ID: 946229052

View in Genome Browser
Species Human (GRCh38)
Location 2:218280378-218280400
Sequence ACCCCCCAGTGAACCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 141}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229052_946229054 -9 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229052_946229060 16 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229060 2:218280417-218280439 AGCCAGGCAGGAGCAGGTATGGG 0: 1
1: 1
2: 2
3: 44
4: 403
946229052_946229062 26 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229062 2:218280427-218280449 GAGCAGGTATGGGCATCCACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
946229052_946229063 27 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229063 2:218280428-218280450 AGCAGGTATGGGCATCCACTGGG 0: 1
1: 0
2: 0
3: 11
4: 118
946229052_946229057 4 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229057 2:218280405-218280427 ATGTAGTGGGGAAGCCAGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 255
946229052_946229064 28 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229064 2:218280429-218280451 GCAGGTATGGGCATCCACTGGGG 0: 1
1: 0
2: 3
3: 31
4: 245
946229052_946229056 0 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229056 2:218280401-218280423 CACGATGTAGTGGGGAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 129
946229052_946229053 -10 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229053 2:218280391-218280413 ACTGGGGGGTCACGATGTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61
946229052_946229059 15 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229059 2:218280416-218280438 AAGCCAGGCAGGAGCAGGTATGG 0: 1
1: 0
2: 10
3: 43
4: 498
946229052_946229058 10 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG 0: 1
1: 1
2: 5
3: 95
4: 814
946229052_946229055 -8 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229055 2:218280393-218280415 TGGGGGGTCACGATGTAGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229052 Original CRISPR ACCCCCCAGTGAACCCCCAG TGG (reversed) Intronic
900172144 1:1274243-1274265 ACCCTCCACTGAGCCTCCAGGGG - Intergenic
900988949 1:6089136-6089158 CCCCCCCAGTTAACCCACTGAGG + Intronic
901921728 1:12541719-12541741 ACCTCCCTGTGAACTCCCAAAGG + Intergenic
902088190 1:13879499-13879521 ACCCCCCAGTGAGTCTCCTGGGG - Intergenic
902330508 1:15728968-15728990 ACCACCAAGTAAAGCCCCAGAGG - Intronic
903140115 1:21334345-21334367 ACCACCCACTGAACACTCAGGGG + Intronic
904675952 1:32199436-32199458 ACCCCCCAGTGAAGCAGCTGAGG + Intergenic
906872087 1:49494160-49494182 AGCCCACATTAAACCCCCAGTGG + Intronic
916582479 1:166121345-166121367 ACTACCCTGTGAACCCTCAGGGG - Intronic
920546293 1:206821528-206821550 TCCTCCCAGGGAACTCCCAGAGG - Intronic
921601558 1:217111649-217111671 ACCCCACTGTGAAACCACAGAGG + Intronic
922152131 1:223015741-223015763 GCCTCCCAGGGAACTCCCAGAGG - Intergenic
922185028 1:223266791-223266813 ACACCCCTCTGAGCCCCCAGGGG - Intronic
923141475 1:231163777-231163799 ACCGCCCAGGGCGCCCCCAGCGG + Exonic
924442871 1:244101162-244101184 ACCCTCCAGCGAGGCCCCAGAGG - Intergenic
1062769567 10:88109-88131 ACACTCCAGTGCTCCCCCAGGGG - Intergenic
1063357341 10:5412993-5413015 ACCCCCCACTCACCTCCCAGCGG - Intronic
1063818607 10:9807977-9807999 ACCCTCCAGTGAATCCTCTGGGG + Intergenic
1067466158 10:46500835-46500857 ACGCCCCAGGACACCCCCAGAGG - Intergenic
1067621030 10:47883771-47883793 ACGCCCCAGGACACCCCCAGAGG + Intergenic
1072550766 10:96475642-96475664 ACCCTGCAGTGCAACCCCAGAGG - Intronic
1072619275 10:97068828-97068850 ACTCCCCAGAGGGCCCCCAGTGG + Intronic
1072631662 10:97150925-97150947 ACCTGACAGTGAACCCTCAGAGG - Intronic
1075259530 10:120950266-120950288 ACGCCCCAGTGACCGCGCAGAGG - Intergenic
1075529660 10:123218600-123218622 GCCCTCCAGTGGACCCACAGAGG - Intergenic
1076537802 10:131193915-131193937 ACCCCTCACTGAGCCCCCACAGG + Intronic
1076747158 10:132520173-132520195 ACCCCCCACTGCAGCCCCTGGGG + Intergenic
1077107436 11:848283-848305 ACCCACCAAAGAACCCCCAGGGG + Intronic
1081803438 11:45875609-45875631 ACTCCCCACTGAGCCACCAGTGG - Intronic
1081977658 11:47245957-47245979 ACCCCAAAGTGGAGCCCCAGAGG + Intronic
1084502106 11:69540873-69540895 AGCCCCCACTGAAACCCCGGAGG + Intergenic
1085259262 11:75195039-75195061 ACCTCTCACTGAACCCCCACAGG + Intronic
1089756990 11:120694560-120694582 GCCCCCCAGAGCACCCTCAGTGG - Intronic
1090204133 11:124875562-124875584 AGCCCCCAGTGGCCCCCCACAGG + Exonic
1092071721 12:5636828-5636850 ACACCCCAGGTACCCCCCAGAGG - Intronic
1092155905 12:6281317-6281339 ACCCTCCAGTGGGCTCCCAGTGG + Intergenic
1096096326 12:48938016-48938038 ACCCCCCAGTCAAGCTCCAGAGG + Exonic
1096841174 12:54379842-54379864 TGCCCCCACTGAACCGCCAGAGG - Intronic
1101827436 12:108231386-108231408 ACCTCCCACTGCAACCCCAGAGG - Intronic
1102434406 12:112909731-112909753 ACACCACAGTGAACTCACAGAGG + Intronic
1103903032 12:124313214-124313236 ATTCCCCACTGAACCCCCAGAGG - Intronic
1114596704 14:23918433-23918455 ACCAAGCAGTGAGCCCCCAGTGG + Intergenic
1115695912 14:35898387-35898409 ATCCCCCAGTGTCCACCCAGAGG - Intronic
1117058846 14:51940292-51940314 GCCCCGCTGTGAACCCCCTGAGG + Intronic
1121710854 14:96038519-96038541 CCCTCCCAGTGAGCCCCCGGAGG + Intergenic
1122160430 14:99780351-99780373 TCCCCACAGAGAACCCCCAAAGG - Intronic
1122690205 14:103528711-103528733 GCCCTCTGGTGAACCCCCAGGGG + Intergenic
1123778765 15:23605197-23605219 CCATTCCAGTGAACCCCCAGAGG - Intronic
1124877504 15:33609058-33609080 AGCCAACAGTGAACCCTCAGAGG + Intronic
1125503806 15:40255294-40255316 TGGCCCCAGTGAATCCCCAGGGG - Intronic
1129153388 15:73703065-73703087 ACACCCCAGAGAAGCCCCACAGG + Exonic
1131092485 15:89633057-89633079 TCTCCCCAGTGAACCTCGAGTGG - Intronic
1131092489 15:89633087-89633109 ACCCACCAGCCAGCCCCCAGGGG + Intronic
1131400255 15:92119636-92119658 ACCCTCCAGTCCAGCCCCAGTGG - Intronic
1132065072 15:98724368-98724390 AAGCCACAGTGAGCCCCCAGTGG - Intronic
1134390394 16:13814613-13814635 ACCCATCTGTGAACTCCCAGTGG - Intergenic
1136459639 16:30401622-30401644 CTCCCCCATTGAAACCCCAGTGG + Intergenic
1137643518 16:50054547-50054569 GCCCACCTGTGACCCCCCAGTGG - Intergenic
1138339522 16:56279480-56279502 ACACCCCAGCGAAGGCCCAGAGG - Intronic
