ID: 946229044

View in Genome Browser
Species Human (GRCh38)
Location 2:218280368-218280390
Sequence GAACCCCCAGTGGCGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 119}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229044_946229055 2 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229055 2:218280393-218280415 TGGGGGGTCACGATGTAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
946229044_946229060 26 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229060 2:218280417-218280439 AGCCAGGCAGGAGCAGGTATGGG 0: 1
1: 1
2: 2
3: 44
4: 403
946229044_946229059 25 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229059 2:218280416-218280438 AAGCCAGGCAGGAGCAGGTATGG 0: 1
1: 0
2: 10
3: 43
4: 498
946229044_946229054 1 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229044_946229053 0 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229053 2:218280391-218280413 ACTGGGGGGTCACGATGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
946229044_946229056 10 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229056 2:218280401-218280423 CACGATGTAGTGGGGAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 129
946229044_946229057 14 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229057 2:218280405-218280427 ATGTAGTGGGGAAGCCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 255
946229044_946229058 20 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG 0: 1
1: 1
2: 5
3: 95
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229044 Original CRISPR GAACCCCCAGTGGCGTGGGC TGG (reversed) Intronic
900174726 1:1286643-1286665 GGACGCCCAGTGGGGTGAGCTGG - Intronic
901077171 1:6562461-6562483 AAAACCCCCGTGGCCTGGGCAGG - Intronic
904612958 1:31735349-31735371 GAGCCCCGAGTGGGGTGGGAGGG + Intronic
908768246 1:67572961-67572983 AACCCCCCACTGGCATGGGCTGG - Intergenic
912501300 1:110123937-110123959 GAATGCCCAGTGGCAAGGGCAGG - Intergenic
913960413 1:143334555-143334577 GAACTCCCCGTGGTGCGGGCGGG - Intergenic
914054769 1:144160128-144160150 GAACTCCCCGTGGTGAGGGCGGG - Intergenic
914124377 1:144806233-144806255 GAACTCCCCGTGGTGAGGGCGGG + Intergenic
918232799 1:182551045-182551067 GAACCCCCAGTGGAGGGGGCTGG - Intronic
919478399 1:198056441-198056463 CGACCCCCAGTGGTGTGTGCAGG + Intergenic
921994038 1:221397481-221397503 GAACTCCTCGTGGCCTGGGCTGG + Intergenic
923077809 1:230625363-230625385 TGCCCCACAGTGGCGTGGGCTGG + Intergenic
1066043828 10:31579361-31579383 GAAGCTCCAGTGGCTTGGACAGG - Intergenic
1066065595 10:31759405-31759427 TAATCCCCAGTGGAGTGCGCAGG + Intergenic
1066689290 10:38010785-38010807 TAAGCCCCAGTGGGTTGGGCAGG + Intronic
1069777455 10:70935257-70935279 GACCCCCCACTGACCTGGGCAGG + Intergenic
1069879230 10:71581349-71581371 GCACCCCCAGAAGCCTGGGCTGG + Intronic
1069996023 10:72342616-72342638 TAGCCCCCACTGGCCTGGGCGGG - Intronic
1070570961 10:77638752-77638774 GAGCCCCCAGTGGGGAGGGGAGG + Intergenic
1070657859 10:78283484-78283506 GGACAACCAGTGGAGTGGGCTGG - Intergenic
1075823876 10:125336964-125336986 GAACCCAGAGTGGTGGGGGCAGG - Intergenic
1075969865 10:126643297-126643319 GAAGACCCTGTGGAGTGGGCTGG - Intronic
1076148468 10:128143885-128143907 GAACCCCCTGTGGCTGGAGCAGG - Intergenic
1076212344 10:128658632-128658654 GAGCCAACAGTGGCCTGGGCAGG + Intergenic
1076328590 10:129647384-129647406 GATCCCCAGGTGGCGTGTGCTGG + Intronic
1076440844 10:130480631-130480653 GAACCCCCTGAGGCCTGAGCAGG + Intergenic
1077136171 11:1000302-1000324 GCACTCCCAGTGGCTGGGGCAGG - Intronic
1084419379 11:69052728-69052750 GGATGGCCAGTGGCGTGGGCGGG + Intronic
