ID: 946229043

View in Genome Browser
Species Human (GRCh38)
Location 2:218280367-218280389
Sequence AACCCCCAGTGGCGTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229043_946229059 26 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229059 2:218280416-218280438 AAGCCAGGCAGGAGCAGGTATGG 0: 1
1: 0
2: 10
3: 43
4: 498
946229043_946229054 2 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229043_946229056 11 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229056 2:218280401-218280423 CACGATGTAGTGGGGAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 129
946229043_946229057 15 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229057 2:218280405-218280427 ATGTAGTGGGGAAGCCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 255
946229043_946229055 3 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229055 2:218280393-218280415 TGGGGGGTCACGATGTAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
946229043_946229060 27 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229060 2:218280417-218280439 AGCCAGGCAGGAGCAGGTATGGG 0: 1
1: 1
2: 2
3: 44
4: 403
946229043_946229058 21 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG 0: 1
1: 1
2: 5
3: 95
4: 814
946229043_946229053 1 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229053 2:218280391-218280413 ACTGGGGGGTCACGATGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229043 Original CRISPR AACCCCCAGTGGCGTGGGCT GGG (reversed) Intronic
900205989 1:1432114-1432136 AACTCCCAGGGGCCTGGACTGGG - Intergenic
900353308 1:2247644-2247666 AACCCCAAGTGGCCAGGGCAAGG - Intronic
901046646 1:6400374-6400396 AACAGCCAGTGGCGTGTGCCTGG - Intergenic
901051773 1:6429016-6429038 AACCTCCTGGGGAGTGGGCTGGG + Intronic
901796439 1:11681957-11681979 GTCCCCCAGGGGCGTGGACTCGG + Exonic
902807805 1:18871924-18871946 AGCCCCCAGAGGCCTGGCCTTGG - Exonic
903173560 1:21568033-21568055 AAGCCCCAGTGACCTCGGCTTGG - Intronic
906967771 1:50475574-50475596 GACCCCCAGTGGCGAGTTCTTGG - Exonic
908768245 1:67572960-67572982 ACCCCCCACTGGCATGGGCTGGG - Intergenic
913190992 1:116412869-116412891 CACCCCCATAGGGGTGGGCTGGG + Intergenic
913514250 1:119589427-119589449 AACCCCCAGAGTCAAGGGCTGGG + Intergenic
920920164 1:210292214-210292236 ACCCCCCAGCGGCGGGGGTTGGG + Intergenic
923036497 1:230288280-230288302 AATCCCCAGTGCAGGGGGCTGGG - Intergenic
923077810 1:230625364-230625386 GCCCCACAGTGGCGTGGGCTGGG + Intergenic
1066254427 10:33664798-33664820 AAACCCCAGGGGCTTGGTCTAGG - Intergenic
1066281124 10:33919279-33919301 AACCCCCAAAGGACTGGGCTGGG - Intergenic
1066689291 10:38010786-38010808 AAGCCCCAGTGGGTTGGGCAGGG + Intronic
1069996022 10:72342615-72342637 AGCCCCCACTGGCCTGGGCGGGG - Intronic
1070657858 10:78283483-78283505 GACAACCAGTGGAGTGGGCTGGG - Intergenic
1070774075 10:79099733-79099755 AACCCCCTGTGACTTGGGCTTGG + Intronic
1071669600 10:87596415-87596437 GTCCCCCAGTGGTGTGGGCATGG + Intergenic
1072760782 10:98054844-98054866 AACCCCCAGTGCAGGGTGCTGGG + Intergenic
1074082106 10:110176188-110176210 AAGGGCCAGTGGCCTGGGCTGGG - Intergenic
1074859503 10:117499642-117499664 CACCCTCAGGGGCCTGGGCTGGG + Intergenic
1075163153 10:120042035-120042057 AGCCCCCAGGGTGGTGGGCTTGG + Intergenic
1076142619 10:128091798-128091820 AACCCCAACTAGCCTGGGCTGGG + Intergenic
