 1:204117047-204117069 GTGGTTAGGGCTGGGCAGACTGG + Intronic
920367724 1:205456908-205456930 GCGGGGTGGGCCGGGCACGCCGG - Intergenic
921778023 1:219125530-219125552 TTGGTATGGGCTGGGCACAGTGG - Intergenic
922081846 1:222305114-222305136 GTGGAGTGGGCTAGGCGCAGTGG + Intergenic
922488344 1:225994361-225994383 GAAGCGTGGGCTGGGCACGGTGG - Intronic
922816846 1:228455257-228455279 GTGGCGTGATCTCGGCTCACTGG - Intergenic
922925157 1:229342222-229342244 GGGGCGAGGGCGGGGCGCACCGG + Exonic
923566753 1:235082291-235082313 GTGGCGTGATCTTGGCTCACTGG - Intergenic
923662311 1:235968952-235968974 GTGGCTTGGGCTGGAGTCACGGG + Intergenic
924308882 1:242719731-242719753 CTTGCCTGGGCTGGGCTCACTGG + Intergenic
924641740 1:245839454-245839476 CTGGCCTGGGCTGGGCACAGTGG - Intronic
924707613 1:246512109-246512131 GTGGCTCGAGCTGGGCCCACTGG + Intergenic
1062779143 10:185524-185546 GGGGCGCGGGGTGGGCACAGTGG + Intronic
1062799798 10:370468-370490 GTGCTGTGGGGTGGGCACACTGG - Intronic
1063084998 10:2808896-2808918 GTGGCACTGGCTGGGCACAGTGG + Intergenic
1063458682 10:6202383-6202405 GTGGCGGGGGATGGGCTCACGGG + Intronic
1063796290 10:9517207-9517229 CTGGCCTCGGCTGGGCACAGTGG - Intergenic
1064041343 10:11967840-11967862 CTGGAGTGGGCTGGGCACGGTGG - Intronic
1064131631 10:12714658-12714680 GTGGCGTGATCTCGGCTCACTGG - Intronic
1064315245 10:14249484-14249506 GTGGCATGGGCAGTGCAGACTGG - Intronic
1065788336 10:29237060-29237082 GTGGTATTGGCTGGGCACAGTGG - Intergenic
1066317729 10:34265036-34265058 TTGGCGTAGGCCGGGCACAGTGG - Intronic
1066543833 10:36477830-36477852 GTGGTGTGATCTGGGCTCACTGG + Intergenic
1067419175 10:46131985-46132007 GTGCCATGGGCTGGGCACGGTGG - Intergenic
1067504525 10:46838576-46838598 GTGCCATGGGCTGGGCACGGTGG - Intergenic
1067564795 10:47328921-47328943 GTGACGTGGTGTGTGCACACTGG + Intergenic
1067876307 10:50010813-50010835 GTGCCATGGGCTGGGCACGGTGG - Intergenic
1068159818 10:53249467-53249489 GTGGCTCAGGCTGGGCACAGTGG + Intergenic
1068244429 10:54345741-54345763 GTGGCGTGATCTTGGCTCACTGG - Intronic
1068893980 10:62179498-62179520 GTGGGAAGGGCTGGGCACAGTGG - Intergenic
1069001896 10:63276405-63276427 GTGGCGGGGTCTCGGCTCACTGG - Intronic
1069909913 10:71752642-71752664 GTGGCTGGGGCTGGGCCCGCTGG + Intronic
1070299489 10:75192867-75192889 GCTGCGTGGGCTGGGCGCAGTGG - Intergenic
1070972020 10:80575471-80575493 GGGATGTGGGCTGGGCACAGTGG + Intronic
1071615698 10:87073675-87073697 GTGGCGTGATCTTGGCTCACTGG + Intronic
1072278102 10:93842313-93842335 GTGTGGTGGGAGGGGCACACTGG - Intergenic
1072663413 10:97377165-97377187 GTACCGTGGGCTGGGCACAGTGG - Intronic
1072976507 10:100063406-100063428 GTGGGGATGGCTGGGCACAGTGG - Intronic
1073075738 10:100825057-100825079 CTGGGGTGGGCTGGGCACTGAGG - Intronic
1073306377 10:102505912-102505934 TGGGCCTGGGCTGGGCACAGTGG + Intronic
1073427556 10:103464976-103464998 GGGGAGTGGGCGGGGCACAGAGG - Intergenic
1073463135 10:103677961-103677983 CTGGCTTGTGCTGGGCACAGTGG + Intronic
1074397842 10:113113461-113113483 GCTGCCTGGGCTGGACACACTGG + Intronic
1074583672 10:114745500-114745522 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1075092658 10:119452326-119452348 GAGCCCTGGGCTGGGCACCCAGG + Intronic
1075699731 10:124461707-124461729 GGGGCGCGGCCTGGGCACCCCGG - Intergenic
1075761054 10:124857188-124857210 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1076149349 10:128150052-128150074 GTGTCGCGGGCCGGGGACACAGG - Intergenic
1076401966 10:130190584-130190606 GTGGCCGGGGCAGGGCCCACAGG + Intergenic
1076807775 10:132867778-132867800 GGGGCCGGGGCTGGGCACGCCGG - Intronic
1077237538 11:1488946-1488968 GTGGCGGGGCCAGGCCACACTGG - Intronic
1077359748 11:2135547-2135569 GTGGCGTGAGCGGGGCAGCCAGG + Intronic
1077614887 11:3667502-3667524 GTGGCGCGTGCTGGGCATGCCGG - Exonic
1078127963 11:8586534-8586556 TTGGCTTGGGCTGGACACAGTGG + Intronic
1078578692 11:12522475-12522497 ATGGCGTGGTCTCGGCTCACTGG + Intronic
1078715965 11:13839272-13839294 GTGGTTTGGGCTGGACACAGTGG + Intergenic
1078885486 11:15495885-15495907 GTGGCATGGGCTGGGCTCAAGGG - Intergenic
1079596938 11:22261604-22261626 GTGGCGTGATCTCAGCACACTGG - Intronic
1080624272 11:34014444-34014466 GTGGCATGGGCTGGGCTCCAAGG + Intergenic
1081729706 11:45361678-45361700 ATGTGGTGTGCTGGGCACACAGG + Intergenic
1081922240 11:46789507-46789529 CTGGGCTGGGCTGGGCACAGTGG + Intronic
1082032570 11:47616212-47616234 GTGGGGTGGGCTGGGGGCAGTGG - Intergenic
1082845642 11:57723190-57723212 GTGGCTTGGGCTGGGTACAGTGG + Intronic
1083157076 11:60830048-60830070 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1083160630 11:60852137-60852159 GTGGAGTCGGAAGGGCACACGGG - Exonic
1083682558 11:64358203-64358225 GGGGCGTGGGGTGGACACCCTGG + Intergenic
1083688262 11:64390793-64390815 GTGGTGTGGGATGTGGACACTGG + Intergenic
1083705591 11:64512122-64512144 GGGGCCTGGGCTGAGCACAGAGG + Intergenic
1084195448 11:67521881-67521903 GGGGCATGGGGTGGGGACACAGG - Intronic
1084289126 11:68150618-68150640 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1084376812 11:68783378-68783400 GTGGAGTGGGCTGGGCAGCTGGG - Intronic
1084707338 11:70823030-70823052 GTGGCGTTGGCAGAGCCCACGGG + Intronic
1084864789 11:72046671-72046693 GTAGGGAGGGCTGGGCACAGTGG + Intronic
1084938059 11:72597671-72597693 GAGGCCTGGCCTGGGAACACAGG + Intronic
1084941076 11:72613662-72613684 GAGGAGTGGGCTGGAGACACAGG - Intronic
1085349799 11:75791101-75791123 GTGGAGTGAGCTGGCCAGACAGG - Intronic
1085503731 11:77043646-77043668 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1085531930 11:77197096-77197118 GAGGCGTGGGCAGGGCAGACGGG - Intronic
1085700873 11:78745283-78745305 GTGGCGTGATCTCGGCTCACTGG + Intronic
1087708718 11:101524527-101524549 ATGGCCTGGGCCGGGCACAGTGG - Intronic
1088272816 11:108052371-108052393 GTGGCGTGGTCTCGGCTCACTGG + Intronic
1088972674 11:114787368-114787390 GTGGCGTGGGGTGGGAACGGGGG + Intergenic
1089184104 11:116603220-116603242 GTGGTGTTGGCTGGGCGCAGTGG + Intergenic
1089756765 11:120693017-120693039 GTTGTCTGGGCTGGGCACAGTGG - Intronic
1089858338 11:121566949-121566971 GCTGCATGGCCTGGGCACACAGG - Exonic
1089962081 11:122625165-122625187 ATGGAATGGGCTGGGCACAGTGG + Intergenic
1090301366 11:125643190-125643212 GTGGCCTGGGCCGGGCGCAGTGG + Intronic
1090456797 11:126857223-126857245 GGTGGGTGGGCTGGGCACCCAGG - Intronic
1090623726 11:128586389-128586411 GGGCCGTGGGCTGTGCACAAGGG - Intronic
1090634711 11:128683765-128683787 GCTGCCTGGGCTGGGCACAGAGG - Intergenic
1090998623 11:131889413-131889435 GTGGTGTGTGCTGTGCACTCAGG - Intronic
1091046777 11:132332328-132332350 GTGGGGTGGGCTGCGCAGACTGG + Intronic
1091471990 12:736756-736778 GTGGTCAGGGCTGGGCACAGTGG + Intergenic
1091582276 12:1797130-1797152 GCGGGGTGGGCTCGACACACAGG + Intronic
1091908877 12:4212660-4212682 CTGGCTTGGGCTGGGGGCACTGG + Intergenic
1094324223 12:29219174-29219196 CTAACGTGGGCTGGGCACAGTGG - Intronic
1094650529 12:32371644-32371666 GTGGCGTGATCTTGGCTCACTGG + Intronic
1094808027 12:34109499-34109521 GTGCTGTGGGCTGGGCACAGTGG - Intergenic
1095755137 12:45756677-45756699 GTGGAGGAGGCTGGGCACAGTGG + Intronic
