ID: 946229045

View in Genome Browser
Species Human (GRCh38)
Location 2:218280372-218280394
Sequence CAGTGAACCCCCAGTGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229045_946229053 -4 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229053 2:218280391-218280413 ACTGGGGGGTCACGATGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
946229045_946229056 6 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229056 2:218280401-218280423 CACGATGTAGTGGGGAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 129
946229045_946229055 -2 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229055 2:218280393-218280415 TGGGGGGTCACGATGTAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
946229045_946229059 21 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229059 2:218280416-218280438 AAGCCAGGCAGGAGCAGGTATGG 0: 1
1: 0
2: 10
3: 43
4: 498
946229045_946229057 10 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229057 2:218280405-218280427 ATGTAGTGGGGAAGCCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 255
946229045_946229058 16 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG 0: 1
1: 1
2: 5
3: 95
4: 814
946229045_946229054 -3 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229045_946229060 22 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229060 2:218280417-218280439 AGCCAGGCAGGAGCAGGTATGGG 0: 1
1: 1
2: 2
3: 44
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229045 Original CRISPR CAGTGAACCCCCAGTGGCGT GGG (reversed) Intronic
900529311 1:3144932-3144954 CAGTGAACCCCCAGGGCCTCAGG + Intronic
901717737 1:11170231-11170253 CAATGAACCTACAGTGGAGTAGG - Intronic
903125861 1:21247196-21247218 AAGAGGACCCCCAGTGGCCTGGG - Intronic
904807785 1:33143799-33143821 CAGAGAGCACCCAGTGGCCTGGG + Intergenic
908266298 1:62382520-62382542 CAGTGATCCCAGAGTGGGGTAGG + Intergenic
908355890 1:63324260-63324282 CCCTGAACCCCCAGTGCCGCCGG - Exonic
918232800 1:182551049-182551071 GAGGGAACCCCCAGTGGAGGGGG - Intronic
919727590 1:200894190-200894212 CAGTGGACCTCCTGTGGAGTAGG + Intronic
1063526303 10:6789656-6789678 CAGTGAACCCACAGTGCCCCAGG - Intergenic
1067274306 10:44820480-44820502 TAGTGAAAGCCCAGTGGCATGGG - Intergenic
1077116838 11:889027-889049 CAGTGCACCCCCAGGGCCCTGGG - Intronic
1079530453 11:21446689-21446711 CAGTGAAGTCCCAGTGGTGCTGG - Intronic
1085014310 11:73162904-73162926 CCCTGAGCCCCCAGTGGTGTAGG + Intergenic
1091330365 11:134727228-134727250 CAGGAAGCCCCCGGTGGCGTGGG + Intergenic
1095738614 12:45584955-45584977 CAGTCATCCCCCAGTGGGGCAGG + Intergenic
1100857515 12:98771243-98771265 CAGTGAAGCCTCAGTGTCCTGGG + Intronic
1102489012 12:113277624-113277646 CCTCGAACCCCCAGTGGGGTGGG + Intronic
1118682180 14:68253718-68253740 CAGTAACCCCCCTGTGGGGTAGG + Intronic
1121331490 14:93052555-93052577 AAAGGAACCCCCAGTGGGGTAGG + Intronic
1122160426 14:99780345-99780367 CAGAGAACCCCCAAAGGCTTAGG - Intronic
1123030481 14:105449060-105449082 CTGGGAAGCCCCAGTGGAGTGGG + Intronic
1126432748 15:48603811-48603833 CAGTGAACCCTGAGTGTCCTAGG + Intronic
1132623955 16:881225-881247 CAGTGCACCCCAAGAGCCGTGGG + Intronic
