ID: 946229046

View in Genome Browser
Species Human (GRCh38)
Location 2:218280373-218280395
Sequence CCAGTGAACCCCCAGTGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229046_946229057 9 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229057 2:218280405-218280427 ATGTAGTGGGGAAGCCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 255
946229046_946229059 20 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229059 2:218280416-218280438 AAGCCAGGCAGGAGCAGGTATGG 0: 1
1: 0
2: 10
3: 43
4: 498
946229046_946229060 21 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229060 2:218280417-218280439 AGCCAGGCAGGAGCAGGTATGGG 0: 1
1: 1
2: 2
3: 44
4: 403
946229046_946229055 -3 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229055 2:218280393-218280415 TGGGGGGTCACGATGTAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
946229046_946229053 -5 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229053 2:218280391-218280413 ACTGGGGGGTCACGATGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
946229046_946229058 15 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG 0: 1
1: 1
2: 5
3: 95
4: 814
946229046_946229054 -4 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229046_946229056 5 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229056 2:218280401-218280423 CACGATGTAGTGGGGAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229046 Original CRISPR CCAGTGAACCCCCAGTGGCG TGG (reversed) Intronic
903043648 1:20550754-20550776 AGAGGGAACCCCCAGTGGCAAGG + Intergenic
907415761 1:54312846-54312868 CCAATCAACCCCCACTGGAGGGG - Intronic
911883264 1:103268101-103268123 CCAGTGAGCCCCTAGTGGTGAGG + Intergenic
916771426 1:167912597-167912619 AGAGGGAACCCCCAGTGGGGTGG - Intronic
918232801 1:182551050-182551072 GGAGGGAACCCCCAGTGGAGGGG - Intronic
920839173 1:209539459-209539481 CCAGTGCACCCCCAGAGACTGGG - Intergenic
922326263 1:224531227-224531249 CCACTGTACCCCCAGTGCCTAGG - Intronic
1068497978 10:57808903-57808925 CCAGTGATCCCCCCGTGTCATGG + Intergenic
1069702347 10:70435849-70435871 CAAGTGAGCCCTCAGTGGGGAGG + Exonic
1069744162 10:70704248-70704270 CCAGTGAACCTGGAGTGGAGGGG + Intronic
1070570958 10:77638747-77638769 CCAAAGAGCCCCCAGTGGGGAGG + Intergenic
1077331772 11:1987135-1987157 CCCGTGAGCACCCAGTGGCCTGG + Intergenic
1085311710 11:75520806-75520828 CCAGTGACCCCGCTGTGGCCCGG + Intronic
1085685646 11:78619800-78619822 CCAGTGGGCCCCTAGAGGCGAGG + Intergenic
1087676373 11:101166507-101166529 CCAGGGAACCCACAATGGTGGGG + Intergenic
1091330364 11:134727227-134727249 CCAGGAAGCCCCCGGTGGCGTGG + Intergenic
1202814753 11_KI270721v1_random:42311-42333 CCCGTGAGCACCCAGTGGCCTGG + Intergenic
1095632557 12:44395616-44395638 CCAGTGAACACCCAGTTCAGTGG - Intergenic
1096242974 12:49969150-49969172 CCAGGGAACCCCCCGTGCCAGGG + Intronic
1101760903 12:107657968-107657990 CCATTGAACACCCACTGCCGGGG + Exonic
1102489010 12:113277623-113277645 CCCTCGAACCCCCAGTGGGGTGG + Intronic
1104041402 12:125133699-125133721 CCTGTTGACCCCCAGTGGCCTGG + Intronic
1104087672 12:125491636-125491658 CCAGAGAACCCACTGTGGAGTGG + Intronic
1104720780 12:131043973-131043995 CCAGGGAACCTCTAGTGGCCCGG - Intronic
1105544531 13:21342032-21342054 TCAGTGAACCCCCACTGTCAGGG + Intergenic
1105932992 13:25069640-25069662 TCAGTGAACCTCCAGAGCCGTGG - Intergenic
1106216063 13:27700937-27700959 CCAGTTAACCCACATTGGCCTGG + Intergenic
1107889412 13:44901227-44901249 CCAGTGTATCCCCAGTGCCTAGG - Intergenic
1108432473 13:50367995-50368017 CCAGTGAATCACCAGTAGCTAGG + Intronic
1113462370 13:110491173-110491195 CCAGGGAACCCACAGGGGCGCGG + Intronic
1118528244 14:66670237-66670259 CCAGTGAACCCCTTTTGGCTAGG + Intronic
1119887382 14:78154229-78154251 CCAGGGACCCTCCATTGGCGGGG - Intergenic
1125566042 15:40679275-40679297 CCAGTGCAGTCCCAGTGGTGAGG - Intergenic
1126817361 15:52466777-52466799 CCATGGAACCCCCAGGGGCCTGG - Intronic
1132344356 15:101099398-101099420 CCAGTGCTCCCCCAGTGGAGAGG - Intergenic
1132623954 16:881224-881246 CCAGTGCACCCCAAGAGCCGTGG + Intronic
1132977787 16:2719286-2719308 CCAGTGGCCCCTCAGTGGCCCGG - Intronic
1134468241 16:14498183-14498205 CCAGTGAAACCCCGGAGGAGAGG + Intronic
1141348597 16:83272137-83272159 CCATTGCATCCCCAGTGGTGAGG - Intronic
1144633441 17:16887992-16888014 CCAGTTAACCCACAATGGGGTGG + Intergenic
1148333224 17:46824648-46824670 CTGCTGAACCCCCAGTGGTGAGG + Intronic
1163422353 19:17220900-17220922 CCAGTGGACCCCCACTGACGTGG + Intergenic
1163437191 19:17302846-17302868 GCAGTGCACCCCCATTGTCGAGG + Intronic
1166849774 19:45753942-45753964 CCAGTGAACCCCAAGTTTCCGGG - Intronic
1167641873 19:50686839-50686861 CCAGGGAGCCCCCGGGGGCGGGG + Intronic
927558056 2:24049813-24049835 GCAGGGACCCCCCAGAGGCGGGG + Exonic
928430893 2:31217611-31217633 CCAGAGAACACACAGTGGGGAGG - Intronic
935122479 2:100195046-100195068 CCAGTAAACACCCAGGGGCCAGG + Intergenic
935648233 2:105359760-105359782 CCAGTGTGCCCTCAGTTGCGAGG + Intronic
941384965 2:164841477-164841499 CCAGTAAACCCCACGGGGCGGGG - Intronic
945231022 2:207590042-207590064 CCAGTGAACCCACATAGGCCTGG + Intronic
946229046 2:218280373-218280395 CCAGTGAACCCCCAGTGGCGTGG - Intronic
946412543 2:219522460-219522482 CCCGTGAGCCCCCACTGGGGAGG - Intronic
1170768600 20:19312896-19312918 CCAGGGAAACCCAAGTGGCCAGG - Intronic
1175259143 20:57663877-57663899 CCAGTCAAGCCCCACCGGCGCGG + Intronic
1178830122 21:36048997-36049019 CCAGTGAAATCCAAGTGGCCAGG + Intronic
1180232569 21:46436157-46436179 CCAGTGAGCGCCAGGTGGCGTGG - Intronic
1181600933 22:23951593-23951615 CCTGGGAACCCCCACTGGGGAGG + Intergenic
1181607580 22:23989733-23989755 CCTGGGAACCCCCAGTGGGGAGG - Intergenic
1181881119 22:25980944-25980966 CCAGTGAACCACCAGAAGCTAGG - Intronic
1182369466 22:29800835-29800857 CCTGTGCACCCCCAGTGGTTAGG - Intronic
1182621021 22:31618671-31618693 CTGGGGAGCCCCCAGTGGCGGGG - Exonic
1184565691 22:45290355-45290377 CATGTGCACCCCCAGGGGCGTGG + Intronic
1184728328 22:46358710-46358732 CAAGGGTACCCCCAGTGGCCTGG + Intergenic
959097552 3:101972069-101972091 CCAGTGAAGCTCCAGTGACTGGG + Intergenic
961146720 3:124599944-124599966 CCAGTGAATTCCCAGTGAGGTGG + Intronic
964063300 3:152552109-152552131 CCATTGAACCCCCAGTGAAATGG - Intergenic
969392727 4:6901907-6901929 CCAGTGAAGCCCCTGGGGCAGGG + Intergenic
969578807 4:8051962-8051984 ACAGGGAACCCCAAGTGGGGTGG - Intronic
976495402 4:85723793-85723815 CCAGTAAAGCCCCAGTGACCAGG - Intronic
979396826 4:120198522-120198544 CCAGTGAAGTTCCAGTGGTGGGG + Intergenic
985187532 4:187333644-187333666 CTAGTGAACCCAAAGTGGCTTGG - Intergenic
988117943 5:26920565-26920587 CCAGTGCAGTCCCAGTGGCGGGG + Intronic
995138630 5:108707394-108707416 ACAGTGAAGCCACAGTGGGGCGG + Intergenic
995235545 5:109825769-109825791 CCAGTCAAACCTCAGTGGCCCGG - Intronic
1002074395 5:176699463-176699485 CCCAGGAACCGCCAGTGGCGGGG + Intergenic
1003407098 6:5834521-5834543 TCAGTGAACCCCCAATGTCGGGG - Intergenic
1006582226 6:35083728-35083750 CCAGTGGAGCCCAGGTGGCGAGG - Intronic
1007231165 6:40348586-40348608 CCATTGAACCCCCTTTGACGTGG + Intergenic
1007423016 6:41730835-41730857 CCAGGGAAACCCAAGTGGCAGGG + Intronic
1011226343 6:85111703-85111725 CCATTAAACCCCCAGGGCCGGGG + Intergenic
1012008197 6:93743646-93743668 ACAGTGAATCCCAAGTGGTGAGG + Intergenic
1012708031 6:102559153-102559175 CCAGTGATCCCCATGTGACGAGG - Intergenic
1018085548 6:160298159-160298181 CCAGTGAATGAACAGTGGCGTGG + Intergenic
1024270257 7:47636350-47636372 CCAGTGCACCCCCAGAGGCCAGG - Intergenic
1027038303 7:74942461-74942483 CCTGTCATCCCCCAGTGGCTTGG - Intergenic
1028263060 7:88687102-88687124 CCAGGGAAGCCCCAGTGTGGAGG - Intergenic
1028500454 7:91513734-91513756 CCAGCTATCCCCCAGTGGCTTGG + Intergenic
1033048352 7:137982361-137982383 CTAGTGAACCCCCAGTGCTATGG + Intronic
1033075903 7:138250311-138250333 CCAGTGGGCCCCCAGAGGTGAGG + Intergenic
1037801247 8:22037063-22037085 CCAATTCTCCCCCAGTGGCGAGG + Intergenic
1052241959 9:26283794-26283816 CCAATGAACCCCCAATGTCTAGG + Intergenic
1054454940 9:65424972-65424994 CCAGTGAAGCCCCATCTGCGTGG + Intergenic
1055141310 9:72880310-72880332 CCAGTGAACCACCAGAAGCTAGG + Intergenic
1062192630 9:135255727-135255749 CCAGGGCACCCCCAGTGCAGTGG - Intergenic
1187338592 X:18401980-18402002 CGAGTAAACCCCCAGTGGGGAGG + Intergenic
1191769800 X:64742499-64742521 CCCGTGGGCCCCCAGAGGCGAGG - Intergenic
1194004220 X:88470582-88470604 CCCGGAAACCCCCAGTGGTGGGG + Intergenic
1197409520 X:126098234-126098256 CCAGTGGACCCCTAGAGGTGAGG - Intergenic
1197591549 X:128416939-128416961 CCAGTGAGCCCCTAGAGGTGAGG + Intergenic
1200045114 X:153396993-153397015 CCAGGAAACCCCCACTGGAGGGG - Intergenic
1200059481 X:153477896-153477918 CCAGTGAAGACCCAGTTGCCAGG + Intronic
1202092489 Y:21208650-21208672 CTACTGAACTCCCAGTGGCGAGG + Intergenic