1096376030 12:51111431-51111453 AAGGTGTGGGCTGGGCACAGTGG - Intronic
1096671589 12:53202069-53202091 GGGGCTGGGGCTGGGCACAGTGG + Intronic
1096996932 12:55844107-55844129 GTGGCCTGGGGTAGGCACTCGGG - Intergenic
1097046132 12:56189140-56189162 GGGGCGGGGGCTGGGCTCAGAGG + Intronic
1097722826 12:63041868-63041890 GTGGCCTGGGCTGGGCATTGTGG + Intergenic
1098312833 12:69164707-69164729 GTGGACTGAGCTGGGCACAGTGG - Intergenic
1098936320 12:76483503-76483525 GTGGCATGGTCTCGGCTCACTGG - Intronic
1100415511 12:94369393-94369415 GTGGCGTGATCTCGGCTCACTGG - Intronic
1100642239 12:96492934-96492956 GTGGCATGATCTCGGCACACTGG - Intronic
1100805345 12:98277451-98277473 GTGGAATAGGCTGGGCACAGTGG - Intergenic
1100971139 12:100071436-100071458 GTGGCGTGATCTTGGCTCACTGG - Intronic
1101344739 12:103876381-103876403 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1101768723 12:107728452-107728474 GTGGAGTGGTCTTGGCTCACTGG + Intergenic
1102061769 12:109937988-109938010 GTATCCTGGGCTGGGCACAGTGG - Intronic
1102190505 12:110984376-110984398 GTGGTGGTGGCTGGGCACAGTGG - Intergenic
1102197920 12:111037293-111037315 GTGGTATGGCCTGGGGACACGGG - Intronic
1102206447 12:111094285-111094307 GTGGCCAGGGCTGCTCACACCGG - Intronic
1102336406 12:112084501-112084523 CAGGCGTGGGCGGGGCACAGTGG + Intronic
1102380156 12:112458495-112458517 GTGGTATGGGCCGGGCACAGTGG - Intronic
1102699414 12:114826111-114826133 GTGGGATGGTCTTGGCACACAGG + Intergenic
1102932139 12:116870523-116870545 GTGACATGGGCTGGGCACAGTGG + Intronic
1103293491 12:119866529-119866551 CTGTTGTGGGCTGGGCACAGTGG + Intronic
1103363749 12:120368591-120368613 GGGGGGTGGGCTGGGCCCCCGGG - Intronic
1103546424 12:121704944-121704966 GTGGCGTGGTCTCTGCTCACTGG + Intergenic
1103616857 12:122159200-122159222 GTGGAGTAGGCTGGGCACGGTGG + Intergenic
1103700447 12:122846409-122846431 CTGGCTGGGGCTGGGCACTCAGG + Intronic
1103727850 12:123007633-123007655 GGGGCTTGGGCAGGGGACACAGG - Intronic
1103791301 12:123473454-123473476 GTGGCGTGATCTCGGCTCACTGG - Intronic
1103968983 12:124657902-124657924 GTAGTTTGGGCTGGGCACAGTGG - Intergenic
1104016161 12:124963819-124963841 GTGGCGTGATCTTGGCTCACTGG - Intronic
1104197925 12:126558924-126558946 GTGTCATGGACTGGGCACCCTGG - Intergenic
1104317067 12:127713112-127713134 GTAGCTTAGGCTGGGCACAGTGG + Intergenic
1104672310 12:130689159-130689181 GTGTCCTGGGCCGGGCACAGTGG + Intronic
1104904292 12:132205222-132205244 CTGGGGTGGGCTGGGCTGACAGG - Intronic
1104906879 12:132218257-132218279 GAGGCCTGGGCTGGGAACACAGG - Intronic
1105708941 13:22986664-22986686 GTGGCCTTGGCTGGGCACGGTGG - Intergenic
1105796026 13:23853851-23853873 GCATCGTGGGCTGGGCACAGTGG - Intronic
1108580412 13:51823363-51823385 TTGGCCTGGGCTGGGCACAGTGG - Intergenic
1108652507 13:52495102-52495124 GTGGCGTGATCTTGGCTCACTGG + Intergenic
1108978405 13:56479429-56479451 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1109302569 13:60604357-60604379 GTGGCTTAGGCTGGGCGCAGCGG + Intergenic
1110243593 13:73296106-73296128 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1111322799 13:86651710-86651732 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1112020487 13:95367070-95367092 GTAGCGTTGGCTGGGCACGGTGG - Intergenic
1112512125 13:100019453-100019475 TTGGCCTGGGCTGGGCGCAGTGG + Intergenic
1112533501 13:100227262-100227284 CAGGTGTGGGCTGGGCACAACGG - Intronic
1112559917 13:100503614-100503636 GAGCTGTGGGCTGGGCACAGTGG + Intronic
1112880637 13:104102636-104102658 GTGACATGGGCCGGGCACAGTGG - Intergenic
1113387411 13:109861634-109861656 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1113521939 13:110947560-110947582 GGGGGAGGGGCTGGGCACACTGG + Intergenic
1113705954 13:112433139-112433161 GGGGGAGGGGCTGGGCACACTGG - Intronic
1113819552 13:113203638-113203660 AGGGCGTGGGCAGGGGACACCGG - Intronic
1113856679 13:113450203-113450225 ATGGTGAGGGCTGGGCACAGTGG - Intronic
1113895834 13:113764130-113764152 GGGGCGTGGGCGTGGGACACGGG + Intronic
1114410747 14:22498134-22498156 GATGAGTGGGCTGGGCACAGTGG + Intergenic
1115757677 14:36545476-36545498 GAGGAGTGGGCTTGGCACAAAGG - Intergenic
1117354087 14:54906732-54906754 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1117415504 14:55491721-55491743 GTGGCGTGATCTAGGCTCACTGG + Intergenic
1118537563 14:66785078-66785100 CAGGAGTGGGCTGGGCACAGTGG + Intronic
1118825834 14:69380492-69380514 TTGGGGTGGGCTTGGAACACAGG - Exonic
1118843551 14:69529251-69529273 CAGGAGTGGGCTGGGCACAGTGG + Exonic
1118862761 14:69677486-69677508 GTGGCGTGATCTTGGCTCACTGG - Intronic
1119373590 14:74168993-74169015 CTGGCGTGATCTCGGCACACTGG - Intronic
1119518684 14:75269344-75269366 GAGGGCTGGGCTGGGCCCACAGG - Intergenic
1119881258 14:78101626-78101648 GTGGCATGGGGTGGGCAGGCTGG + Intergenic
1119936138 14:78594009-78594031 GTGGGGTGGCCTGGGGACATGGG - Intronic
1120375287 14:83696736-83696758 TTGCCATGGGCTGGGCACAGTGG - Intergenic
1121245342 14:92457931-92457953 GTGGCGTGGGCCTGGCAGGCTGG + Intronic
1121314384 14:92952418-92952440 GTCCCGTGGGCTGGGAGCACTGG - Intronic
1121691184 14:95877966-95877988 CTAGCATGTGCTGGGCACACAGG - Intergenic
1122088463 14:99322737-99322759 GCGGGGAGGGCTGGGGACACCGG - Intergenic
1122342025 14:101034719-101034741 GGGGCGGGGGCTGGGCGCACTGG - Intergenic
1122367099 14:101200748-101200770 GTGGCTGGGGCAGGGCACCCGGG - Intergenic
1122556780 14:102584829-102584851 GTTTCCTGGGCTGGGCACAGTGG - Intergenic
1122575090 14:102737079-102737101 GAGGCATGGGCTGGGGACCCAGG + Intergenic
1122619543 14:103047223-103047245 GTGGCGTGATCTGAGCTCACAGG - Intronic
1122650704 14:103225015-103225037 GGGGAGTGGGCTCGGGACACAGG - Intergenic
1122773398 14:104106910-104106932 GTGGCTGGGGCTGGGCCCCCAGG - Intronic
1122774251 14:104110242-104110264 ATGGCGGGGGCTCGGCTCACTGG + Intronic
1122987945 14:105221225-105221247 GTGGCCTGGCCTGGGCACTATGG + Intronic
1123111086 14:105867122-105867144 GTGGCCAGGGCAGGGCCCACAGG + Intergenic
1123664743 15:22599383-22599405 GTGGCGTGGACTCAGCTCACTGG + Intergenic
1123676002 15:22710777-22710799 GTGGCGTGGTCTCGGCTCCCCGG + Intergenic
1123752949 15:23372763-23372785 GTGGCGTGGTCTCGGCTCCCCGG - Intergenic
1124107044 15:26748736-26748758 TTGGTTTGGGCTGGGCACAGGGG + Intronic
1124166642 15:27332226-27332248 GTGAAGTGGGCTGGGCACAGTGG + Intronic
1124318575 15:28693818-28693840 GTGGCGTGGACTCAGCTCACTGG + Intergenic
1124558385 15:30748234-30748256 GTGGCGTGATCTCGGCTCACTGG - Intronic
1124564869 15:30803628-30803650 GTGGCGTGGACTCAGCTCACTGG - Intergenic
1124696387 15:31867919-31867941 GGGGCGGGGGCGGAGCACACCGG + Intronic
1125027833 15:35048577-35048599 GTGGTGTGATCTGGGCTCACTGG + Intergenic
1125339387 15:38659884-38659906 ATGGCAGGGGCTGGGCACAGTGG - Intergenic
1125576476 15:40759095-40759117 GTAGCTTAGGCTGGGCACAGTGG + Intergenic
1125639919 15:41222039-41222061 GTGGCGTGATCTTGGCTCACTGG - Intronic
1125728229 15:41879005-41879027 GTGGCGTGATCTCGGCTCACTGG - Intronic
1125774064 15:42195151-42195173 GTAGACTGGGCTGGGCACAGTGG + Intronic
1125785547 15:42313778-42313800 GTGACATGGGCTGGGCACAGTGG + Intronic
