ID: 946237112

View in Genome Browser
Species Human (GRCh38)
Location 2:218330785-218330807
Sequence ATTCTAATATAGGTGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946237104_946237112 -7 Left 946237104 2:218330769-218330791 CCAGCACCCCCAGATCATTCTAA 0: 1
1: 0
2: 1
3: 18
4: 216
Right 946237112 2:218330785-218330807 ATTCTAATATAGGTGGGCCAAGG 0: 1
1: 1
2: 0
3: 21
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946237112 Original CRISPR ATTCTAATATAGGTGGGCCA AGG Intronic
903384744 1:22918995-22919017 ATTCTGATACAGGTGGGCGATGG - Intergenic
903416910 1:23189804-23189826 ATTCTAATGCAGGTGGTACAGGG + Intergenic
904653940 1:32028223-32028245 ATTCTGATATTGCTGGTCCAGGG - Intronic
905508357 1:38498751-38498773 ATTTTAATTAAGGAGGGCCAGGG - Intergenic
907271169 1:53292065-53292087 ATTTGAATAAAGGTGGTCCATGG - Intronic
908082689 1:60598164-60598186 ATTCTAATATAGGTTGAGAAGGG - Intergenic
910013104 1:82489776-82489798 ATACTAATAGTAGTGGGCCAAGG + Intergenic
916601122 1:166294415-166294437 ATTGTAATATAGGTGGGGAGAGG + Intergenic
918489569 1:185066680-185066702 CTTCTAATATGGGTAGGCAAAGG + Intronic
924596187 1:245446987-245447009 CTGTAAATATAGGTGGGCCATGG + Intronic
1063037844 10:2304972-2304994 ATTCTTACCTATGTGGGCCAGGG + Intergenic
1063097498 10:2921373-2921395 ATCCAAAGATAGGTGGTCCATGG + Intergenic
1063325139 10:5092248-5092270 ATTTTAATGTATGTGGGCCTTGG + Intronic
1063622749 10:7664428-7664450 ATTCTGATGCAGGTGGTCCATGG - Intronic
1073024089 10:100473634-100473656 ATTCTATTATGGGTTGGACATGG + Intronic
1077659392 11:4053896-4053918 AATCTAATATAGGCCGGGCATGG - Intronic
1078479433 11:11663273-11663295 ATTCTAATGAAAGTGGACCATGG - Intergenic
1080297472 11:30746785-30746807 ATGGTAATATAGCTGGGCAAAGG + Intergenic
1080403732 11:31959913-31959935 ATTCTAAAACAGGTGAGTCATGG - Intronic
1082171028 11:49005512-49005534 ATTCTATTATAAATGGTCCAAGG - Intergenic
1082842316 11:57699502-57699524 ATCCTAATGTAGGTGGACCCAGG + Intronic
1083800530 11:65044047-65044069 ATTCAAATATAGGTTGGGGAAGG + Intronic
1085883968 11:80500400-80500422 ATTCTATTATGGGAGAGCCATGG + Intergenic
1087450323 11:98312935-98312957 TGTTTAATACAGGTGGGCCAAGG + Intergenic
1087905579 11:103693062-103693084 ATTCTAATATAGTATAGCCAAGG - Intergenic
1089639501 11:119838430-119838452 ATTCTAATACAGGAGGCTCACGG + Intergenic
1090460629 11:126888560-126888582 ATTCTAAGATAAGTGGGACTTGG - Intronic
1090754073 11:129773272-129773294 ATTCAAAAATAGGTTGGGCATGG + Intergenic
1090786190 11:130049523-130049545 ATTCTCATTTGGGTGGGTCATGG - Intergenic
1097410757 12:59249854-59249876 ATTCTAATATTGCTGGTTCATGG - Intergenic
1098354754 12:69601813-69601835 ATCCTAATATTGGGAGGCCAAGG + Intergenic
1100044769 12:90366332-90366354 ATTCTAACACAGCTGGCCCATGG + Intergenic
1102015413 12:109644970-109644992 AATCTGACATAGGTGGGCCAGGG - Intergenic
1102634712 12:114312783-114312805 ATTCTAATTTGGTTGGTCCAGGG + Intergenic
1103266918 12:119638509-119638531 ATTCTAATTTAATTGGTCCAGGG - Intronic
1106628558 13:31445908-31445930 ATCAAAATATAGGTGGTCCAGGG - Intergenic
1117114222 14:52493249-52493271 ATTCTAACATTGGTGGGACTTGG - Intronic
1118692749 14:68355496-68355518 TTTCTAATATCAGTTGGCCATGG + Intronic
1119041208 14:71276377-71276399 TTTTGAATTTAGGTGGGCCAGGG - Intergenic
1119686968 14:76640687-76640709 GTTCTAATGTAGGTGGCCCAAGG + Intergenic
1120004303 14:79339536-79339558 ATGCTAATGCAGGTGGTCCAGGG - Intronic
1122390365 14:101376978-101377000 ACTCTAGTATAGGTGAGCCTTGG + Intergenic
1127520834 15:59741597-59741619 ATTGTAATATATGTGTGCAACGG - Intergenic
1131213487 15:90517859-90517881 ATTCTGATATAGGTGGTCTATGG - Intergenic
1133891272 16:9881550-9881572 ATTCTAATCTAGGTAGCCCAAGG + Intronic
1135100348 16:19599738-19599760 ATTTTAATGTAGGTGGTCCAAGG + Intronic
1135698092 16:24607930-24607952 TTTCTAACATAGGTGGTCCCAGG + Intergenic
1135782424 16:25315612-25315634 ATTGTAATATAGTTGGGTCTAGG + Intergenic
1136059581 16:27717424-27717446 ATTCTAAAATAGCTGTTCCATGG + Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1142562428 17:818573-818595 ATTCTAATATGATTGGGACACGG - Intronic
1143987933 17:10931194-10931216 ATTCTAATAAAGATGGACTAGGG - Intergenic
1144358249 17:14466625-14466647 ATTTTAATATAGGAGGTCCCAGG + Intergenic
1144424318 17:15127277-15127299 AGTCTGATACAGGTGGTCCAAGG - Intergenic
1146639615 17:34530483-34530505 ATACTAATACTGCTGGGCCATGG + Intergenic
1146713934 17:35067764-35067786 ATTCTGATACAGATGGGCCTTGG + Intronic
1147047823 17:37767798-37767820 GTTTTAATAAAGGTGGGCAAGGG - Intergenic
1151456481 17:74229259-74229281 ATTCTGACACAGGTGGGCCTGGG - Intronic
1156663857 18:39381892-39381914 ATTCTGATATATGTGGCACAAGG - Intergenic
1158849647 18:61482613-61482635 ATACTAATATATGTGGGCAATGG - Intronic
1158986830 18:62826454-62826476 ATACTAATATACGTGGTCCTTGG + Intronic
928108975 2:28491116-28491138 ATTCTGATTTAGTTGGTCCAGGG - Intronic
928493702 2:31810239-31810261 ATTCTAATTCAGGAGGTCCAGGG - Intergenic
930805792 2:55488648-55488670 TTTCAAATATAGGTGGGGCAGGG - Intergenic
935898808 2:107768100-107768122 ATTCTAAAAAAGGTGGGGCGGGG - Intergenic
936263141 2:110979464-110979486 TTTCTCATACAGCTGGGCCACGG - Intronic
936490264 2:112964177-112964199 ATTCTAATATAGGTCCAACAAGG - Intergenic
939481701 2:142756049-142756071 ATTTTAATATATGTGGTCCCGGG + Intergenic
940281022 2:151989749-151989771 AGTCTAATATATGTGGACCATGG - Intronic
941169367 2:162118472-162118494 ATCCTATTATGGGTGGCCCAAGG - Intergenic
942512805 2:176720352-176720374 ATTCTGATATAGGCAGTCCATGG + Intergenic
942662298 2:178278997-178279019 TTTCTCACATATGTGGGCCATGG - Intronic
945223890 2:207512089-207512111 AGTCTAAAATAGGGTGGCCATGG + Intergenic
945640277 2:212417644-212417666 ATTCTAATATAGCTTAGCCTTGG - Intronic
946094552 2:217261935-217261957 CTTCTAATATAGATGGTCCATGG - Intergenic
946160916 2:217835424-217835446 ATTCAGATGTAGGTGGTCCATGG - Intronic
946237112 2:218330785-218330807 ATTCTAATATAGGTGGGCCAAGG + Intronic
946879147 2:224160121-224160143 AGTCTGAAATAGGTGGCCCAAGG - Intergenic
1168940329 20:1706091-1706113 ATTATAATTTAGGTCGGGCAGGG - Intergenic
1170144784 20:13161335-13161357 TTTCTTCTATAGGTGGACCATGG - Intronic
1173677162 20:44845917-44845939 ATTCTAGTTTAGGAGGTCCAGGG - Intergenic
1178671019 21:34591809-34591831 ATTCTAATTTGGGTGGGGCAGGG - Intronic
1182874403 22:33678356-33678378 ATTCTAATATAGGTTGCTAATGG + Intronic
1183026577 22:35070001-35070023 ATTCTGATGTTGGTGGCCCAAGG + Intronic
950983726 3:17337235-17337257 ATTCTAAAATTGCTGGTCCAGGG + Intronic
955633745 3:61002956-61002978 ATTACAACAGAGGTGGGCCAGGG - Intronic
958960547 3:100505547-100505569 ATTCTGGCATAGGTGGTCCAAGG + Intronic
959664104 3:108902372-108902394 ATTCTAATATAAATGGGGGAGGG + Intergenic
960289426 3:115865592-115865614 ATTATTATATAGGTGGTCCATGG - Intronic
960315030 3:116166030-116166052 ATGCTAATTGTGGTGGGCCAGGG + Intronic
961618257 3:128201039-128201061 ATACTAATAAAGGTGGTGCATGG - Intronic
963460869 3:145613610-145613632 TTTCTTACATAGGTGTGCCATGG + Intergenic
963557302 3:146808656-146808678 ATTCAAGCATAGGTGGACCAAGG + Intergenic
966835605 3:184047253-184047275 ATTCTAATATGGGTGGGCCATGG - Intergenic
967017213 3:185493199-185493221 ACTCTGATAAAGGTGGTCCAAGG + Intronic
967318789 3:188175376-188175398 ATTCTACTCTAGGTGGGGCGTGG - Intronic
969092787 4:4707943-4707965 ATTCTAATATAGTCGGGTTAGGG + Intergenic
972368176 4:38395265-38395287 ATTCTAATATAGGCCGGGCTTGG + Intergenic
974667120 4:64977541-64977563 ATTTTTATATCGGTGGCCCATGG - Intergenic
976657434 4:87504039-87504061 ATTCAAATCCAGGTGGTCCAGGG + Intronic
978203263 4:106048149-106048171 ATTCTAAAGCAGGTGGCCCATGG + Intronic
978349829 4:107809908-107809930 ATTCTAATATAATTGGTTCATGG + Intergenic
978366942 4:107992155-107992177 ACTCTTAAATAGGTGGACCAGGG + Intronic
979202350 4:117993562-117993584 ATACTAATATAGGTTGGGCACGG - Intergenic
980583312 4:134783018-134783040 TTTGTAACATAGGTGTGCCATGG + Intergenic
981450407 4:144890528-144890550 ATGCTAATATTGTTGGTCCAGGG + Intergenic
982331007 4:154182146-154182168 ATTTTAAAATATGTGGGCCATGG + Intergenic
982456414 4:155614535-155614557 ATTCTAATATGAGTTGTCCATGG + Intergenic
983284396 4:165721184-165721206 GTTATAAAGTAGGTGGGCCATGG - Intergenic
986284991 5:6352733-6352755 ATTCTACTGTAGGTGGGCATTGG - Intergenic
989707634 5:44356579-44356601 TTTCTAATATCGGTGTCCCAGGG + Intronic
991448356 5:66724806-66724828 ATTATAATATATGTGGGCTGTGG + Intronic
992028081 5:72691182-72691204 ATTCTAATTTAGTAGGTCCAAGG + Intergenic
993347219 5:86799159-86799181 ATTTTCATATGGGTGGGCCAGGG + Intergenic
997922104 5:137991474-137991496 ATTCTGATACAAGTGGTCCATGG - Intronic
999009254 5:148016964-148016986 ACTCCAATACTGGTGGGCCATGG + Intergenic
1000214968 5:159146586-159146608 ATTCTAATTTTGTTGGGCTAGGG - Intergenic
1000360507 5:160442443-160442465 ATTAACATATAGGTGGGCCCGGG + Intergenic
1005157730 6:22826458-22826480 ATTCTCATATAGGTAGGCCGTGG - Intergenic
1007797987 6:44366449-44366471 ATTATGATATAGGTGGTCTAAGG - Intronic
1010120658 6:72372070-72372092 AATCTAAAATACCTGGGCCAAGG + Intronic
1011233940 6:85194179-85194201 ATTCTAATTGTGGTGGGTCATGG + Intergenic
1011441712 6:87394194-87394216 ATTCTAGTTCAGGTGGTCCAGGG - Intronic
1013567371 6:111380691-111380713 ACTCTAATGCAGGTGGTCCAAGG - Intronic
1014592093 6:123286306-123286328 ATTGTAGTATAGGTCGGGCATGG + Intronic
1015272321 6:131349689-131349711 AATCTGATGTAGGTGGTCCATGG + Intergenic
1015901740 6:138074945-138074967 ATACAAATAAAGGGGGGCCAAGG + Intergenic
1016379142 6:143455574-143455596 ATTCTAATGTAAGTGGAACAGGG + Intronic
1021571568 7:22070843-22070865 ATTCTGATGTAGATGGCCCATGG + Intergenic
1021712681 7:23431702-23431724 ATTCTAACATAGGTGGTTCTCGG - Intronic
1021855574 7:24851759-24851781 ATTCAAATAGAGGTAGGACATGG + Intronic
1022675223 7:32493406-32493428 TTTAGAATATAGGTGGGGCATGG - Intronic
1022798142 7:33749197-33749219 ACTCTGATGTAGGTGGCCCATGG - Intergenic
1030732908 7:113010668-113010690 ATGCTAATATAGATTGGTCAGGG - Intergenic
1031263980 7:119560055-119560077 ATTTTAATATAGCTGGAACATGG + Intergenic
1031959527 7:127976225-127976247 TTTCTAATAAGGGTGGGGCAGGG - Intronic
1032677399 7:134144044-134144066 ATTCTGATTTAAGTGGTCCAAGG + Intronic
1033789100 7:144769592-144769614 ATTCTACCACAGGTGGTCCATGG + Intronic
1038147388 8:24911783-24911805 ATTTTAATACAGATGGGCCAAGG + Intergenic
1039989205 8:42473684-42473706 ATTCTATTATTGGAGAGCCAAGG + Intronic
1041763834 8:61395717-61395739 ATGCTAATGTGGTTGGGCCAGGG + Intronic
1043217688 8:77615541-77615563 ATTCTAATATAGGTTTGTCCTGG - Intergenic
1043434197 8:80222524-80222546 ATTATAATAGATGTGAGCCATGG + Intronic
1046892019 8:119432558-119432580 ATATTAATCTAGGTGGTCCATGG - Intergenic
1051831806 9:21287442-21287464 AATCTGATATAGGTAGCCCAAGG + Intergenic
1052372962 9:27686768-27686790 ATTCTAATGTAATTGGACCAAGG - Intergenic
1052600373 9:30620020-30620042 AGAATAATATAGGTGGGGCACGG - Intergenic
1053430001 9:38035855-38035877 ATTCTGATTTAAGTGGCCCAAGG + Intronic
1057630803 9:96717582-96717604 ATGCTTATGTAGGTGGGGCACGG - Intergenic
1057929641 9:99182536-99182558 ATTCTAGTGTAGGTGGCCCATGG - Intergenic
1057958619 9:99433520-99433542 ATTTTATCATAGGGGGGCCATGG - Intergenic
1058675050 9:107393103-107393125 ATTCTAATATAATTGGTCTAGGG + Intergenic
1060997291 9:127882404-127882426 TTTTTAGTAGAGGTGGGCCAGGG - Intergenic
1061644643 9:131990810-131990832 ATTTGCATAGAGGTGGGCCATGG - Intronic
1187096987 X:16159514-16159536 ATTCTGATGTAGATGGTCCAAGG - Intergenic
1187424886 X:19168170-19168192 ATCCTGATATAGGTGGCCCAAGG + Intergenic
1187833239 X:23404454-23404476 AGTCAAATGTCGGTGGGCCAGGG + Intergenic
1188105149 X:26140064-26140086 ATTCTAATAGTGGAGGGCCATGG + Intronic
1189116540 X:38349020-38349042 ACTCAAAGATAGGAGGGCCAGGG + Intronic
1189373459 X:40448000-40448022 ATTCTGCTATAGGCAGGCCAAGG - Intergenic
1190454743 X:50616732-50616754 ATTCTAACACAGGTGGTTCAGGG + Intronic
1190576259 X:51842477-51842499 CTGCTAAGTTAGGTGGGCCAAGG + Intronic
1193083063 X:77424531-77424553 ATTCTAAGACATGTAGGCCAAGG + Intergenic
1197306196 X:124844881-124844903 ATTCTGATGTAGGTGGTCCATGG - Intronic