ID: 946234681

View in Genome Browser
Species Human (GRCh38)
Location 2:218316621-218316643
Sequence AAATTGCAAAATATGTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946234675_946234681 29 Left 946234675 2:218316569-218316591 CCAGGAAGTTTTTAAGGCAGGGA 0: 1
1: 0
2: 4
3: 17
4: 164
Right 946234681 2:218316621-218316643 AAATTGCAAAATATGTAGAGGGG 0: 1
1: 0
2: 3
3: 42
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946234681 Original CRISPR AAATTGCAAAATATGTAGAG GGG Intronic
901902671 1:12379278-12379300 AAATGGAAAAACATGAAGAGGGG - Intronic
902194789 1:14790368-14790390 ATATTGCAAAATAAGAAAAGTGG - Intronic
904363061 1:29990982-29991004 TAATTGGAAAATACGTGGAGGGG - Intergenic
904669540 1:32153077-32153099 AAATTAGAAAAAATGTAGAAAGG + Intronic
905699964 1:40004751-40004773 AAATTGTAAACTATAGAGAGGGG + Intergenic
906230977 1:44163885-44163907 AAATTGCTAAATATGAAAACAGG - Intergenic
908838842 1:68257571-68257593 ATATTTCAAAATAGGTAGATGGG - Intergenic
909041326 1:70655563-70655585 AAAATGCTTAATATGTAGAGAGG + Intergenic
909397722 1:75188970-75188992 TCAATGCAAAATATGTAAAGAGG - Intergenic
909711962 1:78661583-78661605 AAATTGTAAAATTTTTAGTGCGG - Intronic
909726536 1:78842819-78842841 AAATAGCAAAGTATGAAGAAAGG - Intergenic
910496015 1:87828445-87828467 ACATGGCAAAATATGAAGAAGGG - Intergenic
910536212 1:88300784-88300806 AAATTGCAAGGGAAGTAGAGTGG + Intergenic
911261424 1:95690906-95690928 AAAATACAAACCATGTAGAGAGG - Intergenic
912335832 1:108861743-108861765 AAATTGCGAAATACTGAGAGAGG - Intronic
912341258 1:108917799-108917821 AAATTGAAATAAATGTACAGGGG - Intronic
913109455 1:115644050-115644072 AAATTGCAAAATTCTTAGTGGGG + Intronic
913417513 1:118627634-118627656 TAATTGCAACATATCTAGAATGG + Intergenic
914889315 1:151608716-151608738 AAATTTAAAAATATTTAGAAAGG - Intergenic
914948921 1:152092912-152092934 ACATTGGTAAATATGTAAAGTGG - Intergenic
915017631 1:152750140-152750162 AATTTGCAAAATGTGAAGAAGGG + Intronic
915756388 1:158264946-158264968 TAATTGCACAAAATGTAGAGTGG + Intergenic
917339790 1:173964300-173964322 AAATTGCAAATTTTGTAGAAGGG - Intronic
917574162 1:176303127-176303149 AAATAGCAAAATATATAAATAGG + Intergenic
917785585 1:178453115-178453137 AAAATGCAAAAGATGGAGGGGGG + Intronic
918019224 1:180668616-180668638 AAATTGTAAAACATTTAGAGAGG - Intronic
918259053 1:182777493-182777515 AAATCAGAAAATATGCAGAGAGG - Intergenic
918361867 1:183767486-183767508 TAATTGCACAAAATGTATAGGGG - Intronic
918891864 1:190283402-190283424 ATATAGCAAATTATGTAGATCGG - Intronic
919625473 1:199905712-199905734 AGAATGGAAAATATTTAGAGAGG - Intergenic
919817406 1:201450165-201450187 AAATTGCAGATTGTGTAGTGTGG - Intergenic
920750759 1:208673711-208673733 AAATTTAAAAATATGTAAAATGG - Intergenic
920814734 1:209320537-209320559 AAATTTAAAGATATGTAGATAGG + Intergenic
922134689 1:222813614-222813636 ACATTGCAATATATGGAGATAGG - Intergenic
923725466 1:236501763-236501785 ACTTTGCAAAACATCTAGAGAGG + Intergenic
924019008 1:239760750-239760772 AAAATGCAAATTATGAACAGAGG - Intronic
1063045554 10:2388492-2388514 ATATTTCAAAATATGTCCAGAGG - Intergenic
1063137472 10:3229840-3229862 AAATTATAAAATAAGTAAAGGGG + Intergenic
1063316709 10:5013794-5013816 AAATTGTAATATATGTATACTGG - Intronic
1063710275 10:8470485-8470507 AAAATGCAAATTATATAGATAGG - Intergenic
1064520337 10:16194053-16194075 AACCTGTAAAATATTTAGAGAGG - Intergenic
1064803734 10:19107591-19107613 AATTTTCAAAATATATAGAGTGG - Intronic
1065646482 10:27840177-27840199 AAATAGAAAAAAATGTACAGAGG - Intronic
1065884546 10:30065404-30065426 AAATTGAAAAAAATCTAGAAAGG + Intronic
1066974271 10:42351060-42351082 AAATTAAAAAATTTGTAGAATGG + Intergenic
1068258601 10:54546845-54546867 AAATTTCAAAATATGAATTGAGG - Intronic
1068419268 10:56768571-56768593 TAATTGCACAAAATGTAAAGTGG - Intergenic
1069053599 10:63820289-63820311 AAATCTCAAAATAGGAAGAGAGG - Intergenic
1069239004 10:66115123-66115145 AGATTGCAAAATCTGCAGTGGGG + Intronic
1069538803 10:69277656-69277678 AAAATACAAAAGATGGAGAGTGG - Intronic
1073382487 10:103090128-103090150 AAATTGGAAAAGATGGAGAGGGG + Exonic
1073406337 10:103301265-103301287 AAATGGCAAAATTTGTAATGTGG + Intergenic
1073614322 10:104977665-104977687 AAGTATCAAAATATGTAGACAGG + Intronic
1073742759 10:106427852-106427874 CAATTCCAAAATCTGTAGAGAGG - Intergenic
1073782552 10:106855512-106855534 AAAGTGTAATATATGTATAGTGG - Intronic
1074173012 10:110963189-110963211 AAATTTCAAAATGTTTAGGGAGG + Intronic
1074330930 10:112508380-112508402 AGACTCCAAAATATGTGGAGAGG - Intronic
1074473410 10:113747623-113747645 AAATGGCAAAATGTGTACTGAGG + Intergenic
1074586978 10:114777468-114777490 AAATTACAAAATTTGTGAAGGGG - Intergenic
1075949600 10:126465499-126465521 AAATAGTAATTTATGTAGAGTGG + Intronic
1077161891 11:1117361-1117383 AAATTATAAAATATTTTGAGAGG + Intergenic
1078074502 11:8145891-8145913 AAATTGACAAAGATGTGGAGAGG + Intronic
1078473074 11:11607568-11607590 AAAATGCACATTTTGTAGAGGGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079662702 11:23060554-23060576 AAATTGAAAAAAGTGTAGATAGG - Intergenic
1079899039 11:26158220-26158242 CATATGAAAAATATGTAGAGAGG - Intergenic
1080984622 11:37446374-37446396 AAATTTCAAAACATGTTAAGAGG + Intergenic
1084875619 11:72130493-72130515 AAATTGCAAAAGTAGTAAAGAGG - Intronic
1085088532 11:73689960-73689982 AAACTGTAAAATATTTAAAGAGG - Intronic
1085602214 11:77865087-77865109 AATTTGCAAAATATATACAAGGG - Intronic
1086722426 11:90137337-90137359 ATATTTCAAAATAACTAGAGTGG + Intronic
1087141876 11:94772068-94772090 AAGTTGCAAAAATAGTAGAGAGG + Intronic
1087516937 11:99175716-99175738 AAACTGCAAAAATTATAGAGGGG + Intronic
1087555105 11:99708901-99708923 AAATTCTAAACTGTGTAGAGGGG - Intronic
1087876404 11:103363403-103363425 AAATTCCAGAATCTTTAGAGTGG - Intronic
1088655659 11:111996959-111996981 AAATGGGAAAAAATATAGAGTGG - Intronic
1089413369 11:118265966-118265988 AAATTGCAAAAACTGGTGAGAGG + Intergenic
1090903894 11:131056847-131056869 AAAGTTCAAAATCTGTAGGGTGG - Intergenic
1091119957 11:133048844-133048866 AAAATGCACATTATGTACAGTGG - Intronic
1091232065 11:133994850-133994872 CAAGTCCAAAATTTGTAGAGTGG + Intergenic
1092411082 12:8253292-8253314 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1092530601 12:9341554-9341576 AAATTGGCAAGGATGTAGAGTGG + Intergenic
1093095430 12:14966424-14966446 AAATTAAAAAATTTATAGAGAGG - Intergenic
1093154095 12:15659567-15659589 TAATTTCAGAATATGTGGAGAGG + Intronic
1093549684 12:20393098-20393120 ATATTTCAAAATAGCTAGAGTGG + Intronic
1093604513 12:21073856-21073878 AAATTTCAAAAGAAGTAGTGGGG + Intronic
1093702121 12:22233130-22233152 AAATTTCAAAATATGAGGCGAGG + Intronic
1093792740 12:23273043-23273065 AAAAGGCACATTATGTAGAGAGG + Intergenic
1096316323 12:50569781-50569803 CAAAAGCAAAATCTGTAGAGAGG - Intronic
1098714668 12:73814967-73814989 AAATTGTAAAAGATGTAAAAAGG - Intergenic
1099071217 12:78047985-78048007 AAATAGCCAAATAGATAGAGGGG - Intronic
1099280219 12:80634807-80634829 AATTTGCAACATATTCAGAGAGG + Intronic
1099728696 12:86468982-86469004 AAATTGGATAATATGTGAAGAGG - Intronic
1100027953 12:90152555-90152577 ACATTATAAAATATCTAGAGGGG + Intergenic
1100508207 12:95241643-95241665 AAATTGCCAAATGTGGGGAGGGG + Intronic
1101197855 12:102404010-102404032 AAATTGCAAAGTATGTAGACAGG + Intronic
1101798130 12:107996259-107996281 CAATTCCAAAATAAGTAGATAGG - Intergenic
1102826117 12:115949146-115949168 TATTTGCCAAATATGTAAAGGGG + Intergenic
1103708182 12:122891268-122891290 AATTTTCAGAATATGTAGACTGG - Intronic
1104387372 12:128362973-128362995 AAATATCAAAAGATGAAGAGAGG + Intronic
1105967817 13:25400527-25400549 ATATTTCAAAATAACTAGAGAGG - Intronic
1106881407 13:34135582-34135604 AAAGGGCAAAAAATGTAGAGTGG - Intergenic
1107384880 13:39897425-39897447 ACATTTCAAAATATGTTTAGGGG - Intergenic
1107872264 13:44758260-44758282 GAATTTCAAAATATGTTGAAAGG - Intergenic
1107996466 13:45865761-45865783 CAAGTGCAAAATCTGCAGAGGGG + Intergenic
1108470127 13:50759175-50759197 AAAATGGAAAATATGTATATGGG - Intronic
1109528601 13:63608539-63608561 AAAATGCAAAATGTGGGGAGAGG + Intergenic
1109791083 13:67248180-67248202 ATATTGATAAATATGTATAGAGG - Intergenic
1109824180 13:67696655-67696677 AAATTATAAAATATGAAGAACGG + Intergenic
1110025948 13:70539327-70539349 AAATTGAAAAATATATTGGGAGG - Intergenic
1110490858 13:76104768-76104790 AAATTGAAAAATAAATAGAAGGG - Intergenic
1110727230 13:78839493-78839515 GAATTTCAAAATATGTGGGGAGG + Intergenic
1110787322 13:79544968-79544990 TTATTGCAAAAGATGTACAGTGG + Intronic
1110863695 13:80371588-80371610 AAAATGCAAAATAGGCTGAGAGG + Intergenic
1111500547 13:89114899-89114921 CAGTTGGAAAATATCTAGAGGGG - Intergenic
1111559723 13:89929545-89929567 AAACTGTAAAATATTTAAAGTGG - Intergenic
1112584658 13:100707681-100707703 ATATTTCAAAATAAGTAGAAAGG + Intergenic
1113467543 13:110522906-110522928 CAATTGCAGAATATTTAGATTGG - Intergenic
1113662752 13:112118296-112118318 AAAATTCAAATTAAGTAGAGTGG - Intergenic
1115349458 14:32377940-32377962 ATATTGAAAATTATGCAGAGAGG + Intronic
1116117472 14:40674074-40674096 TAATTGCAAAGTATGAAGAAAGG + Intergenic
1116302814 14:43207613-43207635 AAATTTAAAAATATTTAGAACGG - Intergenic
1116539994 14:46090086-46090108 AAATTGTACATTAGGTAGAGAGG + Intergenic
1118140015 14:63070647-63070669 AAATAGCACTATATGTAGAATGG - Intronic
1118141458 14:63088082-63088104 AAATTTCAAAATATATAGGATGG + Intronic
1118699893 14:68422783-68422805 AAATTCCAAATTATTTACAGCGG - Intronic
1119810147 14:77511072-77511094 AAAATAAAAAATATGTAGACAGG + Exonic
1119975646 14:79020896-79020918 GAATTGGCAAAGATGTAGAGTGG - Intronic
1120268845 14:82284834-82284856 AAATTGGATCAAATGTAGAGAGG + Intergenic
1120819491 14:88899018-88899040 AAAATACAAAATATGTATGGTGG + Intergenic
1122062461 14:99145191-99145213 AAACTGTAAAATATTTAAAGAGG - Intergenic
1123838297 15:24219786-24219808 AAATTGCAAAAAAAGAAGAGGGG - Intergenic
1123979903 15:25591657-25591679 AAATTCAAAAATATATAAAGAGG - Intergenic
1124091803 15:26612029-26612051 AAATTGCACAAAATGCATAGTGG + Intronic
1124195747 15:27626438-27626460 AAATTTCAGAATATGTAGAATGG + Intergenic
1124470040 15:29976403-29976425 AAAATGCTAAGGATGTAGAGTGG - Intergenic
1124798071 15:32801971-32801993 AAATTGCAAAAGATTTTCAGTGG - Intronic
1126738506 15:51754863-51754885 AAAATGAAAAATATCTTGAGGGG + Intronic
1126885580 15:53145801-53145823 AAAATGCAAATTATGTACAAGGG - Intergenic
1127019597 15:54731509-54731531 AAATTGCAAAATAATTAGCTGGG - Intergenic
1127340294 15:58035352-58035374 AAATTGCTAAACATGTAGCCTGG - Intronic
1127847037 15:62879125-62879147 AAATTGGAAAATCTGTAGTGAGG - Intergenic
1127858207 15:62969945-62969967 AAATGGCAGAATGAGTAGAGTGG - Intergenic
1130455894 15:84107209-84107231 AAATTCCAAAATATCTACAAAGG - Intergenic
1131481576 15:92786884-92786906 AAATTTCAAAATATTTAGAACGG + Intronic
1132060567 15:98689140-98689162 AATCTGCAAGATATCTAGAGTGG - Intronic
1133759909 16:8790138-8790160 ACATTGCAAATTGTGAAGAGTGG - Intronic
1133850568 16:9499564-9499586 AAATTGCCAAATATCTGGGGTGG - Intergenic
1135838799 16:25854811-25854833 AAACTGTAAAATATTTAAAGAGG + Intronic
1137832284 16:51555255-51555277 AAATTTAAAAATATCAAGAGAGG - Intergenic
1138873744 16:60924889-60924911 AAATTGCAAAATTTAATGAGGGG - Intergenic
1138880544 16:61008909-61008931 GAATCCCAAACTATGTAGAGAGG - Intergenic
1139176045 16:64688980-64689002 AAATTGGAAACTATGCAGATGGG + Intergenic
1141838960 16:86561945-86561967 AATTTGCAAAATGTTTAGCGAGG - Intergenic
1141877519 16:86836149-86836171 ACACTGCAAGATATGCAGAGAGG - Intergenic
1142400775 16:89857481-89857503 CTATTGTAAACTATGTAGAGTGG - Intronic
1143628458 17:8123874-8123896 AAGCTGCAAAATATGAAGAAGGG - Intronic
1143699124 17:8644757-8644779 ATATTTCAAAATAAGTAGAGAGG - Intergenic
1144805397 17:17962798-17962820 AAATTGCAAAAAATTTAGCTGGG + Intronic
1146770686 17:35566319-35566341 ACATTGCAAACTCTTTAGAGTGG - Intergenic
1147455415 17:40534956-40534978 ATATTACAAAATATCTAGTGTGG + Intergenic
1149154073 17:53605360-53605382 GAACTACAAAATATGAAGAGTGG + Intergenic
1149180981 17:53935974-53935996 TAATTGCAATATATGAAGAACGG + Intergenic
1151073301 17:71242283-71242305 TCATTGTAAAATATGTAGTGTGG + Intergenic
1151314634 17:73314016-73314038 AAAGTACAAAATATGTAGCTGGG - Intergenic
1151487333 17:74409377-74409399 AAATTACAAAATAATTAGACGGG - Intergenic
1151900072 17:77006453-77006475 AAGTTGCTAAATTTGTGGAGGGG + Intergenic
1154426175 18:14273907-14273929 ATCTTCCAAAATCTGTAGAGAGG - Intergenic
1155147002 18:23092579-23092601 GAATTGAGAAATATCTAGAGAGG - Intergenic
1155462054 18:26093590-26093612 AAATTGAAGAACATATAGAGTGG + Intergenic
1155545351 18:26908822-26908844 AAATTGCAAAATATTTCCTGGGG + Exonic
1155547407 18:26929712-26929734 AGACTGGAAAATATGGAGAGTGG + Intronic
1156523258 18:37739937-37739959 AAATGGCAAAATAAAAAGAGGGG - Intergenic
1156973358 18:43185079-43185101 AAATTGGATAATATGTTGAGGGG - Intergenic
1157077032 18:44477736-44477758 AAAATGTAAAATATGTCTAGAGG - Intergenic
1158244244 18:55412734-55412756 AAATTCCAAAATATTTAGCCAGG - Intronic
1159207011 18:65265900-65265922 AAATTGCAGAAAATGTTTAGAGG - Intergenic
1159338409 18:67100963-67100985 AAACTGCAAAACATGCAGACAGG + Intergenic
1159685419 18:71413170-71413192 ATATTTCAAAATAACTAGAGAGG - Intergenic
1160092891 18:75843872-75843894 AAAACACATAATATGTAGAGGGG + Intergenic
1160390934 18:78532096-78532118 AAATGTAAAATTATGTAGAGGGG + Intergenic
1163059117 19:14745424-14745446 ATATTTCAAAATAGCTAGAGGGG - Intronic
1163214837 19:15868841-15868863 AAAATACAAAATATGTAGCCAGG - Intergenic
1163215395 19:15872781-15872803 AAAATACAAAATATGTAGCCAGG - Intergenic
1163998790 19:21078255-21078277 AATTTGCAAAATATAGAGACTGG + Intergenic
1165659335 19:37561654-37561676 AATTCCCAAAATACGTAGAGCGG - Intronic
1166517646 19:43459496-43459518 ATATTGCAATACATGTATAGAGG - Intergenic
925625123 2:5834953-5834975 AATTAGGAAAATATGTAGATAGG - Intergenic
926379625 2:12273531-12273553 AAATTGCAAATTATATACATAGG - Intergenic
928071848 2:28224978-28225000 AAGTTGCAAAAAAAGGAGAGTGG + Intronic
928354879 2:30602664-30602686 AATGTGCATAATATATAGAGAGG - Intronic
928455035 2:31412828-31412850 AAACTGCAAGAAAGGTAGAGGGG - Intronic
929039632 2:37731431-37731453 CAATTGCATATTCTGTAGAGGGG - Intronic
929176986 2:38988656-38988678 CAATTTCAAAATATGTACAATGG - Intronic
930149180 2:48040820-48040842 AAATTGTCAAACATGTAGACAGG - Intergenic
930187125 2:48421272-48421294 AAATTTCAAAATAAAAAGAGAGG - Intergenic
930220989 2:48746464-48746486 CAAATGCAAAATCTGCAGAGTGG - Intronic
930430158 2:51265411-51265433 AAACTGTAAAATATTTAAAGAGG + Intergenic
930551724 2:52842968-52842990 AAATTCTAAAATGTGTAGACTGG - Intergenic
930715167 2:54587330-54587352 TAATTGCAACATATGGAGAAGGG - Intronic
930933577 2:56919185-56919207 AAATTGCAAGATAGGAAGATAGG - Intergenic
931496238 2:62810124-62810146 ATATCTCAAAATATGTACAGTGG + Intronic
931615100 2:64147783-64147805 AAAAGGCAAATTATGTATAGAGG + Intergenic
931863542 2:66383265-66383287 AAATTGCTAATTATCCAGAGAGG - Intergenic
935389454 2:102535122-102535144 AAAATACAAAATAGGTAAAGGGG - Intergenic
935482955 2:103616176-103616198 TAATTGCATAACATGGAGAGGGG - Intergenic
935497582 2:103800790-103800812 AAATTACAAAATAAATAGAGAGG - Intergenic
936471422 2:112802063-112802085 AAATTGCTAAGGATTTAGAGGGG - Intergenic
936660719 2:114540594-114540616 AAATAGAAAAATATTTAGTGTGG - Intronic
936892004 2:117381999-117382021 AAATTAGAAAATGTGTACAGAGG + Intergenic
937071858 2:119069826-119069848 AAAATGCAAAAAAAGGAGAGAGG - Intergenic
937690123 2:124746081-124746103 AAATTGCAAATGATATAAAGTGG + Intronic
937724943 2:125152146-125152168 AAATAGCAAAATATGGATACAGG - Intergenic
937947689 2:127354723-127354745 AAAGTACCAAATATGAAGAGAGG + Intronic
938789270 2:134662515-134662537 TAATTTCAAAATATGTATACAGG + Intronic
939311728 2:140487970-140487992 AAATTTCAAAATATTTACAATGG + Intronic
939785627 2:146507734-146507756 TAATTTAAAAATATGTAGATAGG + Intergenic
940436762 2:153665548-153665570 AAATTACAAAATATCAAAAGAGG + Intergenic
940634340 2:156279359-156279381 AAATAGCAATTTATGTACAGGGG - Intergenic
940651292 2:156443558-156443580 AAACTGCCAAATGTGTAGGGAGG - Intronic
941157075 2:161992285-161992307 AAATTCCATAGTATGTAGAATGG + Exonic
941430139 2:165404344-165404366 AGACTGCAAAATATGGAGAAAGG + Intergenic
941441691 2:165545552-165545574 GAGATGGAAAATATGTAGAGAGG + Intronic
941626081 2:167831820-167831842 AAACTGCAACATATGTAGAGAGG + Intergenic
942936478 2:181562445-181562467 AAACTGTAAAATATTTAAAGAGG - Intronic
943099017 2:183465138-183465160 AATTGGGAAAATATGTACAGTGG + Intergenic
943248767 2:185490162-185490184 AAATAGGAAAAAATGTAGATAGG - Intergenic
943418820 2:187640368-187640390 CAATTTCAAAATGTTTAGAGAGG - Intergenic
943774716 2:191752540-191752562 AAATTGAAAAATAATTAGAAAGG - Intergenic
944020709 2:195100271-195100293 ACATTTCAAAATATTTAGAAGGG + Intergenic
945755070 2:213835798-213835820 AAATTGGAAAATATGAAAACTGG - Intronic
945921838 2:215762871-215762893 AAATAGCAAAACATTTAGAAAGG + Intergenic
946234681 2:218316621-218316643 AAATTGCAAAATATGTAGAGGGG + Intronic
947078477 2:226369499-226369521 AAATTGCAAAATATCTCCTGTGG + Intergenic
947147148 2:227078533-227078555 AAATTGTAAAATGTGTATATTGG - Intronic
947484139 2:230531760-230531782 AAATTGTACAAAATGTATAGTGG + Intronic
947818740 2:233056215-233056237 CAAGTGCAAAGTCTGTAGAGTGG + Intergenic
1172963572 20:38816763-38816785 CAATTGCAAAGCATGCAGAGTGG + Intronic
1173366552 20:42391056-42391078 AAATTGAGTAATATGTAGTGGGG + Intronic
1173567453 20:44051927-44051949 AAATTCCAACAAATGTTGAGGGG + Intronic
1174014615 20:47477711-47477733 GAACTGCAAAATATTTAAAGAGG - Intergenic
1174166985 20:48592023-48592045 AAATCACAAAATATCTAGGGTGG + Intergenic
1175653827 20:60751530-60751552 GAAATGCAAAATGTGTGGAGAGG - Intergenic
1176745293 21:10646914-10646936 ACAGTGAAAAATCTGTAGAGTGG + Intergenic
1177510882 21:22086221-22086243 AAATTACATTATATGTACAGAGG + Intergenic
1177621072 21:23593799-23593821 AAATTACAAGACATGTAAAGGGG + Intergenic
1181260410 22:21593307-21593329 AGAAAGCAAAATATCTAGAGGGG - Intronic
1181734665 22:24872298-24872320 AAGTTCCAAAATATGTGGACAGG + Intronic
1183771405 22:39929230-39929252 AAATTGCAAAAATAGTACAGAGG - Intronic
949124365 3:428727-428749 AGATTGCAAAATATGTCTCGTGG + Intergenic
949574953 3:5330181-5330203 AATTTGCAAAATGAGTAGATGGG + Intergenic
951645915 3:24891206-24891228 AAATAGGAATATATGTAGAAAGG - Intergenic
952641586 3:35602971-35602993 AAAATTAAATATATGTAGAGTGG + Intergenic
953761782 3:45693932-45693954 AAATTGCAAAATAATTAGACTGG + Intronic
955205237 3:56889669-56889691 AAATAGCATCATATGCAGAGAGG - Intronic
955493133 3:59503123-59503145 TAATTGAAAAATATGTATTGGGG - Intergenic
956101795 3:65776096-65776118 AAATTGCAAACTAAGTAGGAAGG - Intronic
956646146 3:71458745-71458767 AAATTGCAGAATAAGTAAAATGG - Intronic
956763257 3:72462168-72462190 AAATTTAAAAAGATGAAGAGGGG - Intergenic
957211466 3:77264121-77264143 AAATTACAAAGTATTTAGAGTGG - Intronic
957339904 3:78882600-78882622 AAATTGGAAAATGTGGAAAGAGG - Intronic
957436931 3:80189662-80189684 AAATAGCAAAATATCTTGAAAGG - Intergenic
957684524 3:83483948-83483970 ATATTGCAAAATAGCTAGAGAGG - Intergenic
958651638 3:96943250-96943272 ATATTTCAAAATATCTAGAAGGG + Intronic
959149002 3:102585776-102585798 AAAGTACAAAATTTGTAGAGCGG + Intergenic
959480342 3:106864902-106864924 AAATTGCCTAATATGCAGACTGG + Intergenic
959685498 3:109141344-109141366 AAACTGGAAAAAATGGAGAGGGG - Intergenic
960046330 3:113202103-113202125 AAATTTAAAAATAGGTAAAGGGG - Intergenic
961726996 3:128937740-128937762 AAATTGCAAAAATAGTGGAGAGG - Intronic
962514955 3:136141683-136141705 CAATTGAAAAACATGTACAGTGG + Intronic
962851773 3:139313506-139313528 ATATTGCAATATATGTTGAGAGG - Intronic
963592390 3:147278249-147278271 ATATTTCAAAATAGCTAGAGAGG + Intergenic
963923528 3:150928113-150928135 AAATTGCAAATTATAAAGAAGGG - Exonic
965434459 3:168631897-168631919 GAATTTTAAAATATGTAGTGTGG - Intergenic
965880171 3:173379775-173379797 AAATTGCCAAAAATATACAGTGG - Intergenic
965904827 3:173690952-173690974 AAATTGCAGAAGTTGTAGAAGGG + Intronic
965995491 3:174877140-174877162 AAATTGCAAAATATGCATTTTGG + Intronic
967143321 3:186582971-186582993 AAAATGCAAAAGATGTTGAAAGG + Intronic
967200252 3:187066553-187066575 AAAGTCCAAAATATGCACAGTGG + Intronic
967464955 3:189794084-189794106 AAATTATAAAATGTTTAGAGTGG - Intronic
967616212 3:191570168-191570190 AAATTATAAAATTTCTAGAGAGG - Intergenic
968344549 3:197990371-197990393 AAATTTAAAAAAATGTAGAAAGG + Intronic
970038441 4:11768069-11768091 CAATTGAAAAATATTTAGAGAGG - Intergenic
970504773 4:16716639-16716661 AAATTACAAAATATGAAAACTGG + Intronic
971027870 4:22606436-22606458 AGACTGGAAAATATGGAGAGTGG + Intergenic
971129158 4:23786714-23786736 AAAATGCAATATATGTAGGTAGG + Intronic
971228077 4:24773332-24773354 AAAGTCCAAAATCTGTAGGGTGG - Intergenic
971637618 4:29082600-29082622 TAAATACAAAATATGTAGAGTGG - Intergenic
971875176 4:32299716-32299738 CAACTGCAAAATATGTATATTGG + Intergenic
972185665 4:36525046-36525068 ATATTGCAAAATAGCTAGAAGGG - Intergenic
972478821 4:39478842-39478864 ATGTTGTAAAATATGTAAAGTGG + Intergenic
972708823 4:41573339-41573361 AAATTAAAAAATATATAAAGGGG + Intronic
972778152 4:42262452-42262474 AAAAGGCAAAATATGGAGACAGG + Intergenic
973010689 4:45069346-45069368 AAATTGCAATATATTTAAAAGGG + Intergenic
974922456 4:68259228-68259250 AACTTACTAAATATGTAAAGAGG + Intergenic
975038986 4:69721494-69721516 GAATTACAAAATATGGAGAAGGG + Exonic
975259488 4:72279842-72279864 AAAATGCAAGATGTGTATAGAGG + Intergenic
976751503 4:88455006-88455028 AAACTGCAAGTTATGTAGACTGG - Intergenic
977371842 4:96147153-96147175 AAAGTGGAAAATATGTACTGGGG - Intergenic
977820298 4:101463896-101463918 AAATTTCAGAATACCTAGAGGGG - Intronic
977832553 4:101611299-101611321 TAATTGCACAAAATGTATAGTGG + Intronic
978771748 4:112464230-112464252 AAATTAAAAAATATATAGACTGG - Intergenic
979001311 4:115223959-115223981 AAATTGTAAAACCTGTAAAGAGG - Intergenic
980410888 4:132417028-132417050 TAATTGCACAAAATGTATAGTGG - Intergenic
980544120 4:134235143-134235165 AAATAGCATAATATATAGAGAGG + Intergenic
981020310 4:140020755-140020777 AAATTGCAAAACTTGCAAAGAGG + Intronic
981592086 4:146375479-146375501 AAATTGCAATTTAAGTACAGTGG - Intronic
982192294 4:152868544-152868566 AAATAGCAAATGATGTAGTGTGG - Intronic
983326450 4:166263614-166263636 AAATTACAAAATACAGAGAGAGG + Intergenic
983581755 4:169316439-169316461 GAATTACAAAATAGGTTGAGAGG + Intergenic
983763466 4:171444942-171444964 AAATTACAAAATCCATAGAGTGG - Intergenic
984074540 4:175158976-175158998 AAAGTGTAAAATATTTAAAGAGG + Intergenic
984146019 4:176062284-176062306 AAATTGTAAAATATTTAAACAGG - Intergenic
984657647 4:182336452-182336474 AAACTGCAAAATATTCACAGAGG + Intronic
984793655 4:183637451-183637473 ACATTGCACAATATGAGGAGAGG - Intergenic
986337807 5:6768076-6768098 ACATTTCAACATATGTGGAGGGG - Intergenic
986416401 5:7532425-7532447 AAGTTTTAAAATATGTAAAGTGG - Intronic
987247869 5:16067421-16067443 ACATTGCAAAATGTGCAGGGTGG + Exonic
987419830 5:17706340-17706362 ATAATGGAAAATATGTGGAGAGG - Intergenic
987721454 5:21638594-21638616 AAATTGCATATTATCTAGTGTGG + Intergenic
987859138 5:23461824-23461846 AGATTGCATAATATGTACATTGG + Intergenic
988036620 5:25835144-25835166 TAATTGCTAAATAAGTAAAGTGG - Intergenic
988497399 5:31756924-31756946 AAATTCCAAAATGTATATAGTGG - Intronic
989287882 5:39724067-39724089 AAATTGTAATGTATGTATAGTGG + Intergenic
989554039 5:42770914-42770936 AAATTACAAAATATCTGGAAAGG - Intronic
991093575 5:62716362-62716384 AAATTTCAAAATAAGCAGAAGGG - Intergenic
991184200 5:63788299-63788321 TAATTGAAAAATATGTGTAGGGG - Intergenic
991257896 5:64635333-64635355 AAATTATAAAACATGTTGAGGGG + Intergenic
991574191 5:68085635-68085657 AAATTGCAAAATAAGAGGTGAGG + Intergenic
992557211 5:77915712-77915734 AAATTCCAAGAGATGCAGAGAGG + Intergenic
992858073 5:80884478-80884500 AAATTGGTAAATTGGTAGAGGGG - Intergenic
992884794 5:81147749-81147771 ACAAAGCAAAATCTGTAGAGAGG - Intronic
993147282 5:84111510-84111532 AAAGTGCCAAATATGTAGAAGGG - Intronic
993228221 5:85197931-85197953 ATATTTCAAAATAACTAGAGGGG - Intergenic
993293030 5:86100124-86100146 ATATTGCAAAATATGCAGAAAGG - Intergenic
993584674 5:89709444-89709466 AAGTTTCAAAATGTGAAGAGGGG + Intergenic
993858571 5:93105482-93105504 AACTTGGAAAAGATGTATAGGGG - Intergenic
994909279 5:105882133-105882155 GACTTGCAAAGTATCTAGAGAGG - Intergenic
995225616 5:109697317-109697339 AAACTGGAAAATAAGGAGAGTGG + Intronic
995683343 5:114744828-114744850 AAATTGCAACTTATTTAAAGGGG + Intergenic
995759537 5:115548919-115548941 CAATTGAAAAATATGTAGGAGGG + Intergenic
996307791 5:122069747-122069769 AAATTGCTCAATATGTAGAGTGG - Intronic
996321647 5:122223237-122223259 AAATTTAAAAATATATTGAGAGG + Intergenic
996703242 5:126470887-126470909 AAATGGCAAAAAAGGTAGTGGGG - Intronic
997048222 5:130345754-130345776 AAACCACAAAATGTGTAGAGAGG - Intergenic
997483485 5:134207705-134207727 AAAGTGCAAAATAGGCATAGTGG - Intronic
999335984 5:150717174-150717196 AAGTAGCAAAATATAAAGAGAGG + Intronic
999346880 5:150830938-150830960 AAATTATAAAATACTTAGAGAGG + Intergenic
1000309779 5:160031220-160031242 AATTTGCACAATCTGTGGAGAGG + Intronic
1001217732 5:169871682-169871704 TGATTGCAAAATATGTAGGGTGG + Intronic
1003066320 6:2906230-2906252 AAAGAGCAAAATATGGAGCGTGG + Intergenic
1005473047 6:26180899-26180921 AAATGACAAAAACTGTAGAGTGG - Intergenic
1008139547 6:47816334-47816356 AAACTGCAAAATATCAGGAGAGG + Intronic
1008696986 6:54050017-54050039 ACATTGCAAAGTGGGTAGAGAGG + Intronic
1008951535 6:57165556-57165578 AAAATGAAAAATCTTTAGAGGGG - Intronic
1009198287 6:60713312-60713334 AACTTGCAAAATAAGGTGAGTGG - Intergenic
1009693885 6:67070761-67070783 AAATTGAAAAATAATTGGAGAGG - Intergenic
1009863701 6:69369006-69369028 AAATTGGAATATATGTACAGAGG + Intronic
1009894726 6:69734211-69734233 GAGTTGCTAAATAGGTAGAGAGG - Intronic
1010337705 6:74706250-74706272 AAATTGGAAAATATATAATGGGG + Intergenic
1010433956 6:75809425-75809447 AAACTGTAAAATATTTAAAGAGG + Intronic
1010984440 6:82406768-82406790 AAATTGCAATATATAAACAGTGG + Intergenic
1012085297 6:94818115-94818137 CAAATGCAAAAAATGTAGAGTGG - Intergenic
1013493664 6:110676013-110676035 AAATTGAAAACCTTGTAGAGAGG + Intronic
1014228755 6:118878502-118878524 AAATTATAAAATGTGTTGAGTGG + Intronic
1014347811 6:120296885-120296907 AAGTTTCAAAATATGGAGGGAGG - Intergenic
1014785616 6:125615414-125615436 AAAATGCAAAATATGGAGACTGG + Intergenic
1014972906 6:127840891-127840913 AAAAGGCAAAATATGGAGACAGG + Intronic
1015176733 6:130317606-130317628 AAATGGCAGAATAAGTAGAATGG + Intronic
1015236912 6:130981302-130981324 AAATTGCAAAGTTTGGGGAGGGG + Intronic
1015987756 6:138901683-138901705 TAATAACAAAATATGTATAGTGG - Intronic
1017126929 6:151073994-151074016 AAATGACACATTATGTAGAGAGG + Intronic
1019787816 7:2989741-2989763 AACTTCAAAAATATATAGAGAGG + Intronic
1020336717 7:7067837-7067859 ATATTGCAAATGATATAGAGGGG - Intergenic
1020562826 7:9752302-9752324 ATATTTCAAAATAGGTAGAAGGG - Intergenic
1020873073 7:13657903-13657925 AAATTGCAAAATATGAATTATGG + Intergenic
1020926904 7:14339800-14339822 AAATTGAAATATATTTACAGTGG + Intronic
1021093398 7:16508890-16508912 AAATTGCACCATATGTAGCCCGG + Intronic
1021443422 7:20706256-20706278 AAATAGCAAATTTTGTGGAGTGG - Intronic
1021832207 7:24625975-24625997 ACATTGCTAGATATGCAGAGAGG + Intronic
1022075386 7:26963923-26963945 AAACTGAAAAATATGTCGAAAGG - Intronic
1022263322 7:28728505-28728527 AACCTGGAAAAGATGTAGAGTGG + Intronic
1022755473 7:33283704-33283726 AAATTGCAAAAAAAGGAAAGGGG - Intronic
1023305777 7:38825459-38825481 AAATGGCAAAATAAATAAAGAGG - Intronic
1023355572 7:39363958-39363980 AAATGGCATAATAGCTAGAGGGG + Intronic
1024157695 7:46641422-46641444 AAATTTTAAAATAATTAGAGTGG - Intergenic
1024597264 7:50948544-50948566 AAATTCTAAAATTTCTAGAGTGG - Intergenic
1026214799 7:68338879-68338901 AATCTGCAAAATCTGTAGTGTGG - Intergenic
1027675401 7:81151393-81151415 TAAGTTAAAAATATGTAGAGAGG - Intergenic
1027731232 7:81875873-81875895 AAACTGCAAAATATCTAGGGAGG - Intergenic
1028013117 7:85674457-85674479 AAAATGAAAAATATATAAAGTGG - Intergenic
1030102572 7:105959309-105959331 AAATTGAAAAATAAATGGAGTGG - Intronic
1030172976 7:106623427-106623449 AAAATGGAAAATATCGAGAGAGG - Intergenic
1030675277 7:112378487-112378509 ATATTCCAAAATATGTTAAGTGG - Intergenic
1030847970 7:114445627-114445649 AAATTGCAGATTATGCAGACTGG + Intronic
1031312631 7:120217786-120217808 AAAATGTAAGATATGTAAAGGGG - Intergenic
1031475614 7:122217448-122217470 ATATAGAAGAATATGTAGAGAGG + Intergenic
1031946588 7:127848136-127848158 AAATTGCAAATCATGGAGACAGG - Intronic
1032421989 7:131789306-131789328 AAATTTCAAAAAATACAGAGGGG - Intergenic
1032643167 7:133792393-133792415 AAATTGAAAAATTAGTCGAGTGG + Intronic
1033068202 7:138176522-138176544 AAGAAGCAAAATATGTACAGAGG + Intergenic
1033271065 7:139933631-139933653 TAACTGCAAAGTATCTAGAGAGG - Intronic
1034038664 7:147852287-147852309 AGTTTGCAAAATAGGAAGAGTGG - Intronic
1034379985 7:150683327-150683349 AAATTCCAAAACATGGGGAGGGG - Intergenic
1034543015 7:151771242-151771264 AAAATGCCAAAAATGTAAAGCGG - Intronic
1035089171 7:156291798-156291820 GAAATGCAAAAGATGTAGAATGG - Intergenic
1035376226 7:158408289-158408311 AAATTGAAAAATATGCATAGTGG - Intronic
1035890156 8:3334759-3334781 AATTTGCAGAGTAAGTAGAGTGG + Intronic
1036851463 8:12204464-12204486 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1036872828 8:12446738-12446760 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1037209605 8:16370707-16370729 AAACTGTAAAATATTTAAAGAGG + Intronic
1037390184 8:18385205-18385227 AAAGTGAAAAATATTTACAGGGG + Intergenic
1037477844 8:19275189-19275211 AAATTACAGAATATTTAGAAAGG - Intergenic
1038144341 8:24880587-24880609 AAATTGCACAATACAAAGAGTGG - Intergenic
1038604813 8:28989929-28989951 AAAATATAAAATATTTAGAGAGG - Intronic
1038729672 8:30115660-30115682 AAATAGCAAAATATATAAACAGG + Intronic
1039040315 8:33401720-33401742 AAAATGCAAATTATGAAAAGTGG + Intronic
1039670741 8:39595090-39595112 AACTTACAAAAAATGTAGAGAGG - Intronic
1040076203 8:43233989-43234011 AAATTAGAAAATATCTGGAGTGG + Intergenic
1040563127 8:48542367-48542389 GAACTGCTAAATTTGTAGAGAGG + Intergenic
1041223514 8:55675216-55675238 AACCTGAAAATTATGTAGAGTGG - Intergenic
1041502819 8:58557661-58557683 AGATTGCAAATAATGTAGTGTGG + Intronic
1041559443 8:59198379-59198401 AAATTGCAATATATGTGCACTGG + Intergenic
1042610088 8:70589270-70589292 AATTTACAAATTATGTAGAGAGG - Intronic
1043041932 8:75274813-75274835 AAATTAGAAAATATTTAGAGTGG + Intergenic
1043176819 8:77031684-77031706 AAATTTGAAAATGTGTAGAGAGG + Intergenic
1043198195 8:77327845-77327867 AAATTGCAAAGCATGGAGGGAGG - Intergenic
1044033445 8:87267174-87267196 AAATTACAAAATATATAAATTGG + Intronic
1044130397 8:88516407-88516429 AAATTACAAAATGTGTATATTGG + Intergenic
1044187195 8:89267999-89268021 AAAATGTAAAATATATAGACAGG + Intergenic
1046644393 8:116768990-116769012 AAATTGCAAAATTTAAAGGGAGG - Intronic
1046967345 8:120182408-120182430 AAATTGCAAAATATCAGGATTGG + Intronic
1047057590 8:121183295-121183317 AAATTGGAAAATATTTAAAAAGG + Intergenic
1047981615 8:130189179-130189201 ATATTTCAAAATAACTAGAGTGG - Intronic
1047983467 8:130208117-130208139 AAATTGTAAAACTAGTAGAGAGG + Intronic
1050406817 9:5317748-5317770 AACTTGCAAAAGATGTAAATTGG + Intergenic
1050409503 9:5348099-5348121 AAAGTGGCAAATATGTAGGGTGG + Intergenic
1050987674 9:12103579-12103601 AATTTGCAAGATATTTAAAGGGG - Intergenic
1051859825 9:21611972-21611994 AAATTTGAAAAGATGTGGAGAGG - Intergenic
1051985013 9:23074417-23074439 AACTTTCAAAATATGTAAAACGG - Intergenic
1052086877 9:24278527-24278549 AAATAGAAAAATATTTTGAGTGG + Intergenic
1052298409 9:26925212-26925234 GAATTACTAAATATGTAGATTGG - Intronic
1052682598 9:31713309-31713331 AAATTCCAAAAAATGTATTGGGG - Intergenic
1055697624 9:78903831-78903853 AAATTTGGCAATATGTAGAGTGG + Intergenic
1056006375 9:82275840-82275862 AAATTGATAACTTTGTAGAGAGG - Intergenic
1056111513 9:83400551-83400573 AAAAGGCAAAAGATTTAGAGTGG + Intronic
1057517608 9:95735358-95735380 GAAATGCATAATATGTGGAGAGG - Intergenic
1057863290 9:98659255-98659277 AAATTGTAAAATATGCAAAAGGG - Intronic
1058008326 9:99944329-99944351 CAATTGCAAAAAAAGTAGAAAGG - Intronic
1059252626 9:112900128-112900150 AAAGTGCTAAATATTTACAGTGG - Intergenic
1059533712 9:115061683-115061705 AAAAGGCAGCATATGTAGAGTGG + Intronic
1059598225 9:115746387-115746409 ATAGTGTAAAAAATGTAGAGGGG - Intergenic
1059983846 9:119802385-119802407 AAATGGCAAAATATGAAGACAGG + Intergenic
1186031832 X:5376678-5376700 TAATTGCAAGATGTGTAGAAAGG - Intergenic
1186374695 X:8987145-8987167 AAATTGTAACATATGAAGAGTGG + Intergenic
1186818868 X:13265776-13265798 AAACTGAATAATATGTAGTGAGG - Intergenic
1186941372 X:14511430-14511452 AAATTGCTAAATATGAATAAAGG - Intergenic
1187017002 X:15339246-15339268 AAATTGCAAATTATGTTGCTTGG - Intergenic
1187782700 X:22846444-22846466 GAAAGGCAAAAAATGTAGAGAGG + Intergenic
1188669645 X:32867916-32867938 AAATGGAAAAATATGGAGAGAGG + Intronic
1188727184 X:33600402-33600424 AAAGTGCAACATATGTACAATGG - Intergenic
1188733169 X:33677595-33677617 AAAGTTCAAAATATTTAGAGTGG - Intergenic
1188745067 X:33831161-33831183 AGATCCCAAAATATGCAGAGAGG + Intergenic
1189079547 X:37956319-37956341 ACATTTAAAAATTTGTAGAGAGG - Intronic
1190853675 X:54271300-54271322 AAAGAACAAAATATGTAGATGGG + Intronic
1193624468 X:83799707-83799729 AACTTTCAAAATAGCTAGAGGGG + Intergenic
1193625265 X:83812636-83812658 ATATGAAAAAATATGTAGAGTGG + Intergenic
1193950684 X:87794296-87794318 CTATTTCAAAATATATAGAGAGG - Intergenic
1194397898 X:93408504-93408526 CAATTGCAACACATGGAGAGTGG + Intergenic
1194799406 X:98253317-98253339 AAATGGCAATATCTGTAGATGGG + Intergenic
1194849450 X:98853636-98853658 AAATTGTCAAAAATGTAGTGAGG + Intergenic
1195300681 X:103527116-103527138 AAAGTCCAAAATCTGCAGAGTGG - Intergenic
1195765436 X:108291692-108291714 AAAATGCCAAAAATGCAGAGAGG + Intronic
1197302069 X:124793333-124793355 AAATCACAGAATATGTAGACTGG + Intronic
1197363378 X:125534538-125534560 AAATTGCAAAATATAAAAATAGG - Intergenic
1197825299 X:130583579-130583601 AAATTGGAAAATATTTTGAGTGG + Intergenic
1197841299 X:130749771-130749793 AAATTGCAAAATAAATGGAGAGG - Intronic
1198539034 X:137617056-137617078 AAATTGGACAAGATGTAGATTGG + Intergenic
1198589516 X:138161589-138161611 AAATTTTAAAATATCTACAGAGG + Intergenic
1199097333 X:143758330-143758352 AATTTGAAAAATATGTAGATTGG - Intergenic
1200319714 X:155174634-155174656 AAATTGCATATAATGTATAGGGG - Intergenic