1076150097 10:128154809-128154831 AACTCCCAGAGGAGGGGGCTGGG - Intergenic
1076328591 10:129647385-129647407 ATCCCCAGGTGGCGTGTGCTGGG + Intronic
1078531076 11:12137173-12137195 AGCCCCGAGGGGTGTGGGCTTGG + Intronic
1083296219 11:61717026-61717048 AAGCCCCACTGGTGTGGGATAGG + Intronic
1083640081 11:64140684-64140706 AACCCACAGTGCTGGGGGCTGGG + Intronic
1085036952 11:73306599-73306621 AACCCCCAGTAGCAAGGCCTCGG - Intergenic
1088522378 11:110712895-110712917 TATCCCCAGTGGGGTGGGGTGGG - Intronic
1089442984 11:118531636-118531658 AGCCCCCAGTGGCGAAGGCACGG - Intronic
1090567070 11:128006488-128006510 AAGCCCTGGTGGCATGGGCTCGG - Intergenic
1091128050 11:133119512-133119534 AATTCCCAGTGCCCTGGGCTGGG - Intronic
1091672461 12:2462142-2462164 ACCCCACAGTGGGGTGAGCTTGG - Intronic
1104943601 12:132406001-132406023 AACCCGCAGGGCCCTGGGCTGGG + Intergenic
1105455654 13:20538907-20538929 AACCCCCAGTGGAGATGGCTGGG - Intergenic
1113639267 13:111945451-111945473 AAGCCCCAGTGCAGTGGGCACGG - Intergenic
1113741652 13:112715793-112715815 ATTCCCAAGTGGCTTGGGCTTGG + Intronic
1118271378 14:64345787-64345809 AACCCACAGTGGCTAGGGATGGG - Intergenic
1120751539 14:88202947-88202969 AACCCTGAGTGGGGTGGGCATGG + Intronic
1122888897 14:104723742-104723764 AACCCCGAGTGCCCTGGGCGCGG - Intergenic
1123930890 15:25171193-25171215 AATCCCCACTGGGGAGGGCTAGG + Intergenic
1125762119 15:42103913-42103935 TACCCCCAAGGGCTTGGGCTGGG - Intergenic
1127818661 15:62635929-62635951 AACCCCCAGATCCGTGGCCTTGG + Intronic
1128331815 15:66761013-66761035 AACCTCCAGGGGCGGGGCCTGGG + Intronic
1130952865 15:88605883-88605905 GAGCGCAAGTGGCGTGGGCTGGG - Intergenic
1131290301 15:91101135-91101157 CAGCCCCAGTGGGGTGGGGTGGG + Intronic
1131763397 15:95649407-95649429 AACCCTCAGTGGCATGAGCCAGG - Intergenic
1132623957 16:881230-881252 CACCCCAAGAGCCGTGGGCTGGG + Intronic
1137977597 16:53044325-53044347 AGCCCCCTGTGGGGTGGGCAGGG + Intergenic
1139952271 16:70678210-70678232 AGACCCCAGAGGGGTGGGCTGGG - Intronic
1143476687 17:7207272-7207294 AGGCCCCAGCGGCCTGGGCTGGG + Intronic
1147169173 17:38608154-38608176 CAACCCCAGTGGCTTGGGGTGGG + Intergenic
1147548592 17:41422260-41422282 AACCCCCACTCACCTGGGCTTGG + Exonic
1151816569 17:76474186-76474208 CACCCCCACTGGAGTGGGCAAGG + Intronic
1152310925 17:79549318-79549340 GAGCCCCAGAGGAGTGGGCTGGG - Intergenic
1153893316 18:9537849-9537871 AAAACCCAGTGGACTGGGCTGGG + Exonic
1155471095 18:26193678-26193700 AACCCCGAGTGGGGTGGGGTTGG + Intergenic
1160284278 18:77525737-77525759 AACCTACAGTGTCGTGCGCTAGG - Intergenic
1160770143 19:827504-827526 GAGCCCCAGTGGCTTGGGATGGG + Intronic
1161101627 19:2424590-2424612 AAGTCCCAGGGGCGAGGGCTGGG - Intronic
1162301119 19:9845829-9845851 AGCCCCCAGCGGCCAGGGCTGGG - Intronic
1163334052 19:16660193-16660215 AAGCAACAGTGGCGAGGGCTGGG + Intronic
1163381263 19:16970532-16970554 CACCCCCAGTGGTGTGATCTTGG - Intronic
927251340 2:20997262-20997284 AAGCCCCAGGGACTTGGGCTGGG + Intergenic
930051155 2:47217255-47217277 ATCGCCCAGTGGCAGGGGCTGGG - Intergenic
933997201 2:87678876-87678898 ACCCACCAGTGGTGTGGCCTTGG + Intergenic
934852009 2:97707487-97707509 AACCCCCAGTGGAGAGCTCTGGG - Intergenic
936296650 2:111272034-111272056 ACCCACCAGTGGTGTGGCCTTGG - Intergenic