1144843582 17:18203935-18203957 AAGCCCCAGTGAAGCCCTAGTGG - Intronic
1145035907 17:19540510-19540532 TCCACCCAGTGAAACCACAGGGG + Intronic
1151756396 17:76077588-76077610 GCCCCTCTGTGAAGCCCCAGAGG - Intronic
1152398271 17:80048574-80048596 TCCCCCCAGTGATCCCCCCAGGG + Exonic
1153046292 18:858156-858178 AACCCCCAGAGAAGCCACAGAGG + Intergenic
1155401417 18:25443504-25443526 TCCTCCCAGTGAATCCCAAGAGG - Intergenic
1156077770 18:33301396-33301418 ACCCCACAGAGAATCCCCACTGG + Intronic
1156486579 18:37469954-37469976 AGCCCCCAGTGAATCCCTGGGGG + Intronic
1160205155 18:76825300-76825322 ACATCTCAGGGAACCCCCAGGGG - Intronic
1161629691 19:5346716-5346738 ACCCCCAAGTGAACCCCACATGG - Intergenic
1161724034 19:5918264-5918286 ACCCCTCAGCCAAACCCCAGCGG + Intronic
1162842013 19:13363618-13363640 ACCCCCAAGTGGATCCGCAGAGG - Intronic
1162842017 19:13363629-13363651 TCCACCCAGTGACCCCCAAGTGG - Intronic
1163364768 19:16869765-16869787 ACCCCACAGTAGCCCCCCAGAGG + Exonic
1164715638 19:30388489-30388511 ACCCCACAGAGACCACCCAGCGG + Intronic
1164856939 19:31532109-31532131 ACCCACCAGTGAACCCCCGCTGG + Intergenic
1168009305 19:53517812-53517834 AGCCCCCAGCAAACCACCAGTGG + Intergenic
1168079824 19:54001519-54001541 ACCTTCCTGTGCACCCCCAGGGG + Intronic
1168262924 19:55207081-55207103 ACCCCACGGGGACCCCCCAGAGG + Intronic
926340293 2:11899492-11899514 AGAGCCCAGTGAACCCGCAGTGG + Intergenic
927016612 2:18969962-18969984 ACCCTCTAGGGAAACCCCAGGGG + Intergenic
928201291 2:29249284-29249306 ACCCAACAGTAAGCCCCCAGCGG - Intronic
935122475 2:100195041-100195063 CCTCCCCAGTAAACACCCAGGGG + Intergenic
936072913 2:109383293-109383315 ACCCCCCAGTGACTCCACATGGG - Intronic
938950303 2:136249162-136249184 ACCAGCCAGGGAACCACCAGAGG + Intergenic
946229052 2:218280378-218280400 ACCCCCCAGTGAACCCCCAGTGG - Intronic
947180866 2:227410133-227410155 ACCACCCAATGTACCCGCAGTGG - Intergenic
947218760 2:227772927-227772949 ATCCCCCACTGAACCCTCACTGG + Intergenic
948375859 2:237519809-237519831 ACCCCACACTCAGCCCCCAGAGG - Intronic
948639818 2:239368552-239368574 ACCCCCCTGTTATCCCCCAATGG - Intronic
948887026 2:240889609-240889631 ACTCTCCTGGGAACCCCCAGAGG + Intronic
1169005999 20:2207591-2207613 ACCACCCAGAGACCCCGCAGAGG - Intergenic
1170478947 20:16745877-16745899 AACCCTCACTGAACCCCCAGTGG + Intergenic
1172038869 20:32029842-32029864 AGCCCCCGCTGTACCCCCAGAGG + Intronic
1174270530 20:49365094-49365116 AAACCCCAGTGAAGCCCAAGGGG + Exonic
1175999794 20:62826692-62826714 TCCCCCCAGTGCTCCCTCAGGGG - Intronic
1176372673 21:6071758-6071780 ACCCCCAAGAGAAACCACAGTGG - Intergenic
1179595452 21:42440051-42440073 GCCCCCAAGTGAAACCCCAAGGG - Intronic
1179629577 21:42668178-42668200 CTCCCCCAGTGATCCTCCAGAGG + Intronic
1179733557 21:43380108-43380130 ACACCACGGTGCACCCCCAGAGG + Intergenic
1179750803 21:43466485-43466507 ACCCCCAAGAGAAACCACAGTGG + Intergenic
1180676797 22:17592004-17592026 ACAGCCCAGGGGACCCCCAGAGG + Intergenic
1181686419 22:24532228-24532250 TCCTCCCTGTGAACCACCAGTGG - Intergenic
1181790554 22:25262521-25262543 ACCCCCTAGAGAACTCCGAGAGG + Intergenic
1181826362 22:25519556-25519578 ACCCCCTAGAGAACCCTGAGAGG + Intergenic
1183511064 22:38235272-38235294 ACCCTCCAGGGAAGCCACAGGGG + Intronic
1184456820 22:44615732-44615754 AGCCCCCTGTGAAGACCCAGTGG + Intergenic
1184594281 22:45504399-45504421 AGCCTCCAGGGAGCCCCCAGGGG - Intronic
1184636544 22:45836612-45836634 TCACCCCAGTGCATCCCCAGGGG - Intronic
953767420 3:45754212-45754234 ACCCCACAGTGAACCCTCAGTGG + Intergenic
954541184 3:51393785-51393807 GCCACCCAGGCAACCCCCAGTGG + Exonic
954834418 3:53453207-53453229 CACCCCCAGTGACCCACCAGGGG - Intergenic
956325240 3:68045006-68045028 TGCCCCCAGTCAACCCACAGAGG - Intronic
967854258 3:194104554-194104576 ACCCTCCACTGCAGCCCCAGGGG + Intergenic
969583237 4:8077553-8077575 ATCTCCCAGTCAACTCCCAGGGG + Intronic
972837854 4:42895796-42895818 ATCCCACAGAGAAGCCCCAGGGG + Intronic
975228746 4:71906391-71906413 AGCCCCCAGTCAACACCCTGTGG + Intergenic
977588829 4:98804312-98804334 TCCCCACAGTGAACTCCCACAGG - Intergenic
985663390 5:1168817-1168839 ACCCCCCAGCCACCGCCCAGAGG + Intergenic
988481887 5:31638594-31638616 ATCCCCCAGTTAAGCCCCTGGGG - Intergenic
992890661 5:81201106-81201128 ACCCCCTGGGGAGCCCCCAGGGG + Intronic
998635811 5:143953496-143953518 ACCCCCAAGCTAAACCCCAGAGG - Intergenic
1001433740 5:171683444-171683466 ACCCTCCACTGCACCCCCGGGGG - Intergenic
1005048138 6:21661441-21661463 ACCCACCAGGCAACCCTCAGTGG - Intergenic
1006581560 6:35080506-35080528 TCACCCCATTGAACCCTCAGGGG + Intronic
1007849317 6:44788674-44788696 ACCTCCCAGTGAACACTCACAGG - Intergenic
1017158209 6:151341483-151341505 ACCTCCCAGGAAACCCCCGGGGG - Intronic
1017848728 6:158283855-158283877 ACACCCCAGGGGACTCCCAGAGG - Intronic
1018761673 6:166899104-166899126 AACGCCCAGTGAACGCACAGAGG + Intronic
1019060179 6:169251852-169251874 TCCCCCCAGTGCCGCCCCAGGGG + Intronic
1019418653 7:938749-938771 GCCCCCCACTGCACCCCGAGCGG - Intronic
1019748718 7:2715304-2715326 TCCCCACAGTGAACGCCGAGTGG - Exonic
1021940911 7:25678253-25678275 GCCCCCCAGTGGAGCCACAGTGG - Intergenic
1023285245 7:38612412-38612434 AGCCCCCTGTGAAACTCCAGTGG - Intronic
1024004115 7:45212740-45212762 ACCTCCCAGGGGAGCCCCAGAGG - Intergenic
1026911273 7:74093227-74093249 AGCCCCCAGTGTAGCCACAGAGG + Intronic
1029610991 7:101626545-101626567 ACCCCGCAGGGAGTCCCCAGGGG + Intronic
1032122581 7:129167973-129167995 GCCCCCCAGTGACAGCCCAGTGG + Exonic
1034531912 7:151701112-151701134 GCCCCCCAGGGAAGCCCCACTGG + Intronic
1035026088 7:155827213-155827235 ACCCACCAGAGAAGCCCAAGTGG - Intergenic
1040580353 8:48693844-48693866 AACCCACACTGAACACCCAGCGG - Intergenic
1047576287 8:126159262-126159284 GCCACTCTGTGAACCCCCAGAGG + Intergenic
1058261782 9:102842237-102842259 TTCCCCCAGTGTCCCCCCAGAGG - Intergenic
1058429693 9:104907190-104907212 ACTCACCAGTGAAGTCCCAGTGG - Intronic
1058920529 9:109610205-109610227 ATCCCCCAGTTGACCCACAGTGG - Intergenic
1060479069 9:124007372-124007394 TGCCCCCAGGAAACCCCCAGTGG - Intronic
1060510669 9:124229672-124229694 CCCCCAGAGTGAACACCCAGTGG - Intergenic
1197409524 X:126098239-126098261 AAGCCCCAGTGGACCCCTAGAGG - Intergenic
1198782474 X:140252355-140252377 ACCCCACTGTGAGCTCCCAGAGG - Intergenic