1084524658 11:69688389-69688411 GAACCCCCAGTGACCTGTGCTGG - Intergenic
1084524781 11:69689626-69689648 GAACCTCCAGTGACCTGTGCTGG - Intergenic
1084693198 11:70738866-70738888 GAACCCTCTGGGGCCTGGGCAGG - Intronic
1085014312 11:73162908-73162930 GAGCCCCCAGTGGTGTAGGAAGG + Intergenic
1096830841 12:54312803-54312825 AAACTTCCAGTGGCGTGGCCGGG + Intronic
1101829824 12:108248623-108248645 GAACCCAGAGTGGTGGGGGCAGG - Exonic
1105455655 13:20538908-20538930 TAACCCCCAGTGGAGATGGCTGG - Intergenic
1109895048 13:68676259-68676281 GTTCCACCAGTAGCGTGGGCTGG - Intergenic
1110640756 13:77820940-77820962 GAACCCCTAGTGGCAGGGGGTGG - Intergenic
1113693379 13:112327633-112327655 GAGCACCCAGTGGCCAGGGCTGG + Intergenic
1116325854 14:43533329-43533351 GAGCCCACAGTGGGGTGGGGAGG - Intergenic
1120677387 14:87436776-87436798 GAAGCCACAGTAGCATGGGCAGG + Intergenic
1121053210 14:90832805-90832827 GAACCCCAAGAGGATTGGGCTGG + Intergenic
1122980671 14:105191176-105191198 GAACACACAGTGGTGGGGGCAGG - Intergenic
1123010123 14:105345854-105345876 GCAGCCCCAGTGGAGTGGGGTGG + Intronic
1125534141 15:40433515-40433537 GAACTCCCAGTGCTGTGGACTGG - Intronic
1128331814 15:66761012-66761034 GAACCTCCAGGGGCGGGGCCTGG + Intronic
1131290300 15:91101134-91101156 GCAGCCCCAGTGGGGTGGGGTGG + Intronic
1132623956 16:881229-881251 GCACCCCAAGAGCCGTGGGCTGG + Intronic
1132858667 16:2058933-2058955 GGACCCCCAGTGGGATGGGTGGG - Intronic
1132941202 16:2509206-2509228 GAGGACCCAGTGGGGTGGGCAGG - Intronic
1137977596 16:53044324-53044346 GAGCCCCCTGTGGGGTGGGCAGG + Intergenic
1138565698 16:57831251-57831273 GAACCCCCCGTGGGGTTAGCAGG - Intronic
1139448597 16:67013803-67013825 GTACCCGCGGTGGCGCGGGCGGG - Intergenic
1141666143 16:85466346-85466368 GGACCCCCTGGGGAGTGGGCAGG + Intergenic
1141945570 16:87307050-87307072 GAACCCCCAGAGGCAGGGGTCGG - Intronic
1143918586 17:10313049-10313071 GAAACCACAAAGGCGTGGGCAGG + Intronic
1147883001 17:43665801-43665823 GGTCCCCCAGGGGCGTGGGGGGG + Intergenic
1150778313 17:68099557-68099579 GAACCCACAGAGGCGGGGGAAGG - Intergenic
1151808716 17:76423059-76423081 GAATCCCCAATGGCGGGGCCTGG + Intronic
1152573127 17:81129129-81129151 GAATCCCTCGGGGCGTGGGCAGG - Intronic
1152580771 17:81164789-81164811 GAAGTCCCTGTGGGGTGGGCAGG - Intronic
1158931274 18:62326285-62326307 GAACCCGGAGAGGCGTGGGGAGG + Intronic
1160096183 18:75875741-75875763 GAGCCCCGTGTGGTGTGGGCAGG + Intergenic
1160748577 19:723003-723025 CAAACCCGAGTGGGGTGGGCAGG + Intronic
1160770142 19:827503-827525 GGAGCCCCAGTGGCTTGGGATGG + Intronic
1161001957 19:1915046-1915068 GAGCCTCCAGCAGCGTGGGCGGG + Intronic
1161380025 19:3959940-3959962 CAACCCCCAGTGGCTGGGGAGGG - Intronic
1161604395 19:5206675-5206697 GGACCCCCAGTGGGCAGGGCAGG - Exonic
1162646303 19:12052717-12052739 GAACCCGCTGTGGCGGGGCCCGG - Intronic
1163158047 19:15449688-15449710 GGACCCCCCGGGGCGGGGGCGGG - Intronic
1163233864 19:16020157-16020179 GCACCCTCAGTGCCCTGGGCAGG + Intergenic
1166094481 19:40530566-40530588 GAAGCGGCAGTGGCGTTGGCGGG - Intronic
1166879135 19:45916448-45916470 GAACCCCAGGTGCGGTGGGCGGG - Intergenic
1202694250 1_KI270712v1_random:112806-112828 GAACTCCCCGTGGTGCGGGCGGG - Intergenic
927251339 2:20997261-20997283 GAAGCCCCAGGGACTTGGGCTGG + Intergenic
927927392 2:27023541-27023563 GCAGCCCCAGTTGCCTGGGCTGG - Intronic
932398053 2:71461692-71461714 GCACCTGCAGTGGCCTGGGCAGG + Intronic
932453959 2:71834445-71834467 GACTCCCCAGTGGGATGGGCTGG + Intergenic
933234371 2:79848987-79849009 GAAGCCCAAGTGCCGTGGTCAGG - Intronic