1126196034 15:45933211-45933233 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1126919677 15:53507101-53507123 ATAACGTGGGCTGGGCACAGTGG - Intergenic
1127495156 15:59503858-59503880 GTGGCTAGGGCTGGGCACAGTGG - Intronic
1127797519 15:62451367-62451389 GTTGGCTGGGCTGGGCACAGTGG + Intronic
1128271128 15:66310987-66311009 GTGGCGTGATCTTGGCTCACTGG - Intronic
1128398568 15:67254297-67254319 GTGGCCTGGGCTGAGCAGAGCGG + Intronic
1128476276 15:67999502-67999524 GTTGTGTGGGCTGGGCACAGTGG - Intergenic
1129251086 15:74309300-74309322 GTGGAGTGAGCCGGGAACACAGG - Intronic
1129582191 15:76823399-76823421 GTGGTGTGATCTGGGCTCACTGG - Intronic
1129740386 15:77986979-77987001 GTGGTGTGGGCTGGGCGGGCAGG + Intronic
1129792540 15:78350913-78350935 GTGTCCTGAGCTGGCCACACAGG + Intergenic
1129845366 15:78765618-78765640 GTGGTGTGGGCTGGGCGGGCAGG - Intronic
1129883569 15:79023113-79023135 GTGGCGTGATCTCGGCTCACTGG - Intronic
1130204585 15:81864200-81864222 GGGGCCTGGGCTGGGCACGGTGG - Intergenic
1130530936 15:84747954-84747976 GTGGCGTGGGCCTGGCGCTCAGG - Intergenic
1130598470 15:85261747-85261769 GTGGTGTGGGCTGGGCGGGCAGG - Intergenic
1130994268 15:88895317-88895339 GAGGCGTGGGCCGGGCACTGCGG - Intronic
1131116860 15:89801331-89801353 GTGGCTGGGGCTGGGACCACAGG + Intronic
1131708638 15:95027052-95027074 TTGGCTTGGGCTGGGCACGGTGG + Intergenic
1132094572 15:98972579-98972601 GTGCAGTGGGCCGGGCACAGTGG + Intronic
1132142359 15:99406258-99406280 ATGGCGTGGTCAGGGCACACAGG + Intergenic
1132678692 16:1130980-1131002 GTGGGGTGGACAGGGCACAGTGG + Intergenic
1132683851 16:1154147-1154169 CTGGCGTGGGCCGGGCGCGCGGG + Intronic
1132869565 16:2109789-2109811 GTGGCGTTGGCTGAGCCCAGCGG + Exonic
1132929585 16:2451995-2452017 GAGGCCTCAGCTGGGCACACAGG - Intronic
1132945654 16:2530316-2530338 ATGGGGTGAGCAGGGCACACTGG - Exonic
1133292240 16:4730068-4730090 GTGGCACGGGCTCGGGACACAGG - Exonic
1133339734 16:5028520-5028542 CTGGAGAGGGCTGGGCACAGGGG - Intronic
1133485855 16:6217725-6217747 GTTGCATAGGCTGGGCACAGTGG + Intronic
1133632636 16:7636095-7636117 GTAGCTTGGGCTGGGCGCAGTGG - Intronic
1133997512 16:10759484-10759506 GTGGTTGGTGCTGGGCACACTGG + Intronic
1133999734 16:10773627-10773649 GTGGCGTGATCTTGGCTCACTGG + Intronic
1134141249 16:11721378-11721400 GTGGCGTGATCTTGGCTCACTGG - Intronic
1134203301 16:12216699-12216721 GTGGGGTGGGGAGGGCACATGGG - Intronic
1134593514 16:15476448-15476470 GAGATGTGGGCTGGGCACAGGGG - Intronic
1134642143 16:15837820-15837842 GTTGGGAGGGCTGGGCACAGTGG - Intronic
1134717852 16:16365810-16365832 GTGGCGTTGGCTGAGCCCAGCGG - Intergenic
1134956898 16:18386349-18386371 GTGGCGTTGGCTGAGCCCAGCGG + Intergenic
1135035740 16:19075481-19075503 GTCCCGAGGGCTGGGCACAATGG - Intronic
1135284329 16:21180525-21180547 ATGGCTTAGGCTGGGCACAGTGG - Exonic
1136004438 16:27318957-27318979 GTGCCAGGGGCTGGGGACACGGG + Intronic
1136042251 16:27589191-27589213 GTTGCATAGGCTGGGCACAGTGG - Intronic
1136170848 16:28488460-28488482 GAGACCTGGGCTGGGCGCACTGG - Intronic
1136388328 16:29944767-29944789 CTGCCAGGGGCTGGGCACACAGG - Intronic
1136986738 16:35113271-35113293 ATGGAGTTGGCTGGGCACAGTGG + Intergenic
1137787739 16:51151831-51151853 GCGGCGAGGGCTGGGGACCCGGG + Intergenic
1138212655 16:55176169-55176191 GTTGGGAGGGCTGGGGACACAGG - Intergenic
1138420580 16:56896455-56896477 GTGATGTTGGCTGGGCACAGTGG + Intronic
1138908713 16:61369880-61369902 GTGACATGTGCTGGGCACATGGG + Intergenic
1139524463 16:67505730-67505752 GTTGTGTTGGCTGGGCACAGTGG + Intergenic
1140357448 16:74318578-74318600 GTGGAGTAGGCTGGGCGCAGTGG - Intergenic
1140379476 16:74473496-74473518 GTGGCGTGATCTCGGCTCACTGG + Intronic
1140459169 16:75124972-75124994 GAGGAATGGGCTGGGCTCACTGG + Intergenic
1141072843 16:80973668-80973690 GTGGCATGAGCTGAGGACACAGG - Exonic
1141405699 16:83791028-83791050 GGGGAGTGGGCAGGGCACAGTGG + Intronic
1141506782 16:84483235-84483257 AAGGCATGGGGTGGGCACACAGG + Intronic
1142244570 16:88963860-88963882 GAGGCCTGGCCTGGCCACACGGG + Intronic
1142528729 17:564251-564273 GTGGTGTGGGCCAGGCACAGTGG + Intronic
1142699134 17:1649063-1649085 GTGGGGTGGGCGGGGCACCGAGG + Intronic
1142740415 17:1928763-1928785 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1142873893 17:2839249-2839271 GTGGCGTGACCTCGGCTCACTGG - Intronic
1143024060 17:3930559-3930581 GTGGGGTGGGCTGGGGATCCCGG + Intronic
1143090493 17:4446800-4446822 GGGGCGTGGGGGGGGCACCCTGG + Intronic
1143095842 17:4477824-4477846 GTGCCTGGGGCTGGGCACGCTGG + Intronic
1143097978 17:4488715-4488737 GTGGAGTTGGCTGGGCACGGTGG - Intergenic
1143205533 17:5137578-5137600 GTGGCTCGAGCTGCGCACACTGG - Intronic
1143457642 17:7078194-7078216 GTGAGGAGGGCTGGGCACAGGGG + Intronic
1143651021 17:8264413-8264435 CTGGGGCGGGCTGGGCACACAGG - Intronic
1143724898 17:8838021-8838043 GTGGGGAGGGGAGGGCACACAGG + Intronic
1144031118 17:11324412-11324434 GTGGCCTGTGCTGGGCACAGGGG + Intronic
1144114457 17:12073829-12073851 GTGGCGTGATCTCGGCTCACTGG + Intronic
1144779033 17:17798747-17798769 GTGGCGGTGGCTGGGCATACGGG - Intronic
1144783454 17:17819293-17819315 GTGACGTGGGCAGGGCATAAGGG - Intronic
1144955335 17:19016323-19016345 ATAGGATGGGCTGGGCACACTGG - Intronic
1145125961 17:20300272-20300294 GTGGCCTGAGCTGGGGCCACAGG + Intronic
1145173489 17:20679901-20679923 GTGGCATGATCTGGGCTCACTGG + Intergenic
1146116793 17:30147748-30147770 CTGGCCGGGGCTGGGCGCACTGG - Intronic
1146192783 17:30785033-30785055 GTGGTGTTGGCTGGGCACGGTGG - Intronic
1146213905 17:30963293-30963315 GTGGTTTGGGCTGGGCACAGTGG + Intergenic
1146770339 17:35562892-35562914 TTGGCATGGGCTGGGCACGGTGG - Intergenic
1146855396 17:36256158-36256180 GTGGCTCGAGCTGCGCACACTGG + Intronic
1146865225 17:36332217-36332239 GTGGCTCGAGCTGCGCACACTGG - Intronic
1146871302 17:36380069-36380091 GTGGCTCGAGCTGCGCACACTGG + Intronic
1146878662 17:36431151-36431173 GTGGCTCGAGCTGCGCACACTGG + Intronic
1146882610 17:36452297-36452319 GTGGCTCGAGCTGCGCACACTGG + Intergenic
1147068085 17:37932811-37932833 GTGGCTCGAGCTGCGCACACTGG - Intronic
1147074188 17:37980693-37980715 GTGGCTCGAGCTGCGCACACTGG + Intronic
1147079615 17:38012366-38012388 GTGGCTCGAGCTGCGCACACTGG - Intronic
1147085710 17:38060231-38060253 GTGGCTCGAGCTGCGCACACTGG + Intronic
1147095556 17:38136308-38136330 GTGGCTCGAGCTGCGCACACTGG - Intergenic
1147101657 17:38184197-38184219 GTGGCTCGAGCTGCGCACACTGG + Intergenic
1147422199 17:40327427-40327449 GGTGCATGGGCTGGGCCCACAGG + Intronic
1147796885 17:43050319-43050341 ATGGAGAGGGCTGGGCACAGTGG + Intronic
1148374505 17:47130585-47130607 GTGGGGTGGGCTGGGCCCGGTGG + Intronic
1148385098 17:47228716-47228738 GTAGCATGGGCTGGGCACAGTGG + Intergenic
1148437932 17:47696654-47696676 GAGGCCTGGGCTGGGCACCCGGG + Intronic
1148876073 17:50687897-50687919 GTGGGGTGGCCTGGGCTCAGGGG + Intronic
1149543456 17:57485897-57485919 GTGGAGTGGGCTCAGAACACAGG - Intronic
1149846255 17:60010703-60010725 GTGGCTCGAGCTGCGCACACTGG + Intergenic
1150055185 17:62007958-62007980 GTGGCGTGATCTCGGCTCACTGG - Intronic
1150084604 17:62267282-62267304 GTGGCTCGAGCTGCGCACACTGG + Intergenic
1150258221 17:63766710-63766732 ATGACTTGGGCTGGGCACAGTGG - Intronic