936519737 2:113204229-113204251 AACCCACAGTGGCCTGGGCCAGG + Intronic
937860689 2:126706652-126706674 CACCCCCTTGGGCGTGGGCTGGG - Intergenic
938565403 2:132514209-132514231 AAAACCAAGTGGCCTGGGCTAGG - Intronic
939956721 2:148533513-148533535 ATCCCCCAGAGGCATGAGCTTGG - Intergenic
946229043 2:218280367-218280389 AACCCCCAGTGGCGTGGGCTGGG - Intronic
946311097 2:218883114-218883136 ATCCCAGAGTGGCTTGGGCTGGG + Intronic
946539241 2:220665751-220665773 AGCCCCCAGTGGTGTGGGTGAGG - Intergenic
1168831440 20:847265-847287 AGCCCCCAGGGGCCTGGGATGGG + Intronic
1172120182 20:32593756-32593778 AACCGCCGGGGGCCTGGGCTGGG + Intronic
1173550593 20:43930596-43930618 CACTCCCAGTTGCTTGGGCTGGG + Intronic
1174040075 20:47693354-47693376 ACCCGCCAGTGGGGTGGGGTGGG + Intronic
1174454252 20:50638410-50638432 AAACCCCAATGGAGTGAGCTGGG - Intronic
1174472586 20:50771635-50771657 AAACCCCAATGGAGTGAGCTGGG + Intergenic
1175625144 20:60483657-60483679 AACCCCAAGTGGGGTCTGCTGGG + Intergenic
1179390301 21:40982852-40982874 AACCCCAAATGGCTTGGGTTTGG - Intergenic
1180050221 21:45327675-45327697 AACACCCAGGGGAGTGGGCCTGG + Intergenic
1182621019 22:31618665-31618687 AGCCCCCAGTGGCGGGGACAGGG - Exonic
1182796584 22:32995482-32995504 AACCAGCAGTGGCTTGGGGTAGG - Intronic
1183154674 22:36065993-36066015 AACGCCCAGTGGCGCGGGCACGG + Intergenic
952942424 3:38454500-38454522 CACCTCCGGGGGCGTGGGCTGGG + Intronic
955996648 3:64686113-64686135 AACTCCCAGTGCCTTGGGCAGGG + Intronic
958481987 3:94654461-94654483 AGGCCCCAGTGGCATGGGTTCGG + Intergenic
961133306 3:124488517-124488539 AACCTCCAGTGGCTTAGGCCTGG - Intronic
962022918 3:131518708-131518730 GACCCCCAGTGGCAAGGACTGGG + Intergenic
962693020 3:137919951-137919973 TACCCCAAGTGGAGTGGTCTAGG - Intergenic
969374040 4:6751240-6751262 AACACCCACGGGCGTGGGCTGGG + Intergenic
969610489 4:8225324-8225346 ACCCCTCTGTGGTGTGGGCTGGG + Intronic
972350114 4:38228927-38228949 AACCCTCAGTGGCGTGGATTGGG - Intergenic
998876393 5:146604546-146604568 TACCCCCAGTGGCTAGGACTGGG - Intronic
999793176 5:154962303-154962325 AAACCCCAGTGGAGAGGCCTAGG + Intronic
1001617717 5:173056505-173056527 AACCCCCAGGGGCCTGGGCTGGG + Intronic
1002207805 5:177575916-177575938 AAACCCCACTGGAGTGGGCCCGG - Intergenic
1003847190 6:10185466-10185488 ATCCCCCAGTGCCCTGGACTTGG - Intronic
1008013542 6:46491991-46492013 CACCCTCAGCGGCCTGGGCTGGG - Intergenic
1012238234 6:96842925-96842947 AACCCTCAGTGGCATAGGATTGG + Intergenic
1017768858 6:157629447-157629469 AACCACAAATGGCGTGGGCTGGG + Intronic
1032237217 7:130135841-130135863 AACCCACAGTGGAGTGGGGGTGG - Intergenic
1034944998 7:155256228-155256250 AACCCCCAGTGTGATGGGCTTGG + Intergenic
1038672017 8:29590321-29590343 AACCCCCCGAGGGGTGGGCATGG + Intergenic
1043524685 8:81083448-81083470 ACTACCCAGTGGCGAGGGCTGGG + Intronic
1060942492 9:127550942-127550964 AACCCCCTGTCCCGTGTGCTGGG + Intronic
1061151339 9:128829871-128829893 ATCGCCCAGGGGCGTGGCCTGGG + Intergenic
1061544869 9:131298796-131298818 AACCCCGAGGGACCTGGGCTAGG + Intronic
1062035232 9:134379941-134379963 AACCCCCAGGGGAGCAGGCTGGG - Intronic
1186569802 X:10702777-10702799 AACCCCCAGTGGGGTTGTATTGG + Intronic
1188748611 X:33878153-33878175 AGCCCTCAGTGGGGTGGGGTAGG - Intergenic
1194004222 X:88470588-88470610 AACCCCCAGTGGTGGGGACTTGG + Intergenic