933952312 2:87341769-87341791 GAACTCCCCGTGGTGCGGGCCGG + Intergenic
934236554 2:90238108-90238130 GAACTCCCCGTGGTGCGGGCCGG + Intergenic
941074241 2:160989233-160989255 GAACTCCAAGTGGGGAGGGCAGG - Intergenic
944986473 2:205183190-205183212 GAACACCCAGGGGTGTTGGCAGG + Intronic
945823793 2:214696675-214696697 GGACCCCCAGTAGTGTGTGCAGG - Intergenic
946229044 2:218280368-218280390 GAACCCCCAGTGGCGTGGGCTGG - Intronic
1171245647 20:23607877-23607899 GAATCCCCAGTGGCCTGGGATGG + Intergenic
1172120181 20:32593755-32593777 GAACCGCCGGGGGCCTGGGCTGG + Intronic
1175009166 20:55717690-55717712 GAACCCCAAGTGGAGTGTGCAGG + Intergenic
1179112289 21:38457724-38457746 GAGCCACCTGTGGGGTGGGCGGG + Intronic
1180124324 21:45778788-45778810 GACCCCCCAGTAGTGAGGGCAGG + Intronic
1182621020 22:31618666-31618688 GAGCCCCCAGTGGCGGGGACAGG - Exonic
1185040469 22:48501370-48501392 GAACGCCCAGACGCGAGGGCGGG - Intronic
950173065 3:10852599-10852621 GGAGTCCCAGTGGCGGGGGCTGG + Intronic
955996647 3:64686112-64686134 GAACTCCCAGTGCCTTGGGCAGG + Intronic
966348192 3:179001660-179001682 GAACCCCAAGAGTCCTGGGCAGG + Intergenic
968350183 3:198046899-198046921 GAACCCTCAGTGCACTGGGCAGG - Intergenic
969075409 4:4574306-4574328 TAATCCCCAGTGTCGTGGGAGGG + Intergenic
969374039 4:6751239-6751261 GAACACCCACGGGCGTGGGCTGG + Intergenic
970494241 4:16609332-16609354 GAACTCCCAGGGGAGGGGGCGGG + Intronic
972350115 4:38228928-38228950 AAACCCTCAGTGGCGTGGATTGG - Intergenic
981300914 4:143185117-143185139 GGCCCCCCAGCGGCGTCGGCGGG - Exonic
985510807 5:312584-312606 GAACCCCGAGAGGCAGGGGCAGG - Intronic
998339506 5:141404645-141404667 GAACCATCAGTGGGGAGGGCAGG - Exonic
1001617716 5:173056504-173056526 GAACCCCCAGGGGCCTGGGCTGG + Intronic
1006071305 6:31499413-31499435 GGACCTTCAGTGGCGGGGGCGGG - Intronic
1006441940 6:34058551-34058573 GAACCCACAGTCACCTGGGCAGG - Intronic
1008013543 6:46491992-46492014 GCACCCTCAGCGGCCTGGGCTGG - Intergenic
1015719402 6:136225742-136225764 GATCCCCAAGTGTCGTGGGGGGG - Intergenic
1017768857 6:157629446-157629468 AAACCACAAATGGCGTGGGCTGG + Intronic
1019413902 7:918846-918868 GAGCCCCCAGCCGGGTGGGCTGG - Intronic
1027579678 7:79977687-79977709 GAACCCACAGAGGCGGGGGAAGG + Intergenic
1027628538 7:80574687-80574709 GAACCCTCAGTGGTGTGCACAGG + Intronic
1027667497 7:81057566-81057588 GAACCCACAGAGGCGGGGGAAGG + Intergenic
1031752833 7:125598824-125598846 GAGCCCCCAGAGGTGGGGGCAGG + Intergenic
1035221767 7:157410488-157410510 GAACCCCACGGGGGGTGGGCGGG - Intronic
1035243860 7:157550015-157550037 GAACCCCAACTACCGTGGGCAGG + Intronic
1041389415 8:57335707-57335729 GGACCCTCAGAGGCATGGGCTGG - Intergenic
1044575945 8:93769146-93769168 GAACCAACACTGGCGCGGGCAGG + Intronic
1044707739 8:95024934-95024956 GAACCTGCAGGGGCGTGGCCGGG + Intronic
1049275562 8:141718449-141718471 GTTCCCCGAGTGGGGTGGGCGGG + Intergenic
1049721241 8:144116449-144116471 GAACCCACAGTGGCGGCGGAAGG + Exonic
1051879720 9:21827362-21827384 GAAGCCACAGTGGCCTGGACTGG - Intronic
1057187207 9:93063503-93063525 TAGCCCCCAGTTGGGTGGGCAGG - Intronic
1060759171 9:126234085-126234107 GGCCCCGCAGTGGCGTGTGCTGG + Intergenic
1061246400 9:129403042-129403064 GACCCCCATGTGGCCTGGGCAGG + Intergenic
1061612269 9:131754994-131755016 GAATTCCCAGTGGTGGGGGCAGG - Intergenic
1062156447 9:135051470-135051492 GCACCCCCAGTGGCGGTGCCAGG + Intergenic
1062266714 9:135689842-135689864 GAACCCCCAAGGCTGTGGGCTGG - Intergenic
1190220962 X:48512038-48512060 GCACGTCCAGTGGGGTGGGCAGG - Intronic
1193804008 X:85972443-85972465 GAACCCACGGTGGCGGGGGAAGG + Intronic