ID: 946236315

View in Genome Browser
Species Human (GRCh38)
Location 2:218326643-218326665
Sequence ATACTCTCCCACCCAACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946236315_946236317 -1 Left 946236315 2:218326643-218326665 CCTGGAGTTGGGTGGGAGAGTAT 0: 1
1: 0
2: 3
3: 19
4: 176
Right 946236317 2:218326665-218326687 TCTATGGCCCTGTGTCCTTCTGG 0: 1
1: 0
2: 5
3: 42
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946236315 Original CRISPR ATACTCTCCCACCCAACTCC AGG (reversed) Intronic
900004617 1:36523-36545 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
901501664 1:9656140-9656162 CTCCTCCCCCACCCTACTCCTGG - Intronic
901898123 1:12332609-12332631 ACCCTCTCCCACCCAACTCCAGG - Intronic
902477743 1:16697137-16697159 ATCCTCCCCCACCCTACTCACGG + Intergenic
903345701 1:22682777-22682799 ATATTCTCCCACAAAATTCCTGG - Intergenic
904145961 1:28391474-28391496 CTCCACTCCCACCCAGCTCCTGG - Intronic
905301145 1:36986960-36986982 ATAGTCACCCACCCAACCCAAGG + Intronic
905639246 1:39577035-39577057 ACACCCTCCCACCCATCACCCGG + Intergenic
909581007 1:77234767-77234789 TCTCTCTCCCATCCAACTCCTGG - Intergenic
909666019 1:78134473-78134495 GTACTCTCCCACCCCATGCCAGG + Intronic
911653392 1:100415223-100415245 ATACTCTCTCACCCCTCTCATGG - Intronic
912634460 1:111279045-111279067 AAACTCTGCCCCCCAACTCCAGG + Intergenic
915913746 1:159929451-159929473 AGACTCTCTCACCCAACACCAGG + Intronic
916788412 1:168103681-168103703 TTACTCTCCTCCCCAATTCCTGG + Intronic
917839521 1:178966363-178966385 ATACTCTTTCAACCAACACCAGG - Intergenic
920865518 1:209748928-209748950 ATTCCCTCCCACCCACTTCCTGG + Intergenic
921256903 1:213349959-213349981 ATCCTGTCTCACCCAACTCATGG + Intergenic
1063556982 10:7089854-7089876 TTTCTCTCCCACCCAGGTCCTGG + Intergenic
1063663420 10:8048715-8048737 CTTCTCTCCCACCCAACCCGGGG + Intergenic
1064209485 10:13350313-13350335 CTACGCTCCCCCGCAACTCCCGG + Intergenic
1067644441 10:48083304-48083326 CTACTCTCCCATCCAACACAGGG + Intergenic
1067957986 10:50814163-50814185 AGAGTCTCCCACCCATCTTCAGG - Intronic
1068884000 10:62079751-62079773 CAACTCTCCCACCCACTTCCAGG + Intronic
1068960047 10:62858590-62858612 AGCCTCTCCCACCCTCCTCCAGG + Intronic
1074102284 10:110363299-110363321 ATCCAATCCCACCCAAATCCAGG + Intergenic
1075633187 10:124013603-124013625 ATATTCTCCAACCCACCTTCAGG - Intronic
1077079700 11:719792-719814 ATCCTCACCCGCCCACCTCCTGG - Intronic
1077510718 11:2960381-2960403 CTTTTCTCCCACCCACCTCCCGG - Intronic
1080754469 11:35183008-35183030 ATGCTCTTGCTCCCAACTCCAGG - Intronic
1083669302 11:64291510-64291532 CTCCTCTGCCACCCACCTCCCGG + Intronic
1084161255 11:67351627-67351649 ATGCTCTCCCACCTAAGGCCAGG - Exonic
1085283612 11:75346193-75346215 ATACTCCAGCACCCAGCTCCGGG + Intronic
1085522030 11:77144607-77144629 ATCCCCTCCCTCCCAACTCCAGG + Intronic
1086599718 11:88617861-88617883 AGCCTCTCCCACCCACCTCCTGG - Intronic
1087165059 11:94994775-94994797 TCTCTCTCCCACCCAACCCCAGG - Intronic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1089202105 11:116730794-116730816 ATCCCCTCTCACCCAAATCCTGG + Intergenic
1090212715 11:124934066-124934088 CCTCTCTGCCACCCAACTCCAGG + Intronic
1091130088 11:133138688-133138710 AACATCTCCCACCCCACTCCTGG + Intronic
1092241575 12:6839275-6839297 ACACTCTCCTCCCCAACCCCAGG + Exonic
1100243096 12:92729476-92729498 TTCATCTCCCACCCCACTCCTGG + Intronic
1103496331 12:121365145-121365167 ATTCTCCCTCCCCCAACTCCTGG + Intronic
1103896145 12:124274522-124274544 ATACTCTCACGCCAAACTCTGGG + Intronic
1105931462 13:25056637-25056659 ATAATTTCCCACCCAAGTCCTGG + Intergenic
1108125144 13:47234433-47234455 ATGCTTTCCCACCAAAATCCTGG + Intergenic
1108816708 13:54301445-54301467 TTACTCTTCCCCCCAACTCCAGG - Intergenic
1112699320 13:101987204-101987226 ATACTTTCCCATCCCACTCCAGG + Intronic
1113075217 13:106461374-106461396 AGAGTGTCCCACCAAACTCCTGG - Intergenic
1114717411 14:24842147-24842169 ATAGTCTCCCACCCAAGACCTGG - Intronic
1115037028 14:28870363-28870385 ATACTGTGCCACCGAACTGCAGG - Intergenic
1115852080 14:37596450-37596472 AGACTCTCCCACCGACGTCCAGG - Intronic
1116538345 14:46064554-46064576 CCACTCTCCCTCCCAACCCCTGG + Intergenic
1117068796 14:52037428-52037450 ATGCTATCCCTCCCCACTCCCGG + Intronic
1117798209 14:59416382-59416404 GAACTCTCACACCCAACTGCTGG - Intergenic
1123148208 14:106154558-106154580 TTACTCCCTAACCCAACTCCAGG + Intergenic
1125325764 15:38534636-38534658 CTTCTCTCCCACCCAACTGCTGG + Intronic
1125591764 15:40858739-40858761 AAACCCTCCCACACAACTGCAGG + Intergenic
1126331062 15:47532014-47532036 ATACACTCCAGCCCCACTCCCGG + Intronic
1128708415 15:69854010-69854032 CTTCTCTCCCACCCACATCCAGG + Intergenic
1128810324 15:70566651-70566673 TTGCTCTCCCACCCAGCCCCGGG - Intergenic
1132448891 15:101954420-101954442 AGCCTCTCCCACCCAAGTGCTGG - Intergenic
1134765677 16:16755660-16755682 TTAATCTCCACCCCAACTCCAGG + Intergenic
1135187234 16:20325881-20325903 ACCCTCTCCCACCCTCCTCCAGG + Intronic
1136672225 16:31868876-31868898 ATACATTCCCACCCACATCCGGG - Intergenic
1136682000 16:31973075-31973097 TTACTCCCTAACCCAACTCCAGG - Intergenic
1136782307 16:32914577-32914599 TTACTCCCTAACCCAACTCCAGG - Intergenic
1136887479 16:33939274-33939296 TTACTCCCTAACCCAACTCCAGG + Intergenic
1137433723 16:48438610-48438632 ATAATCTCCCACCTATTTCCAGG - Intronic
1137500971 16:49011348-49011370 ATACTGTCTCTCCCAACCCCAGG - Intergenic
1138490674 16:57374421-57374443 ATTCACTCCCACTCAAGTCCTGG + Intronic
1139374512 16:66488375-66488397 ATACTCTTCAACACAACTCAGGG + Intronic
1203084972 16_KI270728v1_random:1178564-1178586 TTACTCCCTAACCCAACTCCAGG - Intergenic
1143010931 17:3865850-3865872 AGACCTCCCCACCCAACTCCAGG + Exonic
1143107956 17:4538753-4538775 ATACTCACCCACCAAGCTCTGGG + Exonic
1143172452 17:4938113-4938135 GCACCCTCCCACCCACCTCCAGG + Intronic
1143385309 17:6525989-6526011 ATCCTCATCCACTCAACTCCTGG - Intronic
1146322509 17:31858191-31858213 ATGCTCTGAGACCCAACTCCAGG + Intronic
1148442811 17:47720602-47720624 AAACTCTCCCACCTACATCCAGG + Intergenic
1149183255 17:53966171-53966193 CTTCCCTCCAACCCAACTCCTGG + Intergenic
1149276914 17:55051606-55051628 ATACCATCACACCCAACTCAGGG - Intronic
1149448237 17:56730391-56730413 ATACCCTCCCACACAACCTCTGG + Intergenic
1150230381 17:63546400-63546422 AGACTCTCCCACCCTGCACCAGG - Exonic
1152724865 17:81940172-81940194 AGCCTCTCCCACCCACGTCCGGG - Exonic
1155160698 18:23193076-23193098 ACACTCCCCCACCCAACTCTAGG - Intronic
1157379948 18:47205006-47205028 TTATTCTCCCTCCAAACTCCTGG + Intergenic
1157606931 18:48931865-48931887 ATTCTCTCCCAGCCCCCTCCTGG + Intronic
1159768748 18:72522783-72522805 ACCCTCCCCCACCCAACCCCAGG - Intergenic
1159782275 18:72674118-72674140 ATTTTCTCCCACCCCACCCCAGG + Intergenic
1160499260 18:79394333-79394355 AAACTCTCCCCGCCAAATCCTGG + Intergenic
1160636369 19:78132-78154 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
1160963461 19:1735056-1735078 AGACTCTCTCCCCCACCTCCAGG - Intergenic
1166833229 19:45650901-45650923 ATCCCCTGCCTCCCAACTCCAGG - Intergenic
1168209584 19:54880969-54880991 CTCCTCTCCCACCCAAGTGCTGG + Intronic
1168724041 19:58570982-58571004 ACACTCACTCACCCATCTCCGGG + Exonic
1202711760 1_KI270714v1_random:22963-22985 ATCCTCCCCCACCCTACTCACGG + Intergenic
925152165 2:1622470-1622492 ATCCACACCCACCCAACCCCTGG - Intergenic
927741011 2:25569626-25569648 ATATACCCCCACCCAACTGCTGG - Intronic
927841562 2:26448369-26448391 ACACTCTCCCTCCCACTTCCTGG + Intronic
930071357 2:47369179-47369201 CTACTCACTCCCCCAACTCCCGG + Exonic
932197656 2:69798150-69798172 ATAACCTCCCACCCAACCCCAGG + Intronic
936742748 2:115534244-115534266 ATGCTATCCCTCCCCACTCCCGG + Intronic
937230639 2:120396373-120396395 CTACCCTCCAACCCGACTCCAGG + Intergenic
937276959 2:120691060-120691082 CTCCACTCCCACCCACCTCCAGG + Intergenic
937318478 2:120947026-120947048 ATACAATCCCACCCTACTCTGGG - Intronic
940224746 2:151389622-151389644 ATACTCTATCACCCAACTCTTGG - Intergenic
945542432 2:211105404-211105426 ATATTCACCCACCCACCTGCCGG + Intergenic
946236315 2:218326643-218326665 ATACTCTCCCACCCAACTCCAGG - Intronic
1169098016 20:2920727-2920749 ATACTCTCCCACCTCAAACCAGG - Intronic
1169975303 20:11319089-11319111 CTCCTCTCCCACCCAGCCCCTGG + Intergenic
1172020430 20:31909937-31909959 ATTCCCTCCCACCCAGCCCCTGG - Intronic
1175068523 20:56311805-56311827 ATAGTCTCCCCCCCATCTCTTGG + Intergenic
1175950647 20:62581456-62581478 GTACTCCCCCACCCCACGCCAGG + Intergenic
1176019704 20:62956411-62956433 CTCCTCTGCCACCCATCTCCTGG + Intronic
1177348765 21:19907221-19907243 ATACTGTGCCACCGCACTCCAGG + Intergenic
1177771423 21:25519978-25520000 ATAATCCCTCCCCCAACTCCAGG + Intergenic
1181094848 22:20497850-20497872 CTACTTCCCCACCCATCTCCTGG - Intronic
1183186913 22:36297141-36297163 AGACACTCGCACCCAACTCCTGG + Intronic
1183865560 22:40701466-40701488 ATACCCTCCCATACATCTCCCGG + Intergenic
1184831328 22:46990652-46990674 ATCCCCTTCCACCCAACCCCTGG + Intronic
951811175 3:26701701-26701723 ACACTCTGCCTCCCAACTCCAGG + Intronic
953540616 3:43814519-43814541 CCAATCTCCCAGCCAACTCCTGG - Intergenic
958078061 3:88709804-88709826 TTAATCTCTCCCCCAACTCCAGG - Intergenic
961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG + Intronic
964596404 3:158437153-158437175 ATACTATCCTACCAAATTCCCGG + Intronic
965065596 3:163843581-163843603 AGACTCTCCCTGCCAAATCCTGG + Intergenic
966156466 3:176922101-176922123 ATGCTCTCCCACCGATCTGCAGG + Intergenic
966327997 3:178778749-178778771 ACACCCTCCAACCCGACTCCTGG + Intronic
966689146 3:182725665-182725687 GTAACCTCCCACCCAACCCCAGG + Intergenic
967274402 3:187759739-187759761 ATTCTCTCCCTCCCACCTCTAGG - Intergenic
969594934 4:8143480-8143502 ATACTCTCCCTCCCATCTCGGGG + Intronic
970460663 4:16271632-16271654 ATACACTCCCACTAAACTCGTGG + Intergenic
976481816 4:85555571-85555593 ATCCTCTCCCACTCAAGTCCTGG + Intronic
977735353 4:100408643-100408665 ATCCTCTCCCACTCAAGTGCTGG + Intronic
978174059 4:105708559-105708581 CTACTCTCCCACCTCGCTCCTGG + Intronic
979693222 4:123582637-123582659 ATATTCTCTCACCCTAATCCTGG - Intergenic
982990886 4:162272312-162272334 ATAGTCTCCCACCTGCCTCCAGG + Intergenic
983157624 4:164370458-164370480 ATACTCTCTCACCAGTCTCCTGG + Intronic
983672449 4:170254131-170254153 ATACTTTACCTCCCAACCCCTGG - Intergenic
984703141 4:182831777-182831799 TTACTTTCCCACCCAACCTCTGG + Intergenic
986399170 5:7362795-7362817 AAAGTCTCCCATCCAATTCCTGG + Intergenic
987363374 5:17126672-17126694 ATAATTTGCCACCCACCTCCTGG + Intronic
988039134 5:25865299-25865321 CCTCTCTCCAACCCAACTCCTGG + Intergenic
989196285 5:38719711-38719733 ATTCTTTCTCTCCCAACTCCAGG + Intergenic
995054753 5:107746536-107746558 ATACTCTGTCCCCCAACTCCAGG - Intergenic
997370008 5:133353492-133353514 ACACTCTCCTGCCAAACTCCAGG - Intronic
998181411 5:139948072-139948094 CTCCTCCCCCACCCAACCCCTGG + Intronic
1001803177 5:174560824-174560846 AAAATCTCAAACCCAACTCCTGG - Intergenic
1002668655 5:180846791-180846813 ATCCTCTCCCACCCAGTACCTGG + Intergenic
1004762285 6:18680829-18680851 CTTCTCTACCACCCAACCCCTGG - Intergenic
1006902285 6:37510980-37511002 TCACTCTCTCACCCTACTCCTGG + Intergenic
1006927924 6:37668777-37668799 ATAATCTCCCACCCCACCCAAGG - Intronic
1009771641 6:68151281-68151303 ACACAGTCCAACCCAACTCCAGG + Intergenic
1009934884 6:70222408-70222430 ATATTCACCCAGCCTACTCCTGG + Intronic
1011988999 6:93488679-93488701 AGGCTCTCCCACTCAAATCCTGG - Intergenic
1012264514 6:97125217-97125239 TTACTCTCTCACTCAACCCCAGG - Intronic
1012521099 6:100122094-100122116 ATACCCTCACACCCACCTGCAGG + Intergenic
1015249368 6:131110915-131110937 ATAATCTCCCAACAAACTTCAGG + Intergenic
1016016021 6:139186936-139186958 ATATTCCTCCACCCATCTCCAGG - Intergenic
1019047800 6:169161827-169161849 ATGGTCTCCTACCCATCTCCTGG + Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020247112 7:6438196-6438218 CTCCTCCCCCACCCAACTACAGG - Intronic
1023864330 7:44231766-44231788 AGACTCTCCCACCCTGCTCCAGG + Intronic
1026877956 7:73890512-73890534 GGACTCCCCCATCCAACTCCAGG - Intergenic
1027590513 7:80113215-80113237 ATATTTTCCCACCCAATTCATGG + Intergenic
1028014847 7:85695366-85695388 ATACTTTCCCCCAAAACTCCAGG + Intergenic
1028799173 7:94942300-94942322 TTATTCTCCCACCCAAGTCTAGG - Intronic
1030334795 7:108313811-108313833 ATGCTCTCCTACACAACTCTAGG - Intronic
1035745417 8:1959176-1959198 AAATTCTGCCAACCAACTCCTGG - Intergenic
1036491662 8:9231870-9231892 ATACTCTCCCAGCCACCTGAAGG + Intergenic
1039709702 8:40043248-40043270 ATTCTGTCACATCCAACTCCTGG + Intergenic
1042237508 8:66627705-66627727 CAACTCTGCCACCTAACTCCAGG + Intergenic
1042876830 8:73448143-73448165 ATCCTCTCCCTCCCAGCTGCAGG + Intronic
1044792830 8:95865146-95865168 AGACTCTGACACCCCACTCCAGG - Intergenic
1044952147 8:97445192-97445214 ATCCTCTCCCACGAAAATCCTGG - Intergenic
1045582176 8:103493906-103493928 ATAGTCTCTCACCCAATTCCTGG + Intergenic
1047867188 8:129038859-129038881 ATACTCACACACACAACTCTGGG - Intergenic
1049107260 8:140622218-140622240 ATTCGCTCCCACCCAGCCCCTGG - Intronic
1049887312 9:36306-36328 AGCCTCTCCCACCCAAGTGCTGG + Intergenic
1053157277 9:35790512-35790534 ATACACTCCCACCCCACTCCAGG + Intergenic
1054916949 9:70503492-70503514 GTCCTGTCCCCCCCAACTCCCGG + Intergenic
1056114594 9:83429685-83429707 ATAATCTCCCACTCAGCACCTGG - Intronic
1060362219 9:122970282-122970304 ACACTATCACACCCAACTCATGG - Intronic
1185579400 X:1198469-1198491 ACACCCTCCCTCCCACCTCCCGG + Intronic
1186695274 X:12023710-12023732 ATGCTCTCTCATCCACCTCCAGG + Intergenic
1187016617 X:15335360-15335382 AGACCCTCCGACCCAACTTCCGG + Intronic
1187035236 X:15531627-15531649 ATCCTCTCCTGCCCCACTCCAGG + Intronic
1187391725 X:18890651-18890673 ATCCTCCCCCACTCCACTCCAGG + Intergenic
1188854836 X:35181175-35181197 ATCCTCTCCCCCCCAGCTTCTGG + Intergenic
1189259902 X:39670851-39670873 CCTCTCTCCCACCTAACTCCTGG + Intergenic
1189286037 X:39853385-39853407 CTGCTCTCCCACCCATCCCCAGG + Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1191904422 X:66073915-66073937 ATAGACTCACTCCCAACTCCTGG + Intergenic
1197641835 X:128976001-128976023 ATCCTCACCCTCCCAACTCAAGG + Intergenic
1197767684 X:130069711-130069733 AAGGTCTCCCACCCAGCTCCCGG - Intronic
1197970272 X:132108240-132108262 ATTCACTCCCACCCAGCTGCTGG - Intronic
1198800728 X:140445312-140445334 ATACTCTCACAAACAACTCTTGG - Intergenic
1200863672 Y:8019611-8019633 TGACTCTCCCACCCAAAGCCAGG - Intergenic
1202379822 Y:24266833-24266855 GGGCTCTCCCACCCAACTCGCGG + Intergenic
1202490960 Y:25403288-25403310 GGGCTCTCCCACCCAACTCGCGG - Intergenic