ID: 946229052

View in Genome Browser
Species Human (GRCh38)
Location 2:218280378-218280400
Sequence ACCCCCCAGTGAACCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 141}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229052_946229056 0 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229056 2:218280401-218280423 CACGATGTAGTGGGGAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 129
946229052_946229054 -9 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229052_946229060 16 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229060 2:218280417-218280439 AGCCAGGCAGGAGCAGGTATGGG 0: 1
1: 1
2: 2
3: 44
4: 403
946229052_946229058 10 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG 0: 1
1: 1
2: 5
3: 95
4: 814
946229052_946229059 15 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229059 2:218280416-218280438 AAGCCAGGCAGGAGCAGGTATGG 0: 1
1: 0
2: 10
3: 43
4: 498
946229052_946229062 26 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229062 2:218280427-218280449 GAGCAGGTATGGGCATCCACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
946229052_946229055 -8 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229055 2:218280393-218280415 TGGGGGGTCACGATGTAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
946229052_946229063 27 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229063 2:218280428-218280450 AGCAGGTATGGGCATCCACTGGG 0: 1
1: 0
2: 0
3: 11
4: 118
946229052_946229053 -10 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229053 2:218280391-218280413 ACTGGGGGGTCACGATGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
946229052_946229057 4 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229057 2:218280405-218280427 ATGTAGTGGGGAAGCCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 255
946229052_946229064 28 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229064 2:218280429-218280451 GCAGGTATGGGCATCCACTGGGG 0: 1
1: 0
2: 3
3: 31
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229052 Original CRISPR ACCCCCCAGTGAACCCCCAG TGG (reversed) Intronic