ID: 946229054

View in Genome Browser
Species Human (GRCh38)
Location 2:218280392-218280414
Sequence CTGGGGGGTCACGATGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229046_946229054 -4 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229045_946229054 -3 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229052_946229054 -9 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229038_946229054 10 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229043_946229054 2 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229044_946229054 1 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229054 Original CRISPR CTGGGGGGTCACGATGTAGT GGG Intronic