1132747739 16:1443980-1444002 CAGTGGACCCTCAGGGGCATCGG - Exonic
1137225791 16:46506903-46506925 CAGTGAAATCCCAGTGGTGGTGG + Intergenic
1146896918 17:36548859-36548881 GATTGAACCCCCAGAGGCGGAGG + Intronic
1152373947 17:79908306-79908328 CACTGAACACCCACGGGCGTGGG + Intergenic
1157138740 18:45084507-45084529 AAGTCAAACCCCAGTGGCGCCGG - Intergenic
1157787204 18:50494709-50494731 CTCTCAACCCCCAGTGGGGTAGG - Intergenic
1158685535 18:59610852-59610874 CTGTGAATCCCCAGGGGCGCTGG - Intronic
1159794361 18:72823539-72823561 CAGTGAACCCCGAGTGGCCGCGG + Intronic
1163422354 19:17220901-17220923 CAGTGGACCCCCACTGACGTGGG + Intergenic
1167784872 19:51628342-51628364 CAGAGAGCCCCCGGTGGCGTTGG + Intronic
946229045 2:218280372-218280394 CAGTGAACCCCCAGTGGCGTGGG - Intronic
948411659 2:237767334-237767356 TAGTGAAACCCCAGTGGTCTAGG - Intronic
948875335 2:240823949-240823971 CTGTGAGCGCCCAGTGGTGTCGG + Intergenic
1169546499 20:6656197-6656219 CACTGAAACCCCAGAGGCGGAGG + Intergenic
1180232568 21:46436156-46436178 CAGTGAGCGCCAGGTGGCGTGGG - Intronic
1181607579 22:23989732-23989754 CTGGGAACCCCCAGTGGGGAGGG - Intergenic
1184565692 22:45290356-45290378 ATGTGCACCCCCAGGGGCGTGGG + Intronic
950695531 3:14698689-14698711 CAGTGCACTCCCAGTGGTGGTGG - Intronic
951871642 3:27368884-27368906 GAATGAACCTCCAGAGGCGTCGG + Intronic
951916749 3:27809074-27809096 CAGTTAACCCCCAAGTGCGTGGG + Intergenic
953253178 3:41264925-41264947 CAGTGAATCCCCAGTGTGGAAGG + Intronic
954541189 3:51393791-51393813 CAGGCAACCCCCAGTGGGCTTGG + Exonic
955684577 3:61537242-61537264 CAGTTTATCCCCCGTGGCGTTGG - Intergenic
958769237 3:98406935-98406957 CAGTGAAACTCCATGGGCGTAGG - Intergenic
967945188 3:194798475-194798497 CAGTGAGCACCCAGAGGCCTCGG - Intergenic
969512102 4:7623954-7623976 CAGTCACCACCCAGTGGCTTAGG - Intronic
969567269 4:7985911-7985933 CATTGAACCCCCACAGGGGTCGG + Intronic
988117944 5:26920566-26920588 CAGTGCAGTCCCAGTGGCGGGGG + Intronic
1002768625 6:267481-267503 CAGTGAGCCCCCAGTGGCAATGG + Intergenic
1008314806 6:50026474-50026496 CAGTGAAGTCCCAGTGGTGGTGG + Intergenic
1012028716 6:94030345-94030367 CAGTGAAATCCCAGTGGTGGTGG + Intergenic
1012238233 6:96842920-96842942 AAGGGAACCCTCAGTGGCATAGG + Intergenic
1016182304 6:141162223-141162245 CAGTGAGCCCCCAGGGGCCAAGG - Intergenic
1018085549 6:160298160-160298182 CAGTGAATGAACAGTGGCGTGGG + Intergenic
1027038302 7:74942460-74942482 CTGTCATCCCCCAGTGGCTTGGG - Intergenic
1033048353 7:137982362-137982384 TAGTGAACCCCCAGTGCTATGGG + Intronic
1045017341 8:98010796-98010818 CAGAGATCCCCCAGTGCCCTAGG - Intronic
1046150082 8:110212034-110212056 CAGTGCAGCCCCAGTGGTGGTGG + Intergenic
1050458997 9:5861146-5861168 CAGTGAACCCACAATGGCTTAGG + Intergenic
1056702628 9:88923811-88923833 CAGTGAAGCCACAGTGCCGGAGG - Intergenic
1058892013 9:109369497-109369519 CAGTGGAGCCCCAGAGGCCTAGG + Intergenic
1062192629 9:135255726-135255748 CAGGGCACCCCCAGTGCAGTGGG - Intergenic
1195130539 X:101846671-101846693 CAGAGCACCCCCAGTGGGGGAGG + Intronic
1199221300 X:145319078-145319100 CAGTGAAGCCATAGTGGCCTGGG - Intergenic