ID: 946240834

View in Genome Browser
Species Human (GRCh38)
Location 2:218354539-218354561
Sequence TAGACCTGCGGGCCTCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 2, 2: 8, 3: 13, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946240834_946240842 11 Left 946240834 2:218354539-218354561 CCAGGCGGAGGCCCGCAGGTCTA 0: 1
1: 2
2: 8
3: 13
4: 53
Right 946240842 2:218354573-218354595 GTGTGGGCAGAGGATTACCCAGG 0: 1
1: 5
2: 20
3: 48
4: 186
946240834_946240838 -6 Left 946240834 2:218354539-218354561 CCAGGCGGAGGCCCGCAGGTCTA 0: 1
1: 2
2: 8
3: 13
4: 53
Right 946240838 2:218354556-218354578 GGTCTAAGACCAAGGAAGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 172
946240834_946240843 19 Left 946240834 2:218354539-218354561 CCAGGCGGAGGCCCGCAGGTCTA 0: 1
1: 2
2: 8
3: 13
4: 53
Right 946240843 2:218354581-218354603 AGAGGATTACCCAGGTGCCGAGG 0: 3
1: 12
2: 42
3: 55
4: 236
946240834_946240839 -5 Left 946240834 2:218354539-218354561 CCAGGCGGAGGCCCGCAGGTCTA 0: 1
1: 2
2: 8
3: 13
4: 53
Right 946240839 2:218354557-218354579 GTCTAAGACCAAGGAAGTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 119
946240834_946240840 1 Left 946240834 2:218354539-218354561 CCAGGCGGAGGCCCGCAGGTCTA 0: 1
1: 2
2: 8
3: 13
4: 53
Right 946240840 2:218354563-218354585 GACCAAGGAAGTGTGGGCAGAGG 0: 1
1: 1
2: 3
3: 46
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946240834 Original CRISPR TAGACCTGCGGGCCTCCGCC TGG (reversed) Intergenic
902238607 1:15073794-15073816 TGGACCTGCTGGCCTCGGTCTGG + Intronic
904701736 1:32362030-32362052 GAGACCTGCCCGGCTCCGCCTGG - Exonic
907540876 1:55214896-55214918 TCGCCCCGCGGGCCCCCGCCGGG + Exonic
908403038 1:63788813-63788835 TAGACCTCTGGGCCTCAACCTGG + Intronic
911577689 1:99597649-99597671 TGGACATGCGGGCATCTGCCAGG - Intergenic
915409532 1:155689261-155689283 TAGACCGGCGCGCCTCCGGGGGG + Intronic
915734944 1:158078661-158078683 TTCACCTGGGGGCCTCCTCCAGG + Intronic
922663220 1:227447906-227447928 GAGACCTGCAGGCCTTCTCCCGG + Intergenic
924715996 1:246574639-246574661 TAGAACTCCTGGCCTCCTCCAGG + Intronic
1075280312 10:121133189-121133211 TAGACCTGCGGGTCTCAGCCTGG + Intergenic
1078255168 11:9652604-9652626 TAGACCTGCTGGCCTTCACTTGG + Intergenic
1084562407 11:69912221-69912243 TAGACCAGCGGACCCCAGCCGGG + Intergenic
1089858749 11:121570332-121570354 TAGACCTTAGGCCCTCAGCCTGG - Intronic
1092844119 12:12568299-12568321 TAGGCCAGTGGGCCTCAGCCTGG + Intergenic
1096533849 12:52258471-52258493 TCGGCCTGCGGGCCCCGGCCCGG - Intronic
1096538756 12:52291398-52291420 TCGGCCTGCGGGCCGCGGCCCGG - Exonic
1096540019 12:52301962-52301984 TCGGCCTGCGGGCCCCGGCCCGG + Exonic
1101824597 12:108210286-108210308 TACACCTGCGGGCCGACTCCTGG - Exonic
1125522547 15:40356241-40356263 GGGCCCTGCGGGCCTCCCCCTGG + Exonic
1127118058 15:55746650-55746672 TAGACCTTCGGGCCTCAGCCTGG - Intergenic
1142170044 16:88617036-88617058 TAGAGTTGAGGGCCTCCCCCGGG + Intronic
1143921269 17:10332642-10332664 TAGAGCTGCGGGCCTCAGCTGGG + Intronic
1144806616 17:17972183-17972205 GAGGACCGCGGGCCTCCGCCGGG - Intronic
1147260039 17:39204528-39204550 TAGACCTGCGGGCCTCAGCCTGG - Exonic
1148341559 17:46876420-46876442 TAGAGCTGTGGGCCCCTGCCAGG + Exonic
1157274633 18:46302067-46302089 TAGACTTGGGGGCTTCCTCCTGG + Intergenic
1159126048 18:64225995-64226017 TAGATGTGGGGGCCTCAGCCAGG + Intergenic
1161029869 19:2052531-2052553 TAGACCTGCTTGCCTGGGCCTGG + Intergenic
1168630591 19:57953253-57953275 CAGACCTGTGGGCCTCAGCCTGG + Intergenic
931670843 2:64645271-64645293 TTGCCCTGCGGGCCCCCGCGCGG - Intronic
936095113 2:109525493-109525515 TAGGCCTGTGGGGCTCCGGCTGG - Intergenic
937120696 2:119438336-119438358 TAGACCTGCTGGACTCTGCAGGG + Exonic
938303480 2:130231881-130231903 GGGACCTGCAGGCCTCCCCCTGG - Intergenic
938311715 2:130294287-130294309 TAGACCTGGGGGCCTCAGCCTGG - Intergenic
938453199 2:131442375-131442397 GGGACCTGCAGGCCTCCCCCTGG + Intergenic
943066366 2:183090861-183090883 GAGGCCTGCTGGCCTCAGCCGGG - Intronic
946240834 2:218354539-218354561 TAGACCTGCGGGCCTCCGCCTGG - Intergenic
1169093182 20:2873657-2873679 TAGCCCTCAGGGCCGCCGCCCGG - Intronic
1175812774 20:61867664-61867686 TAGAGCTGCTGGCCACCTCCAGG - Intronic
1175820490 20:61906514-61906536 AAAACCTGCTGGCCTCCCCCGGG - Intronic
1176378902 21:6101973-6101995 CAGACCTGCTGGCCTCGGCCTGG + Intergenic
1179744572 21:43436264-43436286 CAGACCTGCTGGCCTCGGCCTGG - Intergenic
1182528226 22:30934978-30935000 TAGATGTGCTGGCCTCCTCCCGG + Exonic
1184105521 22:42365525-42365547 GTGACCTGCGGGGCTCCCCCAGG - Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950891571 3:16409098-16409120 CAGACCTGCAGGCCTGCGCCGGG - Intronic
955235373 3:57134606-57134628 TAGACCTGCGGGCCTTAGCCTGG - Intronic
963150797 3:142043721-142043743 TAGACCTGGGGGCCTCAGCCTGG + Intronic
968675040 4:1872242-1872264 TCGGCGTCCGGGCCTCCGCCTGG + Intronic
968704632 4:2072217-2072239 GAGGCCTGGGGCCCTCCGCCAGG - Exonic
968899071 4:3422372-3422394 AAGTCCTGCAGGCCTCCGACTGG - Exonic
969375707 4:6761953-6761975 CTGAGCTGGGGGCCTCCGCCTGG + Intergenic
984328694 4:178287165-178287187 TAGACCAGCTGGCCTCAGCCTGG - Intergenic
988425041 5:31054037-31054059 TGGACCTGCGGGCCTCAGCCTGG - Intergenic
1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG + Intergenic
1001054950 5:168441699-168441721 CAGACCGGCAGACCTCCGCCAGG - Exonic
1001386680 5:171345139-171345161 TAGGCCTGCAGGCCTCAGCCTGG + Intergenic
1001906625 5:175478692-175478714 CAAGCCTGCGCGCCTCCGCCGGG - Intronic
1002268834 5:178056074-178056096 TAGACCTGCGGGCCTCAGCCTGG - Intergenic
1029414759 7:100435936-100435958 TGGAGCTGCGGGCCGCAGCCGGG - Exonic
1031886850 7:127252828-127252850 TGGAGCTGCGGGCCCCCGGCGGG - Exonic
1035260947 7:157661444-157661466 TCTCCCTGCGGGCTTCCGCCTGG + Intronic
1036730242 8:11256486-11256508 TAGAGCTGCGGGCTTCAGCCTGG - Intergenic
1039608533 8:38901532-38901554 TAGGCCGCCAGGCCTCCGCCGGG - Intronic
1039899433 8:41740836-41740858 CAGACCTGTGGGCTTCAGCCTGG + Intronic
1041327021 8:56678644-56678666 TAGTTCTGCTGGCCTCCTCCTGG - Intergenic
1043463983 8:80487034-80487056 AAGACCTGGAGGCCTCCGCCGGG + Exonic
1045094380 8:98782509-98782531 TAGACCAGCAGGCCTCTGCCTGG - Intronic
1046108285 8:109691846-109691868 AAGCCCTCCTGGCCTCCGCCGGG - Intergenic
1061447983 9:130652263-130652285 TAGACCCGCGGGCCTCAGCCTGG - Intergenic
1062198827 9:135289844-135289866 GAGACCTTCTGGCCTCAGCCTGG + Intergenic
1062569553 9:137178841-137178863 CTGCCCTGGGGGCCTCCGCCTGG + Intronic
1186250383 X:7659774-7659796 TAGACAGGCGTGCCTCAGCCAGG - Intergenic
1187363812 X:18650607-18650629 TAGACCGGTGGGGCTCAGCCTGG + Intronic
1189796351 X:44649599-44649621 TGGACCTGCGGGCCACAGCCTGG - Intergenic
1195625204 X:106999887-106999909 AAGGCCTGCGGGCCGCCGCCGGG + Exonic
1199773865 X:150993971-150993993 TAGGCCTGCGGGCCTCAGCCTGG - Intergenic