ID: 946230341

View in Genome Browser
Species Human (GRCh38)
Location 2:218287341-218287363
Sequence ACACACCCTCTCCCAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946230328_946230341 19 Left 946230328 2:218287299-218287321 CCCTTCCCAGCCCCGCCCACTCT 0: 1
1: 1
2: 8
3: 93
4: 846
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230335_946230341 4 Left 946230335 2:218287314-218287336 CCCACTCTCTGAGTGATAGACAC 0: 1
1: 0
2: 0
3: 6
4: 111
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230333_946230341 8 Left 946230333 2:218287310-218287332 CCCGCCCACTCTCTGAGTGATAG 0: 1
1: 1
2: 0
3: 8
4: 116
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230332_946230341 9 Left 946230332 2:218287309-218287331 CCCCGCCCACTCTCTGAGTGATA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230329_946230341 18 Left 946230329 2:218287300-218287322 CCTTCCCAGCCCCGCCCACTCTC 0: 1
1: 1
2: 20
3: 120
4: 1241
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230336_946230341 3 Left 946230336 2:218287315-218287337 CCACTCTCTGAGTGATAGACACC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230334_946230341 7 Left 946230334 2:218287311-218287333 CCGCCCACTCTCTGAGTGATAGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230330_946230341 14 Left 946230330 2:218287304-218287326 CCCAGCCCCGCCCACTCTCTGAG 0: 1
1: 0
2: 1
3: 33
4: 390
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200
946230331_946230341 13 Left 946230331 2:218287305-218287327 CCAGCCCCGCCCACTCTCTGAGT 0: 1
1: 0
2: 2
3: 27
4: 327
Right 946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG 0: 1
1: 0
2: 2
3: 24
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946230341 Original CRISPR ACACACCCTCTCCCAAGGAG GGG Intronic
900775551 1:4582165-4582187 ACATTCCCTCTCTCATGGAGTGG - Intergenic
901457162 1:9369651-9369673 TCCCACCCTCTGCCAAGGGGTGG - Intergenic
902941197 1:19801128-19801150 TCACACCCACTCTGAAGGAGAGG + Intergenic
903882749 1:26522907-26522929 ACAGACCCTCTCCCCAGGACAGG + Intergenic
906129137 1:43445624-43445646 ACACACCCTCTCAGTAGCAGAGG + Intronic
907476862 1:54711612-54711634 ACACATACTCTCCCAAGGGGTGG - Intronic
910077543 1:83298691-83298713 TCACACCCTCTCCCAAGTTCTGG - Intergenic
912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG + Intronic
913594837 1:120365343-120365365 ACACACCCTGGGCAAAGGAGAGG - Intergenic
914092431 1:144513643-144513665 ACACACCCTGGGCAAAGGAGAGG + Intergenic
914306100 1:146420228-146420250 ACACACCCTGGGCAAAGGAGAGG - Intergenic
914595952 1:149152581-149152603 ACACACCCTGGGCAAAGGAGAGG + Intergenic
915235416 1:154477086-154477108 GCAGAGCCTCTCCCAAGCAGGGG + Intronic
917329633 1:173868327-173868349 CCCCACCCCCTCCCACGGAGCGG - Intronic
918243662 1:182641056-182641078 CCACACCCCCTCCCAAGTGGCGG + Intergenic
918443449 1:184592509-184592531 ACACAGCCTCTTTGAAGGAGAGG - Intronic
920420478 1:205829966-205829988 ATAAGCCCTCTCCCAAAGAGAGG + Intronic
920669357 1:207991444-207991466 ACACACCCTCTGCCAGGGGCAGG + Intergenic
920795453 1:209132390-209132412 ACGCTCCCTCTCTCAAGAAGGGG - Intergenic
923034515 1:230276274-230276296 ACACACCCTTTCTCAAGGCATGG + Intronic
923630048 1:235643861-235643883 ACAAACCCTAGCACAAGGAGAGG + Intronic
1063451791 10:6154909-6154931 TCACAGCCTCTACCAAGGACAGG - Intronic
1065607431 10:27432648-27432670 ACACACACACTCACATGGAGAGG - Intergenic
1066239694 10:33521587-33521609 ACGCAGGCTGTCCCAAGGAGGGG - Intergenic
1066251553 10:33637841-33637863 GCACTCCCTCTCTCAAGGAGTGG + Intergenic
1066455345 10:35567428-35567450 GCACACCCTCTCTGGAGGAGGGG - Intronic
1067684490 10:48458410-48458432 ACACCTGCTCTCCCAAGGTGTGG - Intronic
1067830663 10:49609719-49609741 ACACACACTCCCGCCAGGAGGGG - Intronic
1070666387 10:78348049-78348071 CCACACTCCCTCCCAAGTAGTGG + Intergenic
1073311569 10:102546527-102546549 AGACAGCCGCTCCCTAGGAGGGG + Intronic
1073322864 10:102626194-102626216 AGACACCCTCACCCAGGGCGTGG + Intronic
1073500935 10:103936360-103936382 ACACAGCCTCTCCCCAGGACAGG + Intergenic
1075591160 10:123692599-123692621 ACCCACCCTCTCCCCAGGTCCGG - Exonic
1076519709 10:131073867-131073889 GCACACACGCTCCCAAGGAAAGG - Intergenic
1077138395 11:1012864-1012886 TGACGCCCTCTCCCAAGGACAGG + Exonic
1078370905 11:10744173-10744195 ACACCCCCTCTCCCAGGGTAAGG - Intergenic
1080961684 11:37168218-37168240 ACATTCCCTCTCGCAAGAAGTGG + Intergenic
1081666453 11:44919725-44919747 ATACAGCCTCTGCAAAGGAGTGG - Intronic
1084907309 11:72358032-72358054 TCCCACACTCTCCCAAGGAGAGG + Intronic
1085408891 11:76280167-76280189 AGACACCCCCTCGCAAGGAGAGG + Intergenic
1085509690 11:77082030-77082052 ACACAGCCCCTCCCCTGGAGGGG + Intronic
1086968100 11:93051377-93051399 ACACACAGTCTCCCAGGGAAAGG + Intergenic
1087887270 11:103495277-103495299 ACACACCCTCTTGAGAGGAGTGG + Intergenic
1089564030 11:119361427-119361449 CCACCCCCTCTCTCAGGGAGGGG + Intronic
1089604666 11:119634987-119635009 ACATCCCCTGTCCTAAGGAGAGG - Intronic
1090288266 11:125519112-125519134 ATGCTCCCTCTCACAAGGAGTGG - Intergenic
1090418158 11:126555244-126555266 ACACTCCCTCTCTCAAGCAGTGG + Intronic
1090453908 11:126830761-126830783 GCACTCCCTGTGCCAAGGAGGGG + Intronic
1092151123 12:6249463-6249485 AATCTCTCTCTCCCAAGGAGAGG + Intergenic
1097986058 12:65784451-65784473 ACACACTCTCTTCCCAAGAGGGG + Intergenic
1099202319 12:79690760-79690782 ACAACCCCACTCCCAAGGCGAGG + Intronic
1100544893 12:95592243-95592265 ACTAACCCTCTCCCCAGAAGAGG - Intergenic
1101696445 12:107131822-107131844 ACAAAACCTCTCCCATAGAGGGG - Intergenic
1102735160 12:115152944-115152966 CCACAGCCTTTCCCAAGGAAAGG - Intergenic
1103123607 12:118401406-118401428 ACACACACTCACCCAAGGTAAGG - Intronic
1103246393 12:119461578-119461600 ACCCACCCTCTCCCATGCACTGG + Intronic
1104481181 12:129109829-129109851 ATACACCCTCTCCCTACCAGCGG + Intronic
1104751381 12:131241889-131241911 ACACACCCTTTCCCCAGTACAGG + Intergenic