1150372854 17:64655834-64655856 GTGGCGTGATCTTGGCTCACTGG - Intronic
1150377162 17:64690967-64690989 GTGGCGCTGGCCGGGCACAGTGG + Intergenic
1151100632 17:71551874-71551896 ATGCCGTGGGCTGGGCACGGTGG + Intergenic
1151356098 17:73559593-73559615 GTGGCGGGGGCGGGGGGCACAGG - Intronic
1151771604 17:76166260-76166282 GTGGGTTTGGCTGGGCACAGTGG - Intronic
1151778871 17:76228633-76228655 GTCACTTGGGCTGGGCACAGTGG + Intronic
1151979387 17:77499579-77499601 GTGGCTTGGGCTGGTCAGAGTGG + Exonic
1152203300 17:78959641-78959663 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1152283162 17:79397193-79397215 GAAGCGTGGGCTGGGCGCAGTGG + Intronic
1152623490 17:81377870-81377892 GTGGAGTGGGCTCTGCCCACGGG - Intergenic
1152672157 17:81615156-81615178 GTGGCGTGATCTTGGCTCACTGG + Intronic
1152948582 17:83212117-83212139 GTTGGGGGGGGTGGGCACACAGG - Intergenic
1153225180 18:2894357-2894379 GTGCAGTGGGCTGGACACTCGGG - Intronic
1153246212 18:3074867-3074889 GTGGCGTGATCTTGGCTCACGGG + Intronic
1153274569 18:3355314-3355336 GTGTCTTTGGCTGGGCCCACTGG + Intergenic
1153907221 18:9672929-9672951 CTGGGGTCGGCTGGGCACAGTGG + Intergenic
1154039853 18:10844129-10844151 AAGGTGTGGGCTGGGCACAGTGG + Intronic
1154131041 18:11737626-11737648 GTGGGGTGGCCCTGGCACACTGG - Intronic
1154145498 18:11863164-11863186 GTGGAGTGGGCTGGGCACGGTGG - Intronic
1154243808 18:12677396-12677418 GTGGCGTGATCTTGGCACAGTGG - Intronic
1154326268 18:13393083-13393105 GTGGGGTGGGAAGGGCACGCCGG - Intronic
1155516728 18:26630620-26630642 CAGACGTGGGCTGGGCACAGTGG - Intronic
1156350538 18:36298011-36298033 GCGGGGTGGGCTGGGCCCCCTGG + Intronic
1157249327 18:46080840-46080862 CTGGCGTGGGCCAGGCACAGTGG + Exonic
1159743342 18:72200524-72200546 GTGATGTGGGCTGGGGACAGAGG - Intergenic
1160386824 18:78501965-78501987 GTGCCTTGGGCTGGGCCCAGAGG - Intergenic
1160535295 18:79588425-79588447 GTGGTGTAGGCTGGGCAGAGTGG - Intergenic
1160750102 19:729916-729938 GCCGTGGGGGCTGGGCACACTGG + Intronic
1160770148 19:827512-827534 GTGGCTTGGGATGGGGAGACTGG + Intronic
1160773851 19:845888-845910 GTGGCGTGATCTCGGCTCACTGG - Intronic
1160802574 19:977147-977169 GTGGCTGGGGGTGCGCACACTGG - Intergenic
1160890323 19:1374305-1374327 GTTACTTGGGCTGAGCACACAGG + Intronic
1160891044 19:1378976-1378998 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1160898103 19:1412257-1412279 GAGGGGCGGGCTGGGCTCACTGG + Intronic
1161166869 19:2792450-2792472 GGGGGGTGGGCTGGGCACGGTGG - Intronic
1161201770 19:3019242-3019264 GTGGCATTGGCTGGGGAGACGGG - Intronic
1161308829 19:3582552-3582574 GCTGTGTGGGCTGGGCACAGTGG + Intergenic
1161356882 19:3824007-3824029 GAGTTGTGGGCTGGGCACAGTGG + Intronic
1161418787 19:4163861-4163883 GTGGTGTGATCTGGGCTCACTGG + Intronic
1161569294 19:5021692-5021714 GTGGCGTGATCTTGGCTCACTGG + Intronic
1161840618 19:6678097-6678119 GTGGCATGGGCGGGGCAGTCGGG + Intronic
1162112014 19:8404532-8404554 GTGGGGTGGGCTGGGGAGACGGG - Intronic
1162212109 19:9100519-9100541 GAGCCCTGGGCTGGGCACAGTGG - Intergenic
1163404474 19:17113635-17113657 GGGGGGTGAGCTGGGCACCCCGG + Intronic
1163459279 19:17426673-17426695 GTGGCCTGGGCCGGGCGCAGTGG - Intronic
1163510193 19:17729946-17729968 TGGGCGTAGGCTGGGCACAGTGG - Intronic
1163611820 19:18305556-18305578 GTGCAGGGGGCTGGGCTCACAGG - Intergenic
1163989162 19:20982497-20982519 GTGGCGTGGTCTGAACTCACTGG + Intergenic
1164117993 19:22240504-22240526 GAAGCGTTGGCTGGGCACAGTGG + Intergenic
1164373095 19:27658489-27658511 CTGGGGTGGGCTGGGCACGGTGG + Intergenic
1164861055 19:31562556-31562578 GTGGCGGGATCTGGGCAAACTGG - Intergenic
1165025417 19:32957520-32957542 TTAGCCTGGGCTGGGCACAGTGG + Intronic
1165313254 19:35040857-35040879 GTGGGTTTGGCTGGGCACAGCGG + Intronic
1165577277 19:36831078-36831100 GTGGCGTGATCTTGGCTCACTGG - Intronic
1165747022 19:38235663-38235685 GTGGCTCAGGCTGGGCACAGTGG + Intergenic
1166697836 19:44864045-44864067 TTGGGGTGGGCTGGGTACAGTGG + Intronic
1166800842 19:45456064-45456086 GGGGGTTGGGCCGGGCACACAGG + Intronic
1166827226 19:45616956-45616978 GTGACCTGGGCTGGGCACGGTGG + Intronic
1167060260 19:47140391-47140413 CGGGCGTGGGCTGGGCACGGTGG - Intronic
1167248023 19:48385504-48385526 GTGGCCTGTGCTGAGCACATGGG - Intronic
1167413439 19:49358173-49358195 GTGGCGTGATCTTGGCTCACTGG - Intronic
1167455896 19:49596648-49596670 GGGGAGTGGGCTGGGTAGACTGG - Exonic
1167865025 19:52318163-52318185 GTGGCGTGATCTCGGCTCACTGG + Intronic
1168020043 19:53602590-53602612 GTGGCGTGATCTTGGCTCACTGG + Intronic
1168043766 19:53779398-53779420 GTGGACAGGGCTGGGCACAGTGG - Intergenic
1168504140 19:56919113-56919135 GTTTTGTGGGCTGGGCACAGTGG + Intergenic
1168567529 19:57437436-57437458 GAAGTGTGGGCTGGGCACAGTGG + Intronic
925171672 2:1754062-1754084 GTGGCCTGGGCTGGAGACCCTGG - Intergenic
925276447 2:2651596-2651618 GTGCCCTGTGCTGGGCAAACAGG + Intergenic
925370239 2:3339659-3339681 GTGGCATGGGCTGGGCGCGGTGG + Intronic
925966865 2:9074619-9074641 GTGGTGACGGCTGGGCACAGTGG + Intergenic
926351974 2:12004129-12004151 TTGGAATGGGCTGGGCACAGTGG + Intergenic
927577999 2:24216466-24216488 GTTGGGTGGGCTGGGCACGGTGG + Intronic
927622559 2:24677283-24677305 GTGGCGTGATCTTGGCTCACTGG - Intronic
927714774 2:25344388-25344410 GTGGTGTGGGCTGGGCACGATGG - Intergenic
927917794 2:26947836-26947858 GTGGAGGGGGCTGGGCTCACAGG + Exonic
928656901 2:33461563-33461585 GTGGCAGGAGCTGGGCACATTGG - Intronic
929195781 2:39182992-39183014 ATGTCTTGGGCTGGGCACAGTGG + Intronic
929989580 2:46774372-46774394 CTGGCTTAGGCTGGGCACAGTGG + Intergenic
930008345 2:46915603-46915625 GGGGCGCGGGCTGGGCCCCCAGG - Intronic
930104720 2:47630948-47630970 GTTTAGTGGGCTGGGCACAGTGG + Intergenic
930319426 2:49835578-49835600 GTGGCATGGGCTGGGCGCAGTGG - Intergenic
930792803 2:55352143-55352165 GGTGTGTGGGCTGGGCACAGTGG + Intronic
930812809 2:55560489-55560511 GTGGCCTGGGCTGGGCACAGTGG + Intronic
931405759 2:61976885-61976907 GTGGTGTGGTCTCGGCTCACTGG + Intronic
931519728 2:63082466-63082488 GTGGTGATGGCTGGGCACAGTGG - Intergenic
932285646 2:70529627-70529649 GTGGCTGGGGGAGGGCACACCGG + Intronic
933644467 2:84799273-84799295 GAGGGGTGGGCTGGGCGCAGTGG - Intronic
934691949 2:96368367-96368389 ATGGCTTTGGCTGGGCACAGTGG + Intronic
934734234 2:96680811-96680833 GTGGGGTGGGGTGGGCACAGGGG - Intergenic
934750588 2:96791342-96791364 GTGGCATCGGCTGGGTACAGTGG + Intronic
934865306 2:97804375-97804397 AGGGGGTGGGCTGGGCACAGTGG + Intronic
935213065 2:100954934-100954956 GTGGCGTGATCTCGGCTCACTGG + Intronic
936084339 2:109456217-109456239 CTGGCGTTGGCTGGGCAGAAGGG + Intronic
936348782 2:111696773-111696795 CAGGCGTGGGCTGGGCACGGTGG + Intergenic
937116276 2:119407222-119407244 GTGGACTTGGCTGTGCACACTGG - Intergenic
937319686 2:120953700-120953722 GCTGGGTGGGCTGGGCACAGTGG + Intronic
937765511 2:125656171-125656193 GTGGCGTGATCTCGGCTCACTGG - Intergenic
938098008 2:128475797-128475819 CTGGGCTGGGCTGGGCACCCTGG - Intergenic
939589251 2:144043346-144043368 GTAGCTTAGGCTGGGCACAGTGG + Intronic
940479678 2:154212529-154212551 ATTGCCTGGGCTGGGCACAGTGG - Intronic
941908041 2:170735892-170735914 TTGGAGTTGGCTGGGCACAGTGG - Intergenic
942253540 2:174068344-174068366 GTGGCGTGATCTCGGCTCACTGG + Intergenic
942442699 2:176052572-176052594 GTCGAGTTGGCTGGGCACAGTGG - Intergenic
942575036 2:177354202-177354224 GTGATATAGGCTGGGCACACTGG - Intronic
944047262 2:195427557-195427579 ATAGCGTAGGCTGGGCACATTGG + Intergenic
944140518 2:196451146-196451168 ATGGGGTAGGCTGGGCACAGTGG + Intronic
944386185 2:199167648-199167670 GTGGGGAGTGGTGGGCACACAGG - Intergenic
945207910 2:207351871-207351893 GTGGCGTGATCTTGGCTCACTGG + Intergenic
945937215 2:215915015-215915037 GTGGTGTGGTCTCGGCTCACTGG + Intergenic
946222197 2:218237484-218237506 GTAGGGTGGTCTGGGCACAGTGG - Intronic
946224741 2:218258238-218258260 TTAGGGTGGGCTGGGCACAGTGG - Intergenic
946229038 2:218280359-218280381 GTGGCGTGGGCTGGGCACACAGG - Intronic
946241428 2:218358279-218358301 CGGGGGTGGGCTGGGCACAGTGG + Intronic
946428602 2:219613134-219613156 GTGGCATTGGCAGGCCACACTGG + Exonic
946555444 2:220851714-220851736 ATGCCGTTGGCTGGGCACAGTGG + Intergenic
946863105 2:224018863-224018885 GTGGCTTGGGCTGGGGATAGAGG - Intronic
947081784 2:226406198-226406220 GTGGCGTGATCTTGGCTCACTGG - Intergenic
947686921 2:232096143-232096165 GTGGCGTGATCTCGGCTCACTGG + Intronic
947797124 2:232901671-232901693 GTGGGGAGGGCCTGGCACACGGG - Intronic
948580747 2:238986045-238986067 GAGGCTTGGGCCTGGCACACTGG + Intergenic
1168777729 20:462231-462253 GGGGCGCGGGCTGGGGACCCGGG - Intronic
1169053311 20:2598693-2598715 GAGACATGGGCTGGGCACAGTGG - Intronic
1169292505 20:4364774-4364796 GTGGGGTGGGCCGGGCGCAGTGG - Intergenic
1170223178 20:13963005-13963027 GTGGCGTGATCTTGGCTCACTGG - Intronic
1170952209 20:20947247-20947269 GGGCCGTGGGCTGGGCACAGGGG + Intergenic
1170973025 20:21134146-21134168 GAGGCGTGAGGTGGGCACAAAGG + Intronic
1171962019 20:31501569-31501591 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1172015565 20:31870632-31870654 GGGCCGTGGGCCCGGCACACTGG - Exonic
1172068843 20:32241499-32241521 GTAACATGGGCTGGGCACAGTGG + Intergenic
1172387385 20:34543730-34543752 GGGGAGTGGGCTGGGCCGACTGG - Intergenic
1172876519 20:38167624-38167646 CTCTCGTGGGCTGGGCACAGTGG - Intergenic
1172890550 20:38260839-38260861 GGCGCGCGGGCTGGGCACAAAGG - Intronic
1173502727 20:43565725-43565747 GTGGCAGGGCCTGGGCACCCTGG + Intronic
1173520002 20:43692292-43692314 CTTCCGTGGGCTGGGCACTCTGG - Exonic
1173602748 20:44307711-44307733 GAGGGGAGGGCTGGGCACAGTGG - Intronic
1173845495 20:46185923-46185945 GCAGGGTGGGCTGGGCACAGTGG + Intronic
1174030123 20:47617011-47617033 GTGGCGCGGTCTTGGCTCACTGG + Intronic
1174063435 20:47847921-47847943 GTGTGGTGAGCTTGGCACACAGG - Intergenic
1174544622 20:51316148-51316170 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1174582281 20:51580367-51580389 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1174610417 20:51793714-51793736 GTGGCTTTGGCTGGGCACGGTGG - Intronic
1174651082 20:52126183-52126205 GTGTTGTGGGCCGGGCACGCTGG - Intronic
1174942025 20:54939843-54939865 ATGGGGTGGGCTGGGCACAGTGG + Intergenic
1175184442 20:57170566-57170588 GTGGCAAGGGGTGGGCACATTGG - Exonic
1175976407 20:62712566-62712588 GTGGAGTGGGCAGGGCTCTCAGG + Intronic
1176082009 20:63278229-63278251 CTGGCGTGGGCCAGGCCCACAGG + Intronic
1176249847 20:64115357-64115379 CTGCCCTGGGCTGAGCACACTGG - Intergenic
1176301292 21:5100245-5100267 GTGGCGGGGGCTGGACACGCAGG - Intergenic
1176413606 21:6462047-6462069 GTGGAGTGGGCAGGGAAGACAGG - Intergenic
1176416234 21:6476501-6476523 ATGACGGGGGCTGGGCACAGTGG + Intergenic
1176426153 21:6549719-6549741 GGGGGGTGGGCTGGGCGCAGCGG - Intergenic
1177706743 21:24715520-24715542 ATGGCTTGGGCTGGGCACGGGGG + Intergenic
1177819608 21:26016855-26016877 TTGGCCTGGGCTGGGCGCAATGG - Intronic
1178469904 21:32883099-32883121 GTGGCTGGGGCTGGGCTCATGGG - Intergenic
1178614449 21:34118800-34118822 ATGGAGTAGGCTGGGCACAGTGG - Intronic
1178966459 21:37124034-37124056 GTGGCTCAGGCTGGGCACAGTGG - Intronic
1179035141 21:37753028-37753050 GTGGGCTGGGCAGGGAACACAGG + Intronic
1179253244 21:39691967-39691989 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1179689104 21:43070370-43070392 GTGGAGTGGGCAGGGAAGACAGG - Intronic
1179691734 21:43084835-43084857 ATGACGGGGGCTGGGCACAGTGG + Intergenic
1179701644 21:43158036-43158058 GGGGGGTGGGCTGGGCGCAGCGG - Intergenic
1179855738 21:44161654-44161676 GTGGCGGGGGCTGGACACGCAGG + Intergenic
1179926934 21:44539947-44539969 TTGGCAGGGGCTGGGCTCACAGG + Exonic
1179929601 21:44558512-44558534 CTGGCAGGGGCTGGGCTCACAGG + Exonic
1179931526 21:44573970-44573992 TTGGCAGGGGCTGGGCTCACAGG - Exonic
1179932646 21:44580393-44580415 TTGGCAGGGGCTGGGCTCACAGG + Exonic
1179934226 21:44592251-44592273 TTGGCAGGGGCTGGGCTCACAGG + Exonic
1179935406 21:44600833-44600855 TTGGCAGGGGCTGGGCTCACAGG - Exonic
1179938435 21:44621429-44621451 TCGGCGGGGGCTGGGCCCACAGG - Intronic
1179939205 21:44627353-44627375 TTGGCAGGGGCTGGGCTCACAGG - Exonic
1179948641 21:44697398-44697420 TTGGCAGGGGCTGGGCTCACAGG - Exonic
1181022050 22:20108639-20108661 GTGGCGTGGTGTGGGCAGAAAGG + Intronic
1181055064 22:20256925-20256947 GTGGAGTGGAATGGGCACCCTGG - Intronic
1181314419 22:21962322-21962344 GGGTGCTGGGCTGGGCACACAGG + Intronic
1181467403 22:23117603-23117625 GTGGCGTGGAGAGGGCCCACTGG + Intronic
1181931136 22:26402575-26402597 TTGGGGTGGGGTGGGGACACAGG - Intergenic
1182550333 22:31097414-31097436 GAGGGGTGGGCTGGGCACAGTGG + Intronic
1182878584 22:33713667-33713689 GTGCCCAGGGCTGGGCACAGTGG + Intronic
1183343713 22:37295680-37295702 GGGGCGAGGGCTGAGCACGCAGG - Intronic
1183441899 22:37827794-37827816 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1183590125 22:38775187-38775209 GGGGCGTGGGTGGGGGACACTGG + Intronic
1183602145 22:38845970-38845992 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1183667531 22:39254222-39254244 GCTGCCTGGGCTGGTCACACTGG - Intergenic
1183750590 22:39718054-39718076 GGACCGTGGGCTGGGCACAGTGG + Intergenic
1183826896 22:40395607-40395629 GGGGCAGGGGCTGGGCACAGTGG - Intronic
1183995034 22:41626694-41626716 GTGGCGTGATCTCGGCTCACTGG + Intronic
1183997928 22:41649877-41649899 ATGGTTTGGGCTGGGCACAGTGG + Intronic
1184066667 22:42125443-42125465 ATGGGCTGGGCTGGGCACACAGG - Intergenic
1184069135 22:42137595-42137617 ATGGGCTGGGCTGGGCACACAGG - Intergenic
1184350291 22:43938982-43939004 GTGGCGTGATCTTGGCTCACTGG + Intronic
1184648049 22:45906784-45906806 GTGGCGTGTGCAGGGCACAGAGG - Intergenic
1184788431 22:46683746-46683768 GTGGAGTGGGCCGGGCGCAGTGG + Intergenic
1185276720 22:49953096-49953118 GAGGAGGGGGCTGGGCACAGTGG + Intergenic
1185323882 22:50216275-50216297 GTGGGGTTGGCTGGGAGCACCGG + Intronic
1185337533 22:50277434-50277456 GTGGCGGAGGCTGGGGGCACAGG - Intronic
1185367392 22:50443087-50443109 GTGGCGTGATCTCGGCTCACTGG - Intronic
950063006 3:10087932-10087954 GAGGCCAGGGCTGGGCACAGTGG - Intronic
950110791 3:10417308-10417330 GTGGCAGGGGCTGGGCAGAGGGG + Intronic
950373944 3:12555020-12555042 GTGGCATGGGCTGGGCGCGGTGG + Intronic
950459202 3:13111215-13111237 GTGGTGAGCCCTGGGCACACTGG - Intergenic
952805300 3:37344158-37344180 GTGGCGTAGCCTTGGCTCACTGG + Intronic
953135276 3:40176608-40176630 GTTGGGTGGGCTGGGCACCCAGG + Intronic
953668521 3:44943435-44943457 GTGCCGTGGGCACAGCACACAGG + Intronic
953837955 3:46363535-46363557 GTGTCTTGGGCTGGGCACAGTGG - Intergenic
953911060 3:46893280-46893302 CTGGGTTGGGCTGGGCACTCTGG - Intronic
954043092 3:47904955-47904977 ATGGTGTTGGCTGGGCACAGTGG - Intronic
954184286 3:48905019-48905041 GTGGAGGAGGCTGGGCACAGTGG - Intergenic
954582425 3:51710279-51710301 GTGTTGTGGGCCGGGCACAGTGG - Intronic
955468137 3:59257784-59257806 GTTGCATGGGCTGTACACACTGG + Intergenic
955535148 3:59915650-59915672 CTAGCCTGGGCTGGGCACAGTGG + Intronic
955686488 3:61554033-61554055 GTGGCGTGATCTTGGCTCACTGG - Intergenic
956021092 3:64933956-64933978 GTGGAAGGGGCTGGGCACAGTGG - Intergenic
956802592 3:72774825-72774847 GTGAAATGGGCTGGGCACAGTGG + Intronic
956822092 3:72963285-72963307 GAGGAGTAGGCTGGGCACAGTGG + Intronic
956833281 3:73074228-73074250 GTGGGATAGGCTGGGCACATTGG - Intergenic
956854472 3:73262418-73262440 GTGGCGTGATCTTGGCTCACTGG + Intergenic
957126403 3:76167001-76167023 GTGGCGTGATCTTGGCTCACTGG + Intronic
958267827 3:91460294-91460316 GTGGCGTGATCTGGGCTCACTGG - Intergenic
958973325 3:100637890-100637912 GTGGGGTGGGCTGAGTAAACGGG - Intronic
959653305 3:108772579-108772601 GTGCAGTGGGCTGGGCACAGTGG - Intergenic
960131590 3:114061863-114061885 GTGGCTTTGGTTGGGCACATTGG - Intronic
960318109 3:116202419-116202441 AGGGTGTGGGCTGGGCACAGTGG - Intronic
960470114 3:118053864-118053886 TTGGAGTGGGCTGGGCACAGTGG - Intergenic
960780001 3:121310321-121310343 CAGGCATGGGCTGGGCACAGTGG + Intronic
961442551 3:126961534-126961556 GTGGGGTGCACTGGGCACCCTGG + Intergenic
961649108 3:128408625-128408647 GTAGAGTGGGCTGGGGCCACGGG - Exonic
961726589 3:128934816-128934838 CAGGTGTGGGCTGGGCACAGTGG - Intronic
961751383 3:129097052-129097074 GTGGCGTGATCTCGGCTCACTGG - Intronic
961765387 3:129206345-129206367 GTGAGGTGGGCAGGGCACAGTGG - Intergenic
961807635 3:129500777-129500799 GGGAAGTGGGCTGGCCACACTGG + Intronic
962271499 3:133980898-133980920 GAGGAGTGGGGTGGCCACACAGG - Intronic
962845199 3:139267707-139267729 GGAGAGTGGGCAGGGCACACTGG + Intronic
963110170 3:141682089-141682111 GTGTGGTGGGCTGGGCACAGTGG + Intergenic
963180349 3:142348925-142348947 GAGCCTTGGGCTGGGCACAGTGG - Intronic
963518160 3:146334353-146334375 GTGGGGGGGGCTGAGTACACAGG + Intergenic
963833329 3:150031912-150031934 GTGGGGTGGGCTGTCCACATAGG - Intronic
964753581 3:160074723-160074745 GTCTCCTGGGCTGAGCACACGGG + Intergenic
967115866 3:186337880-186337902 GTAGAATGGGCTGGGCACAGTGG + Intronic
967212962 3:187185162-187185184 ATGGCGTGGCCTGGGCTCAGAGG - Intergenic
968447283 4:658207-658229 GTGGCGGGGGCAGGTCACCCAGG + Intronic
968513606 4:1005884-1005906 GTGGCGTGATCTCGGCTCACTGG + Intergenic
968517532 4:1021167-1021189 GTGGGGTGGGATGGGGACCCAGG + Intronic
968610941 4:1556743-1556765 GTGGGGCGGGCTGGGGACTCCGG - Intergenic
968911265 4:3477957-3477979 TTGGCGGTGGCTGGGCACAGTGG + Intronic
969078235 4:4597801-4597823 GTGTAGTTGGCTGGGCACAGTGG + Intergenic
969565200 4:7973221-7973243 GAGGTGTCGGCTGGGCACAGTGG + Intronic
971112776 4:23607678-23607700 AAGGAGTGGGCTGGGCACAGGGG + Intergenic
971407419 4:26335238-26335260 GTGGCGTGATCTCGGCTCACTGG + Intronic
971411222 4:26374753-26374775 GTGCCAGGGGCCGGGCACACTGG - Intronic
971820657 4:31550013-31550035 GTGGCATGGTCTCGGCTCACTGG + Intergenic
972312788 4:37896328-37896350 GTGGAGGGGGCTGGGAACAAAGG + Intronic
972421052 4:38886638-38886660 GTAGCCTGGGCCGGGCACAGTGG + Intronic
972572311 4:40321524-40321546 ATGGCGTGGGCTTAGCAGACAGG + Intergenic
972594778 4:40519953-40519975 GTAGGGTGGGCTGGGCACGGTGG - Intronic
973211327 4:47618530-47618552 GAGGCGAGGGCTGGGCGCAGTGG + Intronic
973573716 4:52265303-52265325 GAAGCATGGGCTGGGCACAGTGG + Intergenic
973662371 4:53121283-53121305 CTGGGGTGGGCTGGGAGCACAGG + Intronic
973947193 4:55970157-55970179 GAGGACTGGGCTGGGCACAGTGG - Intronic
973969838 4:56202302-56202324 GTGGCGTGATCTTGGCTCACTGG + Intronic
976110513 4:81668365-81668387 GTGGCCAAGGCTGGGCACAGTGG + Intronic
976171514 4:82309725-82309747 CTGATGTGGGCTGGGCACAGTGG + Intergenic
976198727 4:82559255-82559277 GTGACAGGGGCTGGGCACAGTGG + Intronic
977039189 4:91993670-91993692 GTGGCGTGATCTCGGCTCACTGG - Intergenic
978564274 4:110065337-110065359 TTGGGCTGGGCTGGGCACAATGG + Intronic
979297221 4:119047344-119047366 GTTTCATGGGCTGGGCACAGTGG - Intronic
979533620 4:121795192-121795214 CTGGAGGGGGCTGGGCACAGTGG + Intergenic
980051509 4:128044525-128044547 GTGGCGTGATCTCGGCTCACTGG - Intergenic
981084134 4:140665969-140665991 TTTGTGTGGGCTGGGCACAGTGG - Intronic
983482862 4:168296929-168296951 GTGGCATGATCTGGGCCCACAGG + Intronic
984040059 4:174721085-174721107 GTGGTGTGATCTTGGCACACTGG + Intronic
984925076 4:184799402-184799424 GGGTAGTGGGCTGGGCACAGTGG - Intronic
984940287 4:184925483-184925505 GTGGCTGGGGCTGGGCGCAGTGG + Intergenic
985505635 5:278768-278790 GGGGAGAGGGCTGGGGACACAGG + Intronic
985677760 5:1241064-1241086 GGGGCGCGGCCTGGCCACACTGG + Intronic
985792218 5:1935455-1935477 AAGGCGTGTGCTGGGCACTCAGG + Intergenic
985843130 5:2324569-2324591 GTGCCGGGGCCTGGGCACATGGG + Intergenic
986031385 5:3896227-3896249 ATGGCTTGGGCTGGGGACATGGG + Intergenic
986476627 5:8140833-8140855 ATAGAGTGGGCTGGGCACAGTGG - Intergenic
986611509 5:9572587-9572609 GTGGCATGATCTGGGCTCACTGG - Intergenic
987096747 5:14557127-14557149 GTGGCGTGATCTCGGCTCACTGG + Intergenic
988529757 5:32017147-32017169 ATGGCCTGGGCCGGGCACAGTGG + Intronic
988820350 5:34877709-34877731 ATGGTGTTGGCTGGGCACAGTGG - Intronic
988908337 5:35813203-35813225 TTGTAGTGGGCTGGGCACAGTGG + Intronic
989039826 5:37216254-37216276 GTGGGGTGGGCCAGGCACAGAGG + Intronic
990190052 5:53249505-53249527 GAGGCTTGGGCTGGACATACAGG - Intergenic
991353953 5:65748470-65748492 GTGATGTTGGCTGGGCACAGTGG + Intronic
991653248 5:68877434-68877456 GTGGCGTGATCTCGGCTCACTGG - Intergenic
991916925 5:71614769-71614791 GGGGTCTGGGCTGGGCACAGTGG - Intronic
992058325 5:73015319-73015341 GTGGCGTGATCTGGGCTCACTGG + Intronic
992150349 5:73896364-73896386 GTGGTGTGGGCCAGGCAGACTGG + Intronic
992629559 5:78667297-78667319 TTGGCTTCGGCTGGGCACAGTGG + Intronic
992907237 5:81358560-81358582 TTGGTCTGGGCTGGGCACAGTGG + Intronic
992920363 5:81510473-81510495 TTGGAGTAGGCTGGGCACAGTGG + Intronic
994083205 5:95731159-95731181 GTGGCGGCGGCTGGACACAAAGG - Exonic
995935463 5:117506249-117506271 GTGGCGTGATCTAGGCTCACTGG + Intergenic
996069060 5:119113526-119113548 ATGTCATGGGCTGGGCACAGTGG - Intronic
996124175 5:119706283-119706305 CTGGCGGGGGCAGGGCACAGTGG - Intergenic
997456824 5:134023843-134023865 ATGAAGTGGGCTGGGCACAGTGG + Intergenic
997586216 5:135045169-135045191 GAGGCCTGGGCTGGGCATATGGG - Intronic
997814291 5:137000942-137000964 GTGGCGTGATCTCGGCTCACTGG - Intronic
998089872 5:139359193-139359215 GTGGCGCGATCTTGGCACACTGG + Intronic
998202530 5:140136524-140136546 GTGGCGTGATCTGGGCTCACTGG - Intergenic
998971218 5:147594614-147594636 GTGGCATTAGCTGGGCACAGTGG - Intronic
999107608 5:149087350-149087372 GTGTGGTGGGCCGGGCACAGTGG + Intergenic
999505268 5:152188113-152188135 GTGGAGGAGGTTGGGCACACTGG + Intergenic
999920180 5:156309657-156309679 GTGGCGTGATCTTGGCTCACGGG + Intronic
1000706586 5:164520275-164520297 TTGACAAGGGCTGGGCACACTGG - Intergenic
1000771276 5:165357987-165358009 AAGGCTTGGGCTGGGCACAGTGG - Intergenic
1001059866 5:168479076-168479098 GTGGTGTTGGCTGGGCACGGTGG - Intergenic
1001477812 5:172063609-172063631 CTGGTGAGGGCGGGGCACACAGG - Intronic
1001523200 5:172410001-172410023 GTGGTATGGGCCGGGCACAGTGG - Intronic
1001828546 5:174766186-174766208 GTGCAGTCGGCTGGGCACAGGGG + Intergenic
1002164502 5:177336131-177336153 GGGGAGTGGGCTGGGGACACAGG + Intronic
1002641157 5:180631184-180631206 ATGGGGTGGGCTGGGCACAGTGG + Intronic
1002742762 5:181445316-181445338 GTTGGGGGGGGTGGGCACACAGG - Intergenic
1002842222 6:915950-915972 GGGGCTTGGGCTGGGCGCAGTGG - Intergenic
1003078061 6:2999796-2999818 GGGGTGTGGGCGGGGCTCACGGG + Intronic
1003371305 6:5529591-5529613 GTGACTTAGGCTGGGCACAGCGG - Intronic
1004364248 6:14998728-14998750 CTGGCGTGGGCCGGGCGCAGTGG - Intergenic
1004908720 6:20261108-20261130 ATGGTGTAGGCGGGGCACACAGG - Intergenic
1005484182 6:26283976-26283998 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1005496910 6:26395831-26395853 CTGGGGTGGGCAGAGCACACAGG + Intergenic
1006144443 6:31950074-31950096 GTGGCATGGTTTGGGAACACAGG + Exonic
1006170013 6:32087228-32087250 GTAGTGTGGGCTGGGGCCACGGG - Intronic
1006219159 6:32473424-32473446 CTGGCTTTGGCTGGGGACACCGG - Intergenic
1006307945 6:33236006-33236028 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1006489799 6:34377544-34377566 GTGGAGAGGGCAGGGCACAGTGG + Intronic
1006995174 6:38253053-38253075 GTGGCATGAGCTCGGCTCACTGG - Intronic
1007106380 6:39285944-39285966 CTGGCGTGTGGTGGGCACCCAGG - Intergenic
1007618027 6:43193689-43193711 CTGGCCTGGGCTGGGCACGGTGG - Intronic
1007848439 6:44780361-44780383 GGGGCCTGGGCCGGGCACTCCGG + Intergenic
1008987385 6:57561288-57561310 GTGGCGTGATCTGGGCTCACTGG + Intronic
1009175342 6:60453846-60453868 GTGGCGTGATCTGGGCTCACTGG + Intergenic
1009785110 6:68326780-68326802 GTGAAGAGGGCTGGGCACAGTGG + Intergenic
1010206100 6:73323652-73323674 GAGGCTTGGGCAGGGCCCACAGG + Intergenic
1011702472 6:89968721-89968743 CTGTCTTGGGCTGGGCACAGTGG + Intronic
1012921562 6:105225498-105225520 GTGACAGGGGCTGGGCACAGTGG - Intergenic
1013102131 6:106995952-106995974 GTGGCCTAGGCTGGGCACAGTGG + Intergenic
1013826312 6:114215245-114215267 GTGGCGTGACCTCGGCTCACTGG - Intronic
1015213219 6:130721179-130721201 GTGGCGTGATCTCGGCTCACTGG - Intergenic
1016500703 6:144717920-144717942 GTGGCTCAGGCTGGGCACAGTGG - Intronic
1016827164 6:148399274-148399296 GTGGCGTGATCTCGGCTCACTGG + Intronic
1016892180 6:149017316-149017338 GTGGCGTGATCTCGGCTCACTGG - Intronic
1017521439 6:155206520-155206542 ATGCTGTGGGCTGGGCACAGTGG - Intronic
1017657120 6:156640560-156640582 GAGCCTTGGGCTGGGCACAGCGG + Intergenic
1017735703 6:157361067-157361089 GTGCTATGGGCTGGGCACAGTGG - Intergenic
1017846835 6:158265793-158265815 GTGGGGAGGTCTGGGCACACAGG - Intronic
1018171831 6:161149827-161149849 GTGATCTGGGCTGGGCACAGTGG - Intronic
1018602585 6:165560930-165560952 GTAGCATGGGCTGGGCACAGTGG + Intronic
1018740594 6:166725651-166725673 GGGGGGTGGGGTGGGCCCACGGG + Intronic
1018855155 6:167669599-167669621 GTGGCGAGTGCTGTGCCCACTGG + Intergenic
1018903275 6:168061737-168061759 CTGGGCTAGGCTGGGCACACTGG - Intronic
1019234945 6:170603788-170603810 GAGGTTTGGGCTGGGCACAGTGG - Intergenic
1019291582 7:253070-253092 GTGGCCTGGGCTGGGCAGGGCGG + Intronic
1019471070 7:1221313-1221335 ATGGCGGGGGCTGAGGACACAGG + Intergenic
1020026136 7:4901380-4901402 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1020116361 7:5478542-5478564 GTGGGGTGAGCTGGGAGCACAGG + Intronic
1022680080 7:32536700-32536722 GTGGGGTGGCCTGGGGACCCAGG - Intronic
1023334142 7:39150753-39150775 GTAGATTGGGCTGGGCACAATGG - Intronic
1023666305 7:42526809-42526831 TAGGTGTGGGCTGGGCACAGTGG - Intergenic
1023821563 7:43983394-43983416 GTTGCATGAGCTGGGCACAGTGG + Intergenic
1023925089 7:44662747-44662769 GTGGTATAGGCTGGGCACAGTGG - Intronic
1023975536 7:45027138-45027160 GGGGCTTGGGCAGGGCACACCGG - Intronic
1024700422 7:51899905-51899927 GAGGCCTGGGCTCCGCACACAGG - Intergenic
1026097944 7:67361673-67361695 CTGTGGTGGGCTGGGCACAGTGG + Intergenic
1026208128 7:68277224-68277246 GTGTAGTTGGCTGGGCACAGTGG + Intergenic
1026320781 7:69266077-69266099 TTGGGGTGGGCCGGGCACAGTGG - Intergenic
1026622616 7:71963446-71963468 GCTGTGTGGGCTGGGCACAGTGG - Intronic
1026668175 7:72362672-72362694 GTGGCAGGGACTGGGCACACAGG - Intronic
1026875281 7:73875854-73875876 AAGGCGTGGGCCGGGCACAGTGG - Intergenic
1026909956 7:74085668-74085690 GTGGGGTGGGCAGGGCAAGCTGG + Intronic
1027249578 7:76390528-76390550 TTGGCGCTGGCTGGGCACAATGG + Intronic
1029425428 7:100491170-100491192 GGGGCCAGGGCTGGGCACAGTGG + Intronic
1029546167 7:101211730-101211752 GGGGTGAGGGCTGGGCAGACGGG + Intronic
1029711426 7:102302146-102302168 GTGCCCTGGGCTGGGCACAGTGG - Intronic
1029749825 7:102536815-102536837 GTTGCATGAGCTGGGCACAGTGG + Intergenic
1029767775 7:102635920-102635942 GTTGCATGAGCTGGGCACAGTGG + Intronic
1030092005 7:105866088-105866110 CTGGGGTGGGGTGGGGACACAGG - Intronic
1030473510 7:109998813-109998835 GTGGCATGTGCTGGGCAGAAAGG - Intergenic
1031202188 7:118702370-118702392 GAGGCCAGGGCTGGGCACAGTGG + Intergenic
1032067362 7:128781700-128781722 GGAGTGTGGGCTGGGCACAGTGG + Intergenic
1032174589 7:129612411-129612433 GTGGCGTGGGCTTGTTACCCAGG + Intronic
1032351922 7:131172372-131172394 GTGGCGTGATCTCGGCTCACTGG + Intronic
1032475610 7:132209545-132209567 GAGGAGGGGGATGGGCACACAGG + Intronic
1033587448 7:142784916-142784938 GTGGCGTGATCTTGGCTCACTGG + Intergenic
1033819839 7:145121923-145121945 GTGGTGTGGGCTGAGCGCAGTGG - Intergenic
1034138696 7:148796607-148796629 GTGGGGAGGGCTGTGCAGACGGG + Intronic
1034412428 7:150948306-150948328 GGGGTGTGGAGTGGGCACACTGG + Intronic
1034690423 7:153009313-153009335 GATGCGTGGACTGGGCACTCTGG + Intergenic
1034871047 7:154684154-154684176 GTGTCCTGGGCTGGGCACAGTGG - Intronic
1036148589 8:6277057-6277079 TTGGTGTGGGCTGGGCGCAGTGG - Intergenic
1036158481 8:6364412-6364434 GTTAGGTGGGCTGGGCACAGTGG + Intergenic
1036408806 8:8479404-8479426 GAGACCTGGGCTGGGCACAGTGG + Intergenic
1036813942 8:11887456-11887478 GTGGCGTGATCTTGGCTCACCGG + Intergenic
1036911520 8:12761248-12761270 GAGATGTGGGCTGGGCACAGTGG - Intergenic
1037322772 8:17659407-17659429 GTGATGAGGGCTGGGCACAGTGG + Intronic
1037325823 8:17689150-17689172 GTGGCGTGATCTCGGCTCACTGG - Intronic
1037630083 8:20647869-20647891 GTGGAGTGAGCTGGGCTCTCAGG + Intergenic
1037930604 8:22878042-22878064 GTGGGGAGGGCTGGGGACACAGG - Intronic
1037977352 8:23223122-23223144 GTGGCGTGGTCTCGGCTCACTGG + Intronic
1038074598 8:24057520-24057542 CTGGAGTGGGCTGGGCACAGTGG - Intergenic
1038916587 8:32031233-32031255 CTGGGGTGGCCTGGGCACAGAGG - Intronic
1039248015 8:35631023-35631045 TTGGCCTGGGCCGGGCACAGTGG + Intronic
1039507345 8:38061514-38061536 GTAGCATAGGCTGGGCACAGTGG + Intergenic
1039518489 8:38152249-38152271 AGGGCATGGGCTGGGCACAGTGG + Intergenic
1039547203 8:38418805-38418827 GTGGGGAAGGGTGGGCACACAGG + Intronic
1039965225 8:42279112-42279134 CTGGCCTGGGCCGGGCTCACGGG - Intronic
1040053274 8:43035960-43035982 GCGGGGTGGGCTGGGCGCAGTGG - Intronic
1040288280 8:46111461-46111483 GTGGCGTGGGCAGGCCGCAGAGG - Intergenic
1040303454 8:46200045-46200067 GAGGCGTGGGCGGGCCACATGGG + Intergenic
1040521022 8:48176226-48176248 GTGACCTGTGCTGGCCACACTGG - Intergenic
1040876972 8:52163844-52163866 GTGGAGTGGGCTGCACACCCAGG + Intronic
1041010086 8:53532972-53532994 ATGGAGTTGGCTGGGCACAGGGG + Intergenic
1042855419 8:73261849-73261871 GAAGCGTGGGCTGGGCCCAGAGG - Intergenic
1042886376 8:73556696-73556718 GTGGCGTGATCTTGGCTCACTGG - Intronic
1042918927 8:73902587-73902609 GTCTCATGGGCCGGGCACACTGG + Intergenic
1043256372 8:78142832-78142854 GTGTTGTGGGCTGGGCACGGTGG - Intergenic
1043379350 8:79685923-79685945 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1044359970 8:91271651-91271673 GTGGCGTGATCTTGGCTCACTGG + Intronic
1044841007 8:96336935-96336957 GTGGCGTGATCTCGGCTCACTGG - Exonic
1044880455 8:96718061-96718083 GGGGCATGGCCTGGGCACAGTGG - Intronic
1044970657 8:97616394-97616416 GTGTCTTGGGCTGGGCACGGTGG + Intergenic
1045100852 8:98842712-98842734 GTGGTATTGGCTGGGCACAGTGG + Intronic
1045128051 8:99116317-99116339 GTAGTGTAGGCTGGGCACAGTGG - Intronic
1045306337 8:100959801-100959823 CTGTGGTGGGCTGGGCACAGTGG - Intergenic
1047348727 8:124053300-124053322 GAGCCCTGAGCTGGGCACACTGG + Intronic
1047420969 8:124707937-124707959 GTGGCCTGGGCAGGGAGCACTGG + Intronic
1047434796 8:124827296-124827318 GTGGGCTGGGCCGGGCACAGTGG + Intergenic
1048883626 8:138890723-138890745 TTGTTGTGGGCTGGGCACAGTGG + Intronic
1049380600 8:142313830-142313852 GTGGCGTGATCTCGGCTCACTGG + Intronic
1049504292 8:142986855-142986877 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1049527144 8:143133091-143133113 GTGGAGTGGGCTGGAGACCCTGG - Intergenic
1049585716 8:143431474-143431496 GCGGCGGGGGCGGGGCCCACGGG + Intergenic
1049782017 8:144433495-144433517 GGGGCCCAGGCTGGGCACACAGG - Intronic
1049937967 9:517795-517817 GTGGCGTGATCTCGGCTCACTGG + Intronic
1049990547 9:986830-986852 GTGGCATGGTCTCGGCTCACTGG - Intronic
1050113038 9:2236110-2236132 GTGTCTTTGGCTGGGCACAGTGG - Intergenic
1050475169 9:6033706-6033728 TTGGCCTGGCCTGGGCACAGCGG + Intergenic
1051244767 9:15098595-15098617 GTGGCATGGTCTCGGCTCACTGG - Intergenic
1051282928 9:15461216-15461238 GTGGCGTGATCTTGGCTCACTGG + Exonic
1051540172 9:18206874-18206896 GTGGAGTGGGCTTGGCACGGTGG + Intergenic
1053499652 9:38574806-38574828 GTGGTATGGGCTGGGCACAGAGG + Intronic
1054757927 9:68977711-68977733 GTGGCATGGTCTCGGCTCACTGG + Intronic
1055457747 9:76488769-76488791 CTGGCTTAGGCTGGGCACAGTGG - Intronic
1055561717 9:77527920-77527942 GTGGGGTGGGCTGGGCACGGTGG - Intronic
1055575578 9:77657694-77657716 GTGGCGTGAACTCGGCTCACTGG + Intergenic
1056676415 9:88680388-88680410 AGGGCGTGGGCTGGGCACAGTGG - Intergenic
1057148502 9:92775400-92775422 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1057443691 9:95099385-95099407 TTGGCGGGGCCTGGGCACAGGGG - Exonic
1057530044 9:95837163-95837185 TTGTCCTGGGCTGGGCACAGTGG + Intergenic
1057679072 9:97159508-97159530 GTGGTATGGGCTGGGCACGGAGG + Intergenic
1057735232 9:97652287-97652309 ATGCAGTGGGCTGGGCACAGTGG - Intronic
1057882112 9:98800211-98800233 CTGGGCTGGGCTGGGCACAGTGG - Intergenic
1058048135 9:100379340-100379362 GTGTCATGGGCTGGGCACGGTGG - Intergenic
1058061944 9:100506706-100506728 GTGGCATGGTCTCGGCTCACTGG - Intronic
1058427149 9:104884946-104884968 ATGAAGTGGGCTGGGCACAGTGG + Intronic
1059115137 9:111594607-111594629 GTGGCGTGATCTTGGCTCACTGG + Intronic
1059145279 9:111894592-111894614 GTGGCGTGATCTAGGCTCACAGG - Intergenic
1059613275 9:115922013-115922035 ATGGCGTGGTCTTGGCTCACTGG - Intergenic
1060400556 9:123346358-123346380 GTGCAGTGCGCTGGGTACACAGG + Intergenic
1060407725 9:123381195-123381217 GCGGGGTGGGATGGGCACTCAGG + Exonic
1060576831 9:124703493-124703515 GTAGGATGGGCTGGGCACAGTGG - Intronic
1060590089 9:124811026-124811048 GTGGGGTGGGCTGGGCTGAGGGG - Exonic
1060623764 9:125091822-125091844 GAGGCTTGGGCCGGGCACAGTGG + Intronic
1060974949 9:127759501-127759523 GTGGCTCAGGCTGGGCACAGTGG - Intronic
1061089219 9:128417499-128417521 GGGGAGTGGGCAGGGGACACAGG + Intronic
1061553070 9:131349109-131349131 TGGGAGGGGGCTGGGCACACTGG + Intergenic
1061695988 9:132373971-132373993 GTGGCGTGATCTCGGCTCACTGG + Intergenic
1061912209 9:133731256-133731278 GAGGAGTGGGCTGGGAACAGGGG + Intronic
1062127882 9:134874201-134874223 GTTGTTTGGGCTGGGCACAGTGG - Intergenic
1062292843 9:135804997-135805019 CAGCCCTGGGCTGGGCACACTGG - Intergenic
1062329507 9:136031623-136031645 GGGCCGTGGGCCGGGCACAGTGG - Intronic
1062396907 9:136356237-136356259 GTGGGCTGGGCTGGGCTCAGAGG + Intronic
1062491814 9:136808432-136808454 GTGGGGTGCGCTGGGCCCGCCGG + Intronic
1062537688 9:137028055-137028077 GGCGCGTGGGGTGGGCTCACCGG + Exonic
1062660937 9:137632689-137632711 GTGGTCTAGGCTGGGCACAGTGG - Intronic
1203608665 Un_KI270748v1:76534-76556 GTTGGGGGGGGTGGGCACACAGG - Intergenic
1185618550 X:1438222-1438244 GTGGCGTGATCTCGGCTCACCGG - Intronic
1186111051 X:6256386-6256408 CAGGCTTGGGCTGGGCACAGTGG - Intergenic
1186189403 X:7054128-7054150 GTGACGTAGGCTGGGCGCAGTGG + Intronic
1186272763 X:7907304-7907326 GTAGGGTTGGCTGGGCACAGTGG - Intronic
1186448340 X:9651330-9651352 ATGGCTTGGGCCGGGCACAGTGG - Intronic
1187423093 X:19153531-19153553 GGGGCTTGGGCTGGGTACAGTGG - Intergenic
1187940785 X:24378972-24378994 GTGGCATGGTCTCGGCTCACTGG + Intergenic
1189297531 X:39929556-39929578 GTGGGGTGCGCTGGGCGCACCGG + Intergenic
1189326967 X:40118552-40118574 ATGTCTTGGGCTGGGCACAGTGG - Intronic
1190082727 X:47369461-47369483 ATAGAGTGGGCTGGGCACAGTGG - Intergenic
1190136503 X:47804170-47804192 ATGGCTTGGGCTGACCACACTGG - Intergenic
1190242945 X:48671850-48671872 ATGGGGTTGGCTGGGCACAGTGG + Intergenic
1190320415 X:49176495-49176517 GGGGCGTGGCCAGGGCACCCGGG + Intronic
1190485692 X:50922632-50922654 AAGGCATGGGCTGGGCACAGTGG + Intergenic
1192114400 X:68396754-68396776 GTGGCGTGATCTCGGCTCACTGG - Intronic
1192811258 X:74549108-74549130 GTGACATGGGCTGGGCACCGTGG + Intergenic
1195030403 X:100922118-100922140 GGAGCGTGGGCTGGGCACGGTGG - Intronic
1196706912 X:118724875-118724897 GTGGAGTGGCCTAGGTACACAGG + Intergenic
1196887526 X:120262229-120262251 GTGGCGTGATCTGAGCTCACTGG - Intronic
1197143834 X:123148288-123148310 GTGGCGTGATCTTGGCTCACTGG - Intergenic
1197690925 X:129500451-129500473 TTGTTGTGGGCTGGGCACAGTGG - Intronic
1198301786 X:135340692-135340714 GTTTCATGGGCTGGGCACAGTGG - Intronic
1199430492 X:147754038-147754060 GAGGCCTTGGCTGGGGACACTGG - Intergenic
1200688203 Y:6276743-6276765 CTGGAGTTGGCTGGGCACAGTGG + Intergenic
1200769812 Y:7113193-7113215 GTGGCGCCGTCTGGGCTCACTGG - Intergenic
1200840504 Y:7776648-7776670 GTTGGGTGGGCAGGTCACACAGG + Intergenic
1201047064 Y:9897945-9897967 CTGGAGTTGGCTGGGCACAGTGG - Intergenic