ID: 946229054

View in Genome Browser
Species Human (GRCh38)
Location 2:218280392-218280414
Sequence CTGGGGGGTCACGATGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229045_946229054 -3 Left 946229045 2:218280372-218280394 CCCACGCCACTGGGGGTTCACTG 0: 1
1: 0
2: 0
3: 5
4: 61
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229052_946229054 -9 Left 946229052 2:218280378-218280400 CCACTGGGGGTTCACTGGGGGGT 0: 1
1: 0
2: 1
3: 5
4: 141
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229046_946229054 -4 Left 946229046 2:218280373-218280395 CCACGCCACTGGGGGTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229038_946229054 10 Left 946229038 2:218280359-218280381 CCTGTGTGCCCAGCCCACGCCAC 0: 1
1: 0
2: 1
3: 72
4: 793
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229044_946229054 1 Left 946229044 2:218280368-218280390 CCAGCCCACGCCACTGGGGGTTC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64
946229043_946229054 2 Left 946229043 2:218280367-218280389 CCCAGCCCACGCCACTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 105
Right 946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229054 Original CRISPR CTGGGGGGTCACGATGTAGT GGG Intronic
900994364 1:6112489-6112511 CTGGGTGGTCCTGATGTGGTCGG - Intronic
911218254 1:95218906-95218928 GTGGGGAGTGACGATGTTGTAGG + Intronic
918316124 1:183324007-183324029 CTGGGGGATCACCATAAAGTGGG + Intronic
920231784 1:204475510-204475532 ATGGGTGGTCAGGATGTAGGTGG + Intronic
922061736 1:222099175-222099197 CTGGGGTGTCACGTTGGAGGTGG + Intergenic
1066975624 10:42365640-42365662 CTGGGAGGTGAGGATGCAGTGGG + Intergenic
1070673812 10:78398190-78398212 CTGGGAGGACACGATGTAGTTGG - Intergenic
1081215896 11:40397572-40397594 TTGGAGGGTCAGGAAGTAGTTGG + Intronic
1090487705 11:127128882-127128904 CTGGGGGCTCAGGATCTGGTTGG - Intergenic
1092297577 12:7212832-7212854 CTGGGGGATCACGAGGCAGCTGG + Intronic
1092456581 12:8649255-8649277 CTGTGGGGTTACAATCTAGTAGG + Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1096357550 12:50954247-50954269 CTGGGGGCTTACCATGTATTAGG - Intronic
1097947014 12:65380291-65380313 TTGGGGGGTCCTGATATAGTTGG + Intronic
1101254395 12:102963507-102963529 CAGGGAGGTTACCATGTAGTAGG - Intergenic
1102410679 12:112715639-112715661 CTGTGAGCTCACCATGTAGTTGG - Intronic
1108462316 13:50678781-50678803 CCTGGGGGTCACTCTGTAGTAGG - Intronic
1110872008 13:80463282-80463304 CTGGGGGGTGAGCAGGTAGTGGG + Intergenic
1111988095 13:95085652-95085674 CTGGTGGGTCAAGATGCAGGTGG - Intronic
1112884567 13:104152806-104152828 CGGAGGGGTCACTATGTAGCAGG + Intergenic
1117540017 14:56737864-56737886 CTGGAGGATAACGATTTAGTGGG + Intergenic
1119035944 14:71230920-71230942 CAGGGTGGGCACGATGCAGTTGG - Intergenic
1128662280 15:69510876-69510898 GTGGGTGGGCACCATGTAGTTGG + Intergenic
1130397284 15:83513675-83513697 ATGGAGGGTCATGATTTAGTGGG - Intronic
1132864577 16:2087116-2087138 CTGGGTGGGCACAGTGTAGTTGG + Intronic
1133916819 16:10116579-10116601 CTGGGGGGACATGGTTTAGTTGG + Intronic
1133977554 16:10610596-10610618 CTGGGGGTTGAAGCTGTAGTGGG - Intergenic
1142351478 16:89582769-89582791 CTGGGAGGTCACAATGAGGTAGG - Intronic
1143018639 17:3904882-3904904 CTTCGGGGTCACGATGAAATTGG + Exonic
1146738980 17:35264594-35264616 CTGGGGGGTCATGAAGTTATAGG - Exonic
1148456237 17:47813054-47813076 CTGGGGGCTCACGCTTTAGGGGG - Intronic
1155085475 18:22453911-22453933 CTGGGGAGTCAGGATTTAGGGGG + Intergenic
1157311995 18:46559791-46559813 CTGAGGGGTCATGAGGTAGGAGG - Intronic
1160364621 18:78313632-78313654 CTGTGGGGTCCCCATGTAGGTGG - Intergenic
1161411800 19:4121866-4121888 CTAGGGGGTCACGATGGGGTGGG - Intronic
1163124303 19:15236500-15236522 GTGGGGGGACAGGATGGAGTAGG + Exonic
1167475308 19:49697199-49697221 CTGGAGGCTCAAGATCTAGTAGG - Intronic
925746603 2:7048984-7049006 CCGGGGGCTCAGGATGTGGTGGG + Intronic
931053193 2:58437502-58437524 CTAGGAGGTCACTATCTAGTTGG + Intergenic
937876078 2:126826489-126826511 CTGGGGGCTCACCATGATGTTGG + Intergenic
941406471 2:165095143-165095165 ATGGGTGGTGACTATGTAGTAGG + Intronic
946184931 2:217975307-217975329 TTGGGGGGTCAGGATGTTGGGGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1178785806 21:35652156-35652178 CTGGGGCTTCACCATGTATTAGG - Intronic
1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG + Exonic
1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG + Intergenic
1183919539 22:41153860-41153882 CTGGGGGGTTGCCATGGAGTGGG - Intronic
1184691406 22:46119048-46119070 CTGGGGGGTCTGGGTGTGGTGGG + Intergenic
954646506 3:52134965-52134987 CTGGGAGGTGGCGATGTGGTGGG - Intronic
965435874 3:168650672-168650694 CTGTGGGGTCACAGTGTTGTGGG + Intergenic
966830439 3:184003364-184003386 CTGGGGAGTAAGGATGTGGTGGG - Intronic
968872592 4:3249308-3249330 CTGGGGAGACACGAGGTAGCCGG - Exonic
980788468 4:137586327-137586349 TTGGGGGCTCACGATGTGATTGG + Intergenic
985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG + Intergenic
986548579 5:8926834-8926856 GTGGGGGGTCAGGAGGAAGTAGG + Intergenic
988030388 5:25756329-25756351 CTGGGGGATCAAGAAGCAGTAGG + Intergenic
996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG + Intronic
1019577783 7:1745843-1745865 CAGGATGGTCATGATGTAGTGGG - Exonic
1022331427 7:29382940-29382962 CTGAGGGGTGAGGATGTCGTGGG + Intronic
1034425247 7:151010574-151010596 CTGGCGGGGCAGGATGCAGTGGG - Intronic
1035954569 8:4061994-4062016 CTGAGAGGTCAAGGTGTAGTGGG + Intronic
1043225724 8:77727894-77727916 CTTGGGGGTCAGGATTTATTTGG + Intergenic
1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG + Intergenic
1060537345 9:124400660-124400682 CAGGTGGCTCACAATGTAGTTGG - Intronic
1061484848 9:130915011-130915033 CTGAGGGCACAAGATGTAGTCGG - Intronic
1187066198 X:15840698-15840720 GTGGGGGGTGGTGATGTAGTTGG - Intronic
1187273839 X:17801660-17801682 CTGGGTGGTCATGACGTAGGTGG + Exonic
1195364111 X:104111223-104111245 CTGGGGGATTTTGATGTAGTAGG - Intronic