ID: 946229631

View in Genome Browser
Species Human (GRCh38)
Location 2:218283285-218283307
Sequence CCTGCGAGTTCTGGGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946229631_946229644 23 Left 946229631 2:218283285-218283307 CCCAGAACCCCAGAACTCGCAGG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 946229644 2:218283331-218283353 GCCTTCCAGATCCTGGGTCCAGG 0: 1
1: 0
2: 0
3: 25
4: 260
946229631_946229640 1 Left 946229631 2:218283285-218283307 CCCAGAACCCCAGAACTCGCAGG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 946229640 2:218283309-218283331 CAGTGGCATAACCAGGACGGAGG 0: 1
1: 0
2: 2
3: 9
4: 105
946229631_946229639 -2 Left 946229631 2:218283285-218283307 CCCAGAACCCCAGAACTCGCAGG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 946229639 2:218283306-218283328 GGTCAGTGGCATAACCAGGACGG 0: 1
1: 1
2: 2
3: 20
4: 169
946229631_946229642 16 Left 946229631 2:218283285-218283307 CCCAGAACCCCAGAACTCGCAGG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 946229642 2:218283324-218283346 GACGGAGGCCTTCCAGATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
946229631_946229643 17 Left 946229631 2:218283285-218283307 CCCAGAACCCCAGAACTCGCAGG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 946229643 2:218283325-218283347 ACGGAGGCCTTCCAGATCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 120
946229631_946229638 -6 Left 946229631 2:218283285-218283307 CCCAGAACCCCAGAACTCGCAGG 0: 1
1: 0
2: 3
3: 12
4: 170
Right 946229638 2:218283302-218283324 CGCAGGTCAGTGGCATAACCAGG 0: 1
1: 0
2: 1
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946229631 Original CRISPR CCTGCGAGTTCTGGGGTTCT GGG (reversed) Intronic
900350441 1:2231922-2231944 CTTGGGAGTTCTGGGCTTCAGGG + Intronic
900896843 1:5488655-5488677 CCTTCCTGTTCTGCGGTTCTGGG - Intergenic
902375895 1:16029822-16029844 TCTGAGAGTTTTGGGGTTCTTGG + Intronic
902380841 1:16051569-16051591 TCTGAGAGTTTCGGGGTTCTTGG + Intronic
902691238 1:18110975-18110997 CCTGCGGGTTCTCGGGTTCTCGG + Intronic
903649624 1:24914699-24914721 CCTGGGGGTTGTGGGGATCTTGG + Intronic
903685529 1:25128955-25128977 TCTGCCTGTTCTGAGGTTCTTGG - Intergenic
904011948 1:27394892-27394914 CCAGCTGGTTCTGGAGTTCTAGG + Exonic
904288417 1:29468554-29468576 CCTGAGAATTCTGGGTCTCTTGG + Intergenic
904827851 1:33286670-33286692 CCTGGGAGTTCTGGGCATGTGGG - Intronic
906960530 1:50417043-50417065 CCTGGGAGTTATGGGGTTCTGGG - Intergenic
907652735 1:56311338-56311360 CCTTCCAGTGCTGGGGTTCCAGG - Intergenic
912561631 1:110555534-110555556 CCTCCGAGGGCTGGGCTTCTGGG + Intergenic
912606465 1:110994904-110994926 CCTACCAGTTCTGCAGTTCTGGG - Intergenic
915361694 1:155289761-155289783 GTGGGGAGTTCTGGGGTTCTTGG + Exonic
916242565 1:162654633-162654655 CCAGTGTGTTCTGGGATTCTGGG + Intronic
917201398 1:172519949-172519971 GATGCTAGTTCTGAGGTTCTAGG + Intergenic
919297440 1:195720881-195720903 CCTGGGAGTTCAGGGGTGCAGGG + Intergenic
919611748 1:199753629-199753651 CCTGTGAGTATTGGGGTTCATGG + Intergenic
922952293 1:229569136-229569158 CCTCAGAGTGCTGGGGTTATAGG + Intergenic
924856792 1:247882053-247882075 TCTCTGCGTTCTGGGGTTCTAGG - Intergenic
1065505543 10:26426799-26426821 CCTGGGGGTCCTGGAGTTCTTGG + Intergenic
1069343351 10:67438941-67438963 CCAGAGAGCTCTGGGGTCCTTGG + Intronic
1070416029 10:76190348-76190370 AATGCAAGTTCTGGGGGTCTAGG + Intronic
1070855800 10:79607204-79607226 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
1074208404 10:111304483-111304505 CCTGGGGGTTCTGAGGTTCTGGG + Intergenic
1077235278 11:1479146-1479168 CCTGCATGTTCTGTGGTACTGGG - Intronic
1078865931 11:15297179-15297201 CCTGAGAGTTCCAGGGATCTAGG - Intergenic
1080431692 11:32205460-32205482 CTTTCTAGCTCTGGGGTTCTGGG - Intergenic
1081591981 11:44429728-44429750 CCTGAGAGATATGGGGTTTTGGG - Intergenic
1082749322 11:57000071-57000093 CCTGGGAATTCTGGGTTTGTGGG + Intergenic
1086160444 11:83716326-83716348 GCAGCCAGTCCTGGGGTTCTTGG + Intronic
1089122478 11:116147123-116147145 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1090104808 11:123841452-123841474 CCTACTAGTTCTGGGCTGCTGGG - Intergenic
1091385536 12:92346-92368 CCTGCGAGTTCTGCGGCTGGAGG - Intronic
1091430962 12:434302-434324 CATGCCCTTTCTGGGGTTCTGGG + Intronic
1092157760 12:6295428-6295450 TCTGGGAGTTCTGGGGTGCTAGG - Intergenic
1094284826 12:28781358-28781380 CCTGCTAGTCCTCGGGGTCTTGG - Intergenic
1094497134 12:30995382-30995404 CCTGCTATTGCTGGGGCTCTGGG + Exonic
1096798493 12:54093656-54093678 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1097661330 12:62434858-62434880 CCTCCTTGTTCTGGGATTCTGGG - Intergenic
1102110444 12:110361531-110361553 CCTGCCAGTGCTGGGATTATAGG - Intergenic
1102854536 12:116281749-116281771 CCTCCCAGTTCTAGGATTCTAGG - Intergenic
1103230102 12:119322466-119322488 CCTGCGACTTCTAGAGGTCTTGG - Intergenic
1103415606 12:120740090-120740112 CCTGTGAGTGTTGGGGGTCTTGG + Intergenic
1103715393 12:122942289-122942311 CCGGCCAGCTCTGGGGTTTTAGG - Intronic
1107123044 13:36816108-36816130 TATGCCAATTCTGGGGTTCTGGG + Intergenic
1112160867 13:96866716-96866738 CCTGCCATTTCTGTGGTTCATGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114398558 14:22388583-22388605 CCTGAGAGTTCTGGGCTTTCAGG - Intergenic
1119954062 14:78776077-78776099 CTTGCAAGTTCTGGCATTCTGGG - Intronic
1119995114 14:79245040-79245062 CCTGCGAGTTCTTTGGCCCTGGG + Intronic
1121736269 14:96220218-96220240 CCTGAGAGTTGTGTGGTCCTGGG + Intronic
1121824318 14:96998308-96998330 CCTGCAAGTCCTGGGGGACTGGG - Intergenic
1122028403 14:98894722-98894744 CCTCCGAGTACTGGTGTACTTGG + Intergenic
1122258710 14:100499839-100499861 CCTTTGAGTTCTGAGGTGCTTGG - Intronic
1122763574 14:104048907-104048929 CCTGGGAGTGCTGTGGTGCTGGG + Intronic
1123134938 14:106018847-106018869 CCTGAGGTTCCTGGGGTTCTTGG - Intergenic
1124370723 15:29103495-29103517 CCTGGGAGGTGTGGGGTTCAGGG - Intronic
1128543085 15:68550617-68550639 CCCCCGAGTTCTGGGATTCTGGG + Intergenic
1128716648 15:69913567-69913589 GCTTGGAGTGCTGGGGTTCTGGG - Intergenic
1129231679 15:74200517-74200539 CCTGAGAGTGCTGGGGCACTGGG + Intronic
1130229314 15:82084592-82084614 CCTGCTTGTACTGGGGTTATGGG - Intergenic
1131770842 15:95735842-95735864 CCTGCAAGTTCTGAAGTTCAGGG - Intergenic
1132398357 15:101489925-101489947 CCGCCGACTTCTGGGGCTCTCGG + Intronic
1132541252 16:510917-510939 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541265 16:510966-510988 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541294 16:511064-511086 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541309 16:511113-511135 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541324 16:511162-511184 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541392 16:511402-511424 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541420 16:511500-511522 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541435 16:511549-511571 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541450 16:511598-511620 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1132541518 16:511838-511860 CCTGCAGGTTCTGGGGTTGGCGG - Intronic
1140855231 16:78972079-78972101 CCTGAGAGGTCTGGGCTGCTGGG - Intronic
1141438065 16:84012226-84012248 CCTGGGTAGTCTGGGGTTCTGGG - Intronic
1141658160 16:85427120-85427142 ACTGTGAGTCCTGGGGTCCTGGG + Intergenic
1142387324 16:89774123-89774145 CCTTCAAGTTCTGGGGTTGCTGG + Intronic
1144301372 17:13925232-13925254 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1146985575 17:37213705-37213727 CCTGTGAATTCTGAGGTTCCCGG + Intronic
1148748105 17:49929655-49929677 CCTTAGAGGTCTGGTGTTCTAGG - Intergenic
1151177648 17:72301866-72301888 CCTGAGAGTTCTGGGGGACTTGG + Intergenic
1151605312 17:75131723-75131745 GCTGCGAGCTCTCGGGGTCTGGG + Exonic
1152755201 17:82084340-82084362 CCTGCTAGGTATGGAGTTCTCGG - Exonic
1152823445 17:82449126-82449148 GCTTCCGGTTCTGGGGTTCTGGG + Intronic
1153770003 18:8407833-8407855 CCTGCCTGCTCTGGGGATCTTGG + Intergenic
1153879583 18:9408778-9408800 ATTGCGATTTCTGAGGTTCTTGG + Intergenic
1161047556 19:2144230-2144252 CATGCTGCTTCTGGGGTTCTGGG - Intronic
1161981022 19:7630435-7630457 GGTGGGAGTTCTGGGATTCTTGG + Intronic
1165098903 19:33426773-33426795 CCTGCAGGTGCTGGGGATCTGGG - Intronic
1166300323 19:41909030-41909052 CCTGGAGGTTCTGGGGTGCTGGG - Intronic
1166735011 19:45079048-45079070 CCTGCGAGTTGGGGGCGTCTGGG - Intergenic
1167307999 19:48719917-48719939 CCTGCACGTCCTGGGGTTGTGGG + Intergenic
1167322019 19:48802936-48802958 CCTCCCAGTTCTGGGGTTACAGG - Intronic
1167689686 19:50977634-50977656 CCTGCAAGGTCTGGTGTCCTGGG - Exonic
1168163963 19:54533908-54533930 CCTGCGTGTTCTGGGGTCACAGG - Exonic
928651572 2:33409652-33409674 CCTGAGAGGCCTGGGTTTCTGGG - Intergenic
932275242 2:70446633-70446655 CCTCAGAGTTCTGGGATTATAGG - Intergenic
932413801 2:71561989-71562011 CCTGCCAGTTCTGATGTTCCAGG - Intronic
933141022 2:78793054-78793076 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
935206541 2:100901468-100901490 TCTTCCAGTTCTGGGTTTCTTGG - Intronic
935816127 2:106847586-106847608 CTTGCTAGCTCTGTGGTTCTGGG + Intronic
938245310 2:129772132-129772154 GCTGTGAGATCTGAGGTTCTGGG + Intergenic
938247503 2:129790374-129790396 CCTCCGAGTTCTGGCTTTCCAGG + Intergenic
939262755 2:139831357-139831379 GCTGCGAATGCTAGGGTTCTGGG - Intergenic
944059582 2:195558417-195558439 CCTGAGAATCTTGGGGTTCTGGG - Intergenic
944681804 2:202084121-202084143 CCTGCCAGTTCTGGGATTTGGGG + Intronic
946229631 2:218283285-218283307 CCTGCGAGTTCTGGGGTTCTGGG - Intronic
947977744 2:234382101-234382123 CCTGGGAGTTCAGGAGTTCAAGG - Intergenic
1171797919 20:29580683-29580705 CCTGGGAGTTCTGAGGTTCCGGG + Intergenic
1171850322 20:30303477-30303499 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1174902419 20:54514396-54514418 CCTGCCATTTCTGGAATTCTTGG - Intronic
1176071078 20:63226739-63226761 CCTGGCAGTCCTGGGATTCTGGG - Intergenic
1176098307 20:63353965-63353987 CCTGGGAGGTCTGTGGTCCTGGG + Intronic
1177345598 21:19864752-19864774 CCTGGGAGTTGTGTGGTACTAGG - Intergenic
1177387113 21:20422934-20422956 CCAGGGAGTTCTGGAGATCTGGG + Intergenic
1179917902 21:44489758-44489780 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1181096586 22:20509132-20509154 GCTGAGAGTTCTGGGGCTCGAGG + Intronic
1182295008 22:29307288-29307310 CCTGCCGGTGCTGGGGCTCTGGG - Intronic
1184549167 22:45195349-45195371 CCTGGTTGTTCTGGGGATCTTGG - Intronic
1184650434 22:45917133-45917155 CCTGTGAGTTTTGGGGATCCAGG - Intergenic
1185168998 22:49281282-49281304 CCTGTGAGTGCTGGGCTGCTGGG + Intergenic
1185309434 22:50145986-50146008 CCTTCGAGTCCTTGGGGTCTCGG - Intronic
949995454 3:9613004-9613026 CCTGGAAGTGCTGGGCTTCTAGG - Intergenic
950099645 3:10348933-10348955 CCTTGTGGTTCTGGGGTTCTGGG + Intronic
950808892 3:15632630-15632652 CCTGGAAGTCATGGGGTTCTTGG - Intronic
951208466 3:19947831-19947853 CCTGGCAGTCCTGGGGGTCTCGG + Intronic
953217683 3:40936626-40936648 CCAGGCAGTTCTGGAGTTCTTGG - Intergenic
953918565 3:46936430-46936452 CCAGCTAGTGCTGGGGCTCTGGG - Intronic
959254197 3:103989873-103989895 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
961035362 3:123638051-123638073 CCTGTGAGTCCTGGGGCACTTGG - Exonic
961079192 3:124010646-124010668 CCTGAAAGTTCTGGGATTATAGG + Intergenic
963461300 3:145617566-145617588 TCTGCATGTTCCGGGGTTCTAGG + Intergenic
963761537 3:149290813-149290835 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
967763641 3:193252919-193252941 CCTGGAAGTTCTGGGGTCCCAGG + Intronic
968392672 4:205772-205794 CCTGGGGGTCCTGGGGGTCTGGG - Intergenic
969283938 4:6190782-6190804 CCTGGGAGCTCTGGCGTCCTGGG - Intronic
969941483 4:10736425-10736447 TCTGCCAGTTATGGGGTTCCTGG + Intergenic
978954283 4:114595741-114595763 CATGGGAGATCTGGGGTCCTTGG - Intergenic
979188838 4:117832912-117832934 ACTGAGAATTCTGGGGTTTTTGG + Intergenic
979935379 4:126687565-126687587 CCCGGGAGTTCTAGGGTTGTTGG - Intergenic
981547221 4:145906143-145906165 GCTGAGAGATTTGGGGTTCTTGG - Intronic
981992287 4:150936406-150936428 CCTGAGAATACTGGTGTTCTTGG - Intronic
988420517 5:31000258-31000280 CATGCATGTACTGGGGTTCTTGG - Intergenic
988922946 5:35961616-35961638 CCTGGGAATTCTGGGGTTTATGG + Intronic
988936330 5:36086759-36086781 CCTGCCAGTCCTGGACTTCTAGG - Intergenic
994274790 5:97822622-97822644 CCAACGTGCTCTGGGGTTCTAGG - Intergenic
995524724 5:113041305-113041327 CCTGCCATTTCTGGGGATTTAGG - Intronic
996192639 5:120564369-120564391 CCAGAGTGTTCTGGGGTGCTAGG - Intronic
997465461 5:134084996-134085018 CCTGGGATCTCTGGGGTCCTTGG + Intergenic
1006208775 6:32375075-32375097 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1010775307 6:79878485-79878507 CCAGAGGGTTCTGGGGCTCTAGG + Intergenic
1012177451 6:96106108-96106130 CCCTAGAGTTCTGGAGTTCTGGG + Intronic
1015556465 6:134466732-134466754 CCAGTAAGTTCTGGGTTTCTTGG - Intergenic
1018174125 6:161164300-161164322 CCTGCTAGTGCTGGGCATCTGGG + Intronic
1019042825 6:169120638-169120660 CTTGGGAGTTCTGGGGTTTGTGG - Intergenic
1020136571 7:5591479-5591501 CGTGCGGGTTCTGGGGCTCAAGG + Intergenic
1030628577 7:111870616-111870638 CCAGCCAGTTCTTGGTTTCTAGG + Intronic
1032240506 7:130155269-130155291 CCTGCTGGTGCTGGGGTTCGAGG - Intergenic
1032554499 7:132817565-132817587 CCTGCCACCTCTGGGGTTCATGG + Intronic
1033870675 7:145750738-145750760 CCAGAGAGTTCTGGGGTTTGTGG + Intergenic
1034781458 7:153886412-153886434 CCGGCCAGTGCTGGGGTTCCAGG + Intergenic
1034892799 7:154855502-154855524 CCTGCGAGGTTTGGGAATCTGGG + Intronic
1036418628 8:8574584-8574606 CCTGGGAGGTTTGGGGTTCAAGG - Intergenic
1039659992 8:39450773-39450795 CCTGGGAATTCTGGGGTTTGTGG - Intergenic
1040591021 8:48792163-48792185 CCTGAGAGTTCTTGGCATCTTGG - Intergenic
1045324667 8:101109291-101109313 GCTCCCAGTTCTGGGGGTCTCGG + Intergenic
1046138791 8:110063197-110063219 CCTGAGAATTCTGGGGTTTGTGG - Intergenic
1048737249 8:137515422-137515444 CCTGTGACCTCTGGGGTTTTGGG + Intergenic
1049662052 8:143823947-143823969 ACTGCGAGTTCTGGGAAGCTTGG + Intronic
1053788102 9:41666768-41666790 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1054157031 9:61648000-61648022 CCTGGGAGTTCTGAGGTTCCGGG + Intergenic
1054176378 9:61878107-61878129 CCTGGGAGTTCTGAGGTTCCGGG - Intergenic
1054476808 9:65579008-65579030 CCTGGGAGTTCTGAGGTTCTGGG + Intergenic
1054661160 9:67702701-67702723 CCTGGGAGTTCTGAGGTTCCGGG + Intergenic
1059443652 9:114324973-114324995 CCAGGGAGGGCTGGGGTTCTAGG - Intronic
1059444852 9:114331750-114331772 CCAGGGAGGGCTGGGGTTCTAGG - Intronic
1061855195 9:133438158-133438180 CCTGCCAGCTCTGAGATTCTGGG - Intronic
1188815690 X:34711274-34711296 CCTGCTAGTTTTGGGGCTTTTGG - Intergenic
1194784021 X:98059786-98059808 CCTGTGCTTTCTGGGGTTTTTGG - Intergenic
1197717297 X:129718779-129718801 CCAGAGGCTTCTGGGGTTCTTGG - Intergenic
1198263766 X:134990846-134990868 CCTGCCCTTCCTGGGGTTCTGGG + Intergenic
1199142762 X:144332295-144332317 CCTGGGAATTCTGGGGTTTGTGG + Intergenic
1199601035 X:149541228-149541250 CCTGCGAGTCGTGGGTGTCTAGG - Exonic
1200420141 Y:2956269-2956291 CCTGGGAGTAGTGGGGTTCGGGG + Intronic