1108063585 13:46554751-46554773 ACAAACCCTCCCCCAGGGAGCGG - Intronic
1108825639 13:54408806-54408828 ACACAGCCTATCCAAATGAGAGG + Intergenic
1109883088 13:68507363-68507385 ACACTCCCTCCCACAAGGGGTGG + Intergenic
1111598270 13:90438501-90438523 ACAGACCTACTCCCCAGGAGGGG - Intergenic
1115244407 14:31280486-31280508 AGATAGCCTCTCCAAAGGAGAGG + Intergenic
1115648393 14:35385664-35385686 ACGCACACACTCCCAGGGAGAGG - Intergenic
1116856528 14:49957308-49957330 GCACACCCTCTGCCTGGGAGAGG + Intergenic
1117902647 14:60551099-60551121 GCACACCCTCTCCCAAGCAGGGG - Intergenic
1118482358 14:66179940-66179962 ACAGACCCAGACCCAAGGAGAGG - Intergenic
1119735081 14:76976502-76976524 CCAGGCCCTCTCCCAGGGAGGGG + Intergenic
1124906420 15:33872810-33872832 ACCCACCCTGTCCAAAGGAAAGG + Intronic
1125582798 15:40798897-40798919 ACACACACACTCACAAGGCGGGG - Intronic
1129156477 15:73721485-73721507 ACAAGCTCTTTCCCAAGGAGAGG + Intergenic
1129950995 15:79591516-79591538 ACACACCCCTTTCCAAGAAGGGG + Intergenic
1130285229 15:82549253-82549275 ACCCACCATCTCCCACGCAGTGG - Intronic
1130561567 15:84963318-84963340 ATACACCCTCTCCCCAGGAGTGG + Intergenic
1130871882 15:87978225-87978247 GGCCACCCTCTCCCAAAGAGGGG - Intronic
1131119395 15:89813579-89813601 GCACACCCTCCCACAGGGAGAGG + Intronic
1131553513 15:93377685-93377707 ACAGAGCCTCTCCCCAGCAGTGG + Intergenic
1132452235 15:101974857-101974879 ACACACCGTCTCCAAAGGTCCGG + Intergenic
1132657400 16:1046979-1047001 GACCACCCTCTCCCAAGGGGAGG - Intergenic
1133240979 16:4414338-4414360 AAACACCCCCACCCAAGGGGAGG + Intronic
1133547863 16:6825615-6825637 AAATACCCACTCCCAGGGAGAGG - Intronic
1135603815 16:23805878-23805900 ACAAACACTCTCCCATTGAGTGG + Intergenic
1135633480 16:24054599-24054621 AAAAACCCTTTCCCAAGAAGGGG + Intronic
1137729722 16:50680667-50680689 ACCCACCCTTTCCCCAAGAGAGG - Intronic
1140857185 16:78988532-78988554 ATACTCCCTCTCCCCAGGAGAGG + Intronic
1141131978 16:81443589-81443611 ACCCCCCCTCTCCCAAGAACAGG - Intergenic
1141702284 16:85648054-85648076 ACACACCCTGCCCCACCGAGAGG - Intronic
1142149081 16:88504873-88504895 AGACACCCCCTCCCCAGGACAGG + Intronic
1142199267 16:88753348-88753370 ACACCCACTCACCCAAGGACGGG + Intronic
1142266881 16:89068040-89068062 AGACACCCTCTCCCCAGGGCTGG + Intergenic
1142291795 16:89196463-89196485 ACGCACTCTCTCCCACAGAGGGG - Intronic
1142765359 17:2061303-2061325 ACAGAGCCCCTCCCAAGGATCGG - Exonic
1143200313 17:5108925-5108947 ACCCAGCCTTTCCCAAAGAGTGG - Exonic
1143599411 17:7934342-7934364 TCACCCCCTCTCCCAAAGAACGG - Intronic
1144552780 17:16256080-16256102 AAACAACCTCTTCCAATGAGTGG - Intronic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1147569186 17:41557190-41557212 ACACTCACTCCCACAAGGAGTGG + Intergenic
1150373148 17:64659126-64659148 ACACACTCTCTCTGAAGAAGAGG - Intronic
1151226591 17:72652539-72652561 ACTCACCCTCACCCCAGGACAGG - Intronic
1152126419 17:78450052-78450074 ACACCCATTCTCCCCAGGAGAGG - Intronic
1152252314 17:79218521-79218543 ACTCCCCCTCTCCCCAGCAGGGG - Intronic
1153397203 18:4637571-4637593 ACACACACACTCACAAGCAGAGG - Intergenic
1153617524 18:6948187-6948209 ACAAAGTCTCCCCCAAGGAGTGG - Intronic
1155277335 18:24201135-24201157 ACACACCCTGTACCAGGGACTGG + Intronic
1157132201 18:45017235-45017257 ACACACTTTCTCAGAAGGAGTGG + Intronic
1157623517 18:49029732-49029754 ACACACCCTCCCCAAAGAACAGG - Intergenic
1157958918 18:52130691-52130713 ACAGACCCCCTCCCAAGTAAAGG - Intergenic
1158950804 18:62493053-62493075 ACACCCCGTCACCCAAGGTGGGG + Intergenic
1159637483 18:70822738-70822760 TGACACCCTCTTGCAAGGAGAGG + Intergenic
1160566856 18:79791310-79791332 ACACAGCCTCTGCCCTGGAGAGG - Intergenic
1160583740 18:79901534-79901556 ACCCGCTCTCTCCCACGGAGGGG + Intergenic
1160801926 19:974275-974297 ACACACCCCCTTTCCAGGAGGGG + Exonic
1164477948 19:28589725-28589747 CCAAGCCCTCTCCCATGGAGGGG + Intergenic
1165202123 19:34153703-34153725 ACGCTCCCTCTTGCAAGGAGTGG - Intergenic
1165872245 19:38981178-38981200 ACACACCCCCTCCCACCCAGGGG + Intergenic
1166778320 19:45325881-45325903 ACAAACCCTCCCACAAGGTGTGG - Intergenic
925094194 2:1182122-1182144 AGGCACCATCTCCCAAGGCGAGG - Intronic
925603531 2:5634689-5634711 ACACACCCTGGGCAAAGGAGAGG - Intergenic
925972040 2:9112743-9112765 ACAGACCCTTCCCTAAGGAGGGG - Intergenic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
929900004 2:45992670-45992692 ACAGAGCCACTCCTAAGGAGGGG - Intronic
935653318 2:105399780-105399802 ACGCACCCTCTCCCAGGGATGGG - Intronic
937723107 2:125126541-125126563 TCACACCCTCTCCCAAGTTCTGG + Intergenic
942490429 2:176484412-176484434 AGGCACCCTCTACGAAGGAGAGG - Intergenic
944001448 2:194843075-194843097 GCGCACCCTCTCCTAAGGGGTGG + Intergenic
946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG + Intronic
946680418 2:222209053-222209075 ACTCTGCCTCTCCCAAGCAGAGG + Intronic
1168982814 20:2022290-2022312 GCCCACCTTCTCCCCAGGAGAGG - Intergenic
1172809279 20:37635826-37635848 ACAGTCCCTCTCCCCAGGATGGG - Intergenic
1175104013 20:56601131-56601153 ACACCCCCACTCCCCAGGTGTGG - Intergenic
1178606198 21:34038047-34038069 ACAAATCCTCTCCCAACAAGGGG + Intergenic
1179577250 21:42315636-42315658 ACACATCCGCTCCCCAGTAGAGG - Exonic
1181044790 22:20209436-20209458 ACACACCCCCTCCAAAAGAAAGG + Intergenic
1181560531 22:23697155-23697177 CCACACCCTGTGCCAAGGAGGGG - Exonic
1181621001 22:24091169-24091191 ACACACCCTCTCCTGTGCAGTGG + Intronic
1182364180 22:29766823-29766845 CCACACCCTATCCCAAGAAATGG + Intronic
1183984530 22:41562198-41562220 AGACCCCCTTTCCCAGGGAGAGG - Intronic
1184020391 22:41817224-41817246 ACATACCCACTACCAAGGAGTGG - Intronic
1184133602 22:42532745-42532767 ACACACCCTCATCCAATGACTGG - Intergenic
1184598597 22:45529109-45529131 TCAGACCCTCACCCAAGAAGTGG - Intronic
949977705 3:9476005-9476027 ACACCCCCACTCCCACGGTGTGG - Exonic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953581695 3:44163070-44163092 ACCCACCTTGTCCCAAGGGGTGG - Intergenic
954237741 3:49269812-49269834 ACACACCCACTCCTTAGCAGAGG - Exonic
954422311 3:50425169-50425191 ACACACCCTCTCCCCTGCAGTGG + Intronic
954672853 3:52299822-52299844 GCACACACTCTCCCTAAGAGGGG - Intergenic
958830269 3:99079088-99079110 AGACACACCCTCCCAAGGTGAGG + Intergenic
959375559 3:105584584-105584606 ATGCTCCCTCTCTCAAGGAGTGG + Intergenic
962017572 3:131457935-131457957 ACACACTCTTTCTCAAAGAGGGG + Intergenic
962864945 3:139440733-139440755 ACACACCCACTCCAACAGAGGGG - Intergenic
963152592 3:142061508-142061530 AATCACCCTCTCCAATGGAGAGG + Intronic
963420797 3:145058647-145058669 ACTCACCCTTTCCCCAGAAGAGG - Intergenic
964412210 3:156409430-156409452 ATTCACCCTGGCCCAAGGAGGGG + Intronic
964442033 3:156721853-156721875 ACAGACCCACTCCCAAGTAAAGG + Intergenic
966601419 3:181778991-181779013 ACACTACCTCTTCCTAGGAGAGG + Intergenic
967751478 3:193121064-193121086 ACATTCCCTCTTCCAAGGAGTGG - Intergenic
968039634 3:195578458-195578480 CCAAACCTTCTCCTAAGGAGAGG + Intronic
968808306 4:2788805-2788827 ACACAGCCTCCCCCAGGGAGTGG + Intergenic
968814583 4:2815296-2815318 ACAGCCCCTCTCCAGAGGAGGGG - Intronic
968823570 4:2875962-2875984 CCACAGCCCCTCACAAGGAGAGG + Exonic
970756077 4:19428709-19428731 ACACTCCCTCCCACAAGGGGTGG - Intergenic
971315733 4:25566343-25566365 AGACACCATCTCCCAAAAAGGGG + Intergenic
975707024 4:77121647-77121669 ACACCCCCTCTCATGAGGAGTGG - Intergenic
977524280 4:98125682-98125704 ACACCTGCTCTGCCAAGGAGTGG - Intronic
977870061 4:102080750-102080772 TCACACCCACACCCAAGGAGGGG + Intergenic
981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG + Intergenic
984548279 4:181132255-181132277 ATACACCCGTTTCCAAGGAGGGG + Intergenic
985678293 5:1243458-1243480 ACACACACTCTCCCAGGCCGAGG - Intronic
987335349 5:16893873-16893895 ACACAGCCTCTCCCCAGCAGTGG + Intronic
987601883 5:20083030-20083052 ACATACCCTTTCCCAAGATGTGG + Intronic
987715018 5:21557493-21557515 ACACTCCCTCTTGCAAGGAGTGG - Intergenic
990896584 5:60706391-60706413 ACACTCCATCCCCCAAGGTGGGG - Intergenic
993742954 5:91562778-91562800 TCACACCCTCTCCCAAGTTCTGG - Intergenic
995470748 5:112499635-112499657 ACAGACCAACTCCCATGGAGAGG + Intergenic
997965692 5:138353711-138353733 ACAAAACCTCTCCCAAGGTTGGG - Intronic
998517846 5:142771359-142771381 ACCCACCTTTTCCCAAGGGGAGG - Intronic
998806501 5:145922178-145922200 ACACACCCTCTGCCCAGGTTAGG + Intergenic
999085554 5:148885715-148885737 TCAACTCCTCTCCCAAGGAGAGG + Intergenic
1000832178 5:166116472-166116494 CCATAGCCTCTCCAAAGGAGTGG + Intergenic
1003193974 6:3898761-3898783 ACGCTCCCTCTCGCGAGGAGTGG - Intergenic
1005184843 6:23153831-23153853 ACAAAACCTGTCCCAAGGAAGGG + Intergenic
1005455539 6:26016586-26016608 CCACGCCCTCTCCACAGGAGTGG - Intergenic
1006351141 6:33521870-33521892 CCACACCTTCTCGCAAGCAGAGG + Intergenic
1009001705 6:57724551-57724573 AGACTCCCTCTTGCAAGGAGTGG + Intergenic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1013144902 6:107379080-107379102 AGATACCCTATCCCAAGGACAGG - Intronic
1015225677 6:130854230-130854252 ACATCCTCTCTGCCAAGGAGGGG + Intronic
1017782403 6:157726043-157726065 ACACTCCCTCTCACGAGGAGTGG + Intronic
1019792832 7:3028321-3028343 CCACCCCCTCTCCCATGGAATGG + Intronic
1021420406 7:20440185-20440207 ACACTCCCTCCCGCAAGGAGTGG + Intergenic
1021420843 7:20443254-20443276 ACACTCCCTCCCACGAGGAGTGG + Intergenic
1022190831 7:28015747-28015769 ACACACCCTCGTCCCAGCAGAGG + Intronic
1023117345 7:36875400-36875422 ACACACTCTCCCACAAGGTGTGG + Intronic
1024232398 7:47372540-47372562 TCATACCCTCCCCCCAGGAGAGG - Intronic
1025202220 7:56969575-56969597 ACAAACTGTCTCCAAAGGAGAGG + Intergenic
1025669727 7:63607352-63607374 ACAAACTGTCTCCAAAGGAGAGG - Intergenic
1027295318 7:76763896-76763918 TCACACCCTCTCCCAAGTTCTGG - Intergenic
1027508693 7:79052053-79052075 GCACACCCTCTCTCAGGGAGTGG + Intronic
1030239809 7:107309896-107309918 ACCCCCTCTCTCCCAAGGACTGG + Intronic
1032935705 7:136729246-136729268 AGAAAACCCCTCCCAAGGAGAGG + Intergenic
1034965380 7:155387465-155387487 ACACACCCTCTCCCTGGGCTGGG - Intronic
1038791635 8:30673196-30673218 ACAAACCCTTTCCCCAGAAGAGG - Intergenic
1039751837 8:40486006-40486028 ACAAACTCTTTCCCAAGAAGAGG + Intergenic
1041343316 8:56869152-56869174 AGACACCTTTTCCCAAGGATAGG + Intergenic
1047546762 8:125825572-125825594 ATACACCCTCTCTCGATGAGAGG + Intergenic
1048409081 8:134152901-134152923 GCAAACCCTCTCCCCAGCAGAGG - Intergenic
1049249619 8:141581172-141581194 CCCCACCCTCTCTCAAGGGGTGG - Intergenic
1049251665 8:141592477-141592499 ACACACACACACCCAAGCAGAGG - Intergenic
1049986801 9:959370-959392 ACACACCCTCTGACAAGTGGTGG - Intronic
1052048397 9:23821129-23821151 ACACATCCTCCCGCAAGGCGGGG + Intronic
1052712193 9:32070206-32070228 ACGCTCCCTTTCGCAAGGAGTGG + Intergenic
1053526712 9:38837518-38837540 AGACATCCTCTGCCAAGGGGAGG + Intergenic
1053593266 9:39534162-39534184 ACACACCCCCTTTCCAGGAGGGG - Intergenic
1053850999 9:42288870-42288892 ACACACCCCCTTTCCAGGAGGGG - Intergenic
1054573040 9:66831115-66831137 ACACACCCCCTTTCCAGGAGGGG + Intergenic
1056401077 9:86227764-86227786 GCTCACTCTCTCCCATGGAGAGG - Intronic
1059949604 9:119448632-119448654 CCACTCCCTCACTCAAGGAGAGG + Intergenic
1060997379 9:127882859-127882881 AGGCGCCCCCTCCCAAGGAGGGG + Intergenic
1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG + Intronic
1062362914 9:136195985-136196007 CCACACCCTGTCCCTGGGAGAGG - Intergenic
1062677552 9:137756231-137756253 GCACACCCACTGCCAAGAAGGGG - Intronic
1192589592 X:72348929-72348951 AATCACCCTCCCCCAAGGAAGGG + Intronic
1194501912 X:94691845-94691867 ACACAACCACTTGCAAGGAGAGG + Intergenic
1195208443 X:102626542-102626564 ACTCACCATTTCCCATGGAGAGG + Intergenic
1196176783 X:112646871-112646893 ACATACCCTCACCAATGGAGAGG + Intronic
1199399712 X:147383667-147383689 AAAGACCCTCTTCCAAGGTGAGG + Intergenic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic