ID: 946245019

View in Genome Browser
Species Human (GRCh38)
Location 2:218382532-218382554
Sequence CCACCCAGTGAGATTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946245019_946245027 28 Left 946245019 2:218382532-218382554 CCAGACTCAATCTCACTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 946245027 2:218382583-218382605 TTTCCTTTGTCTGAAGTCCGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
946245019_946245021 -1 Left 946245019 2:218382532-218382554 CCAGACTCAATCTCACTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 946245021 2:218382554-218382576 GAGTCCTTCACACCCCTAAGCGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946245019 Original CRISPR CCACCCAGTGAGATTGAGTC TGG (reversed) Intronic
900481580 1:2902086-2902108 CCACCCAGTGAGGCTGACTTTGG + Intergenic
902185950 1:14725648-14725670 TTGCCCAGTGAGGTTGAGTCGGG + Intronic
902563958 1:17297659-17297681 CCAGCCAGTGACATTGACTATGG - Intergenic
911076027 1:93876065-93876087 CCACCCAGGGAGGTTGAGGTAGG - Intronic
914331606 1:146676484-146676506 CCACCCTGTGAGATTCTGCCTGG + Intergenic
918052716 1:180988584-180988606 CCACCAAGAGAGATTTACTCTGG + Intronic
918344077 1:183591046-183591068 CCCCCCAGTGCGGGTGAGTCTGG - Intronic
920597164 1:207283696-207283718 CCATACAGTGAGAGTGAGTGAGG - Intergenic
1063537697 10:6901066-6901088 CCCCCCAGTGTGGCTGAGTCCGG + Intergenic
1064231824 10:13535955-13535977 CCTCCCAGTCAAATTGATTCTGG + Intergenic
1065150480 10:22817611-22817633 CCCCCCAGTGTGACTGTGTCTGG - Intergenic
1071553679 10:86586219-86586241 CCACACAGTGAGAAAGTGTCAGG - Intergenic
1072450535 10:95536186-95536208 CAACAAAGTGAGATTGATTCAGG + Intronic
1073193524 10:101669369-101669391 CCTCCCAGGGAGTTTGTGTCAGG - Intronic
1074361419 10:112826466-112826488 CCACCCGGAGAGATTTAATCTGG + Intergenic
1074798222 10:116971222-116971244 CCACCCAGTCAAAATGAGTTAGG + Intronic
1077153501 11:1081624-1081646 CCACGCAGTGAGGGTGAGGCTGG - Intergenic
1079448993 11:20582952-20582974 CAACCCAGTGATACTGAGTTTGG + Intergenic
1080695265 11:34598110-34598132 ACCCTCAGAGAGATTGAGTCTGG - Intergenic
1083194607 11:61077875-61077897 TCACCCAGTGATATTTATTCTGG - Intergenic
1085833980 11:79932745-79932767 CCACCCAGTGAGCTGGTGTCAGG + Intergenic
1088401930 11:109430781-109430803 CCACCCAGAGAGATTGAAGGAGG - Intergenic
1098292321 12:68968451-68968473 CCACCCAGTGATCTGGAGTGGGG - Intronic
1102227018 12:111235948-111235970 CCAACCTGTGAGATTCAGTCTGG + Intronic
1102746463 12:115253262-115253284 CAACCCAGTGAGATGGATGCTGG - Intergenic
1104486092 12:129152247-129152269 TTACCCAGTGTGATGGAGTCTGