ID: 946243131

View in Genome Browser
Species Human (GRCh38)
Location 2:218368846-218368868
Sequence CTGTGTCAGTGGGAACCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 175}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946243131_946243151 27 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243151 2:218368896-218368918 GGTCCGAGAGTAAAAATAATGGG 0: 1
1: 0
2: 1
3: 1
4: 96
946243131_946243146 6 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243146 2:218368875-218368897 CCCCAGACTCCGGAGGTGGGGGG 0: 1
1: 0
2: 0
3: 35
4: 281
946243131_946243141 3 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243141 2:218368872-218368894 GACCCCCAGACTCCGGAGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 116
946243131_946243142 4 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243142 2:218368873-218368895 ACCCCCAGACTCCGGAGGTGGGG 0: 1
1: 0
2: 2
3: 11
4: 148
946243131_946243138 -4 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243138 2:218368865-218368887 ACAGAGGGACCCCCAGACTCCGG 0: 1
1: 0
2: 0
3: 28
4: 256
946243131_946243139 -1 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243139 2:218368868-218368890 GAGGGACCCCCAGACTCCGGAGG 0: 1
1: 1
2: 3
3: 11
4: 144
946243131_946243150 26 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243150 2:218368895-218368917 GGGTCCGAGAGTAAAAATAATGG 0: 1
1: 0
2: 0
3: 5
4: 90
946243131_946243144 5 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243144 2:218368874-218368896 CCCCCAGACTCCGGAGGTGGGGG 0: 1
1: 0
2: 2
3: 20
4: 314
946243131_946243140 2 Left 946243131 2:218368846-218368868 CCTCCCGGTTCCCACTGACACAG 0: 1
1: 0
2: 2
3: 7
4: 175
Right 946243140 2:218368871-218368893 GGACCCCCAGACTCCGGAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946243131 Original CRISPR CTGTGTCAGTGGGAACCGGG AGG (reversed) Intergenic
902515296 1:16986669-16986691 GTGTGTCTGTGGGTGCCGGGGGG - Intronic
903016820 1:20366792-20366814 GCGTCGCAGTGGGAACCGGGAGG + Intergenic
903377747 1:22877032-22877054 GTGAGTCAGCGGGAACCAGGCGG + Intronic
908657771 1:66405947-66405969 CTGTTTCAGTGTGAACCTGAGGG + Intergenic
908679733 1:66647351-66647373 TTGTGGCAGTGGGATCTGGGTGG - Intronic
910272987 1:85417298-85417320 CTGGGTGAGTGGGAACAGCGGGG + Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
919729198 1:200902077-200902099 CTGCCTCAGAGGGAACCGGGAGG + Intronic
920947903 1:210546785-210546807 CTGTGAAAGTGGGAATGGGGAGG + Intronic
922566493 1:226604912-226604934 CTGTGACACTGGGATCAGGGTGG + Exonic
924801759 1:247332957-247332979 CTGAGTAAGTGGGAACAAGGTGG + Intergenic
1063429477 10:5976921-5976943 TTATGTCAGTGGGAGCTGGGAGG - Intronic
1063583964 10:7334279-7334301 CTGTGTCACTGGGAAGGTGGAGG - Intronic
1064751198 10:18530925-18530947 ATGTGGCAGTGGGAACAGAGAGG + Intronic
1065021997 10:21508974-21508996 GTGCGGCAGGGGGAACCGGGCGG - Intergenic
1067563833 10:47322600-47322622 CTGTGTTAGCGGGCACGGGGAGG - Exonic
1074088034 10:110223480-110223502 CTGTGTCAGGAGAACCCGGGAGG + Intronic
1074870600 10:117572896-117572918 CTGTGTGCGTGGGAACTGAGAGG + Intergenic
1075004209 10:118818769-118818791 CGGTGTCATTGGGAGCCTGGAGG + Intergenic
1075738720 10:124680260-124680282 CTGTGTCAGTGGGATCCGCTTGG - Intronic
1076604956 10:131683452-131683474 CAGTTTCCGTGGGAACAGGGTGG - Intergenic
1077013182 11:388558-388580 TTTTTCCAGTGGGAACCGGGAGG + Intergenic
1077477621 11:2797838-2797860 CTGTGCCTGGGGGAACCGGCTGG - Intronic
1079849259 11:25510552-25510574 CTGTGTCTGTGGGAAGGTGGGGG - Intergenic
1080769593 11:35328204-35328226 CTGAGTCAGTGGGAATAGGATGG - Intronic
1083192303 11:61061052-61061074 CTGCCTCAGTGGGAACAAGGTGG - Intergenic
1083267812 11:61555094-61555116 CTGTGGCTGTGGGCACTGGGTGG - Intronic
1083293311 11:61701666-61701688 CTGTGTCACAGGGAAGGGGGTGG + Intronic
1084752776 11:71214984-71215006 CTGTGTATGTGGGATCCAGGAGG - Intronic
1097130348 12:56806713-56806735 CTTTTGCAGTGGGAACTGGGAGG - Intergenic
1097180197 12:57167450-57167472 CTGAGTCAGGGGGAAGCAGGTGG - Exonic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1104744437 12:131202236-131202258 GTGTGTAAGTGGGAACCAGCCGG - Intergenic
1104789942 12:131474987-131475009 GTGTGTAAGTGGGAACCAGCCGG + Intergenic
1108580917 13:51827560-51827582 CTCTGACAGTGGGAACTGGGGGG - Intergenic
1113922214 13:113919525-113919547 CTGAGGCAGGGGGATCCGGGCGG - Intergenic
1114482436 14:23044146-23044168 CTGTGCCAGTGGGAACTGTCTGG + Exonic
1115117207 14:29895449-29895471 CGGTGAGAGTGGGAACAGGGAGG - Intronic
1116085142 14:40227655-40227677 GTGGGGCAGTGGGAACGGGGAGG - Intergenic
1118278895 14:64410862-64410884 GTTTGGCAGTGGGAACCAGGTGG + Intronic
1119000667 14:70878823-70878845 CTGGGTCAGGCGGAAACGGGTGG - Intergenic
1120176107 14:81294986-81295008 CTGTTTAAGTGGGTGCCGGGTGG + Intronic
1122239169 14:100350693-100350715 CTGTGTCTGTGGGGCCCAGGAGG + Intronic
1122824820 14:104364476-104364498 CAGGGTCAGTGGGAGCCGGCAGG + Intergenic
1125404958 15:39342367-39342389 CTGTGTCTGTGTGAGTCGGGTGG - Intergenic
1127969489 15:63947185-63947207 CAGTGTGTGTGGGAACTGGGTGG - Intronic
1131094053 15:89645112-89645134 CTGTGGCAGGGGGGACCTGGCGG + Exonic
1134862610 16:17574108-17574130 CAGTGTCAGTGAGAAGAGGGAGG + Intergenic
1136097343 16:27966642-27966664 CTGTGTCCGTGGCATCAGGGAGG - Intronic
1137506439 16:49057912-49057934 CAGTTTCAGTGGGCACTGGGTGG - Intergenic
1138281127 16:55773038-55773060 CTGTGACTGTGGGACCCGGTCGG + Intergenic
1138438650 16:57021050-57021072 CTGCGTCATGGGGAGCCGGGAGG + Intronic
1139279295 16:65756021-65756043 CTGTGACAGTGTGAAACGGTGGG - Intergenic
1141116772 16:81315560-81315582 CCGCGGCGGTGGGAACCGGGAGG - Intronic
1141573763 16:84951100-84951122 CTGTGTCAGAGGCCAGCGGGGGG + Intergenic
1142186294 16:88696284-88696306 CTGTGGGTGTGGGAACAGGGTGG + Intergenic
1142518826 17:491247-491269 CTGTCCCAGCGGGACCCGGGAGG + Intergenic
1143202962 17:5124478-5124500 ATGTGTCAGTGGAAACCAGAGGG - Intronic
1145067350 17:19770747-19770769 TTGTTTCAGTGGGAAGTGGGAGG - Intergenic
1146845832 17:36181717-36181739 ATGTGTCAGTGGAAACCAGAGGG + Intronic
1147986280 17:44309217-44309239 CTGTGTGAGGGGGAAGGGGGTGG + Intronic
1149849035 17:60024658-60024680 ATGTGTCAGTGGAAACCAGAGGG + Intergenic
1149861133 17:60121866-60121888 ATGTGTCAGTGGAAACCAGAGGG - Intergenic
1151202307 17:72477644-72477666 CTCTGTCAGTGGGAGCCCTGGGG - Intergenic
1151660881 17:75517241-75517263 GTGTGTAAGTGGGGCCCGGGAGG + Exonic
1152224902 17:79088212-79088234 CTGTCTCATTTGGAACCAGGGGG + Intronic
1152783606 17:82237049-82237071 CTGAGCCTGTGGGAACCTGGGGG + Intronic
1155216180 18:23645158-23645180 CTGAGTCAGTGTGAACTGAGAGG + Intronic
1160224407 18:77001162-77001184 CCCTATGAGTGGGAACCGGGTGG - Intronic
1160243040 18:77136578-77136600 CAGGGTGAGTGGGAACCAGGAGG + Intergenic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1165354154 19:35293544-35293566 CTCTGTCCGTGGGAAGAGGGCGG + Intronic
1168710713 19:58498521-58498543 CTGTGTGTGAGGGAACCTGGAGG - Exonic
924969974 2:116817-116839 CTGTGTCTTTGGGGACCTGGGGG + Intergenic
924989615 2:301363-301385 CTGTGTTTGTGGGAATCAGGAGG - Intergenic
925197691 2:1939998-1940020 CTGTGGCAATGGAAACCTGGTGG + Intronic
925385733 2:3460380-3460402 CGGGGTCAGTGGGAGCCGCGAGG + Intronic
927129743 2:20048606-20048628 CTGTGTCATTTGGAACTTGGGGG - Intronic
927255595 2:21037984-21038006 CTGTCTCTGGGGGAACCAGGAGG + Exonic
929759142 2:44791659-44791681 CTGAGTCAAGGGGAACAGGGAGG + Intergenic
929908208 2:46064886-46064908 CTGGGGCAGTGGGAAAGGGGAGG + Intronic
930016607 2:46975006-46975028 CTCTGTCAGGCGGAAGCGGGAGG - Exonic
931292657 2:60889244-60889266 CTGTGTCAGTGGAAAAAGAGCGG - Intronic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
931985508 2:67738116-67738138 GTGGGTCAGTGGGAATGGGGTGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938073414 2:128319788-128319810 CAGTGTGAGTGGGCACCTGGCGG - Intergenic
938232946 2:129677640-129677662 CTGTGTCCCTGGGACCCTGGAGG - Intergenic
938646551 2:133336878-133336900 CTGTGGCAGTGAGACCCGGTAGG - Intronic
939249359 2:139665274-139665296 AAGTGTCAGTGAGAACCAGGAGG + Intergenic
939991106 2:148876829-148876851 ACGTGTCAGCGGGGACCGGGAGG - Intronic
944416034 2:199480733-199480755 CAGTAGCAGTGGGAACAGGGAGG + Intergenic
946243131 2:218368846-218368868 CTGTGTCAGTGGGAACCGGGAGG - Intergenic
948567639 2:238896868-238896890 CTCTGTCTGTGGGCTCCGGGTGG - Intronic
948590134 2:239044095-239044117 CTGTGCCAGTGGGAAGGCGGAGG - Intergenic
948591459 2:239053397-239053419 GTGTGTCAGTGGGCACAGTGGGG + Intronic
948809436 2:240467187-240467209 CTGTGTCACCGTGAACAGGGAGG - Exonic
948857612 2:240737296-240737318 CGGTGCCAGGGGGAACAGGGAGG + Intronic
1171953432 20:31441265-31441287 CTGTGGCAGTGGGAAACCAGGGG + Intronic
1172842417 20:37909888-37909910 CTGGAGCAGTGGGAACCAGGGGG - Intronic
1174201234 20:48808046-48808068 CTTTGTCAGTAGGAAAGGGGAGG + Intronic
1175676199 20:60948839-60948861 CTGTGTTGGTGGGGACAGGGCGG - Intergenic
1176027650 20:62993996-62994018 CTTTGTCCGTGGGCACCGAGTGG + Intergenic
1177658115 21:24046148-24046170 ATGAGTCAGTGGGAACTGGCTGG - Intergenic
1181172465 22:21017392-21017414 CTGTGTCTGTGGTCAACGGGTGG - Intronic
1182056370 22:27358478-27358500 CTGGGTCAGTGGGAATTGAGTGG - Intergenic
1183677807 22:39309548-39309570 CTGAGCAAGTGGGAACAGGGAGG - Intergenic
1185407319 22:50660489-50660511 CTTAGTCTGTGGGAACCTGGAGG - Intergenic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
954155131 3:48681228-48681250 GTGTGACGGTGGGAACAGGGTGG + Intronic
954422274 3:50424986-50425008 CTGTGGCAGTGGGTACCTGTGGG - Intronic
954677500 3:52323898-52323920 CTGTGTGAGTGGGTCCCGGTAGG + Intronic
958865703 3:99499126-99499148 CTAAGTCAGAGGGAACCGTGAGG + Intergenic
960626775 3:119688764-119688786 CTGTGTCAATGAGAACAGGTAGG - Intergenic
961801351 3:129452520-129452542 TTGTGCCAGTGGGCATCGGGGGG + Intronic
965551192 3:169966790-169966812 CCACGTCAGAGGGAACCGGGCGG + Exonic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
969401649 4:6959574-6959596 CTGAGTGAGTGGGAACAAGGGGG + Intronic
970594343 4:17586110-17586132 CTGTGTCAGTGGGAGGCTGTTGG + Intronic
974593650 4:63988474-63988496 CTGGGTTTGTGGGAACAGGGAGG - Intergenic
977303969 4:95299896-95299918 CTGTGTTTGTGGTAACAGGGAGG + Intronic
977616014 4:99088450-99088472 CTGGGACAGTCGGAACGGGGTGG - Intronic
978633401 4:110774599-110774621 CTGGCTCAGTGTCAACCGGGTGG - Intergenic
983380225 4:166981992-166982014 CTGAGTCTGTGGGAACAGGGGGG + Intronic
984041816 4:174744344-174744366 CTGTGTCAGTAGGACCAGGCAGG - Intronic
985891372 5:2717644-2717666 CAGTGCCAGTGGGAACAGAGGGG - Intergenic
988580027 5:32460746-32460768 ATGTGTCAGGGGGAACCTGGTGG - Intergenic
990736795 5:58873100-58873122 GTGTGTCTGTGGGAATGGGGAGG + Intergenic
993500275 5:88659832-88659854 GTGTGTCAGTGTGCACCGGGAGG + Intergenic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
996346489 5:122493551-122493573 CTGGGCCAGTGGGGCCCGGGTGG + Intergenic
998818212 5:146034551-146034573 CTGTCTCACTGGGACCCTGGTGG + Intronic
999739805 5:154541745-154541767 GTGTGTCGGTGGGCACCAGGAGG + Intergenic
1001327814 5:170742140-170742162 CTGTGTCATTGTGAACAGTGAGG - Intergenic
1002913896 6:1513339-1513361 CTGTGTCAGTGGGGAGGGGTTGG - Intergenic
1003089308 6:3088318-3088340 CTGTGTCAGTGGGGACCGTGTGG - Intronic
1006256313 6:32835427-32835449 CTGTGTCAGAGGGAACGGTCAGG - Intronic
1006767894 6:36524981-36525003 CTGTATCTGTGGGCACTGGGTGG + Intronic
1007418417 6:41705525-41705547 CTGTGTCGTTGGGAAGAGGGTGG - Intronic
1010175987 6:73028478-73028500 CTGGGTCAGAGTGAACGGGGTGG - Intronic
1011617066 6:89206859-89206881 CTGTGTGAGTTTGAAGCGGGAGG - Intronic
1016992861 6:149941953-149941975 CTATGACAGCGGGAAACGGGGGG + Intergenic
1018824336 6:167397865-167397887 AGGTGCCAGTGGGAACTGGGCGG - Intergenic
1021015575 7:15527032-15527054 CTGTGTCTCAGGGAACAGGGAGG - Intronic
1024000909 7:45188976-45188998 CTGTGCCAGTGGGCATCGAGAGG - Intergenic
1024048980 7:45606159-45606181 CAGAGTCAGTGGGAACCAAGGGG - Intronic
1026490001 7:70855009-70855031 CTGTGTCCCTGGGAATGGGGAGG + Intergenic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1035690303 8:1555475-1555497 CTGTGGCAGTCGGGGCCGGGGGG - Intronic
1036449074 8:8849508-8849530 CTGTGTCAGTAAGAAACGTGGGG + Intronic
1036635432 8:10547252-10547274 CTGTGTCAGAGGCCACCGGCTGG - Intronic
1036662073 8:10715179-10715201 CTGTGTCAGTGGGGCTTGGGAGG + Intergenic
1038427500 8:27473804-27473826 CTGTGTCAGAGTGGACGGGGGGG - Intronic
1039227827 8:35408612-35408634 GTGTGTATGTGGGAACCGGAAGG + Intronic
1039595268 8:38786093-38786115 CTGTCTCTGTGGGAACCTGCAGG + Intronic
1040754043 8:50748882-50748904 TTGTGTCTGTGGGAATAGGGAGG - Intronic
1041352354 8:56960403-56960425 CTGTGTCAGAGGGAGAGGGGTGG - Exonic
1044783963 8:95775164-95775186 CTGTGTCGGTGGTAACAAGGTGG - Intergenic
1045975109 8:108122963-108122985 CTGTGGCAGTGGGATCCGCTGGG + Intergenic
1047179346 8:122572419-122572441 CTCTGTCTGTGGGATCCAGGTGG - Intergenic
1048289960 8:133173665-133173687 CAGTGTTAGTGGGAGCCTGGAGG - Intergenic
1048591204 8:135822226-135822248 CTGTGGCTGTGGGAAAGGGGTGG + Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1049083038 8:140457620-140457642 CTGTGTAAGTGCAAAGCGGGGGG - Intronic
1049390099 8:142363365-142363387 CCTTTTCAGTGGGAACCAGGGGG + Intronic
1051332898 9:16041273-16041295 CTAGGTCAGTGGGAGCAGGGAGG + Intronic
1053489151 9:38486920-38486942 GTGTGTCTGGAGGAACCGGGGGG + Intergenic
1061378499 9:130240339-130240361 CAGGGTCAGTGGGGACAGGGTGG - Intergenic
1061488008 9:130930055-130930077 CTGTGTCTGTGCGTCCCGGGCGG - Intronic
1061855732 9:133441054-133441076 CAGTGTGTGTGGGAACCGGAAGG + Intronic
1062433096 9:136534818-136534840 CTCTGTGAGAGGGAACTGGGGGG - Intronic
1186411573 X:9348685-9348707 CTCTGCCAGTGGGACCTGGGTGG - Intergenic
1186477371 X:9868037-9868059 CTGACTCAGTGGTGACCGGGTGG - Intronic
1196028811 X:111073081-111073103 CTGTGGCTGTGGGAACATGGAGG - Intronic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1199593588 X:149489730-149489752 CTATGTGAGTGGGAAACGGGGGG + Intronic
1199701246 X:150377287-150377309 TTGTAACAGTGGGAACCGTGAGG - Intronic
1199721784 X:150547619-150547641 CTGCGTGGGTGGGACCCGGGAGG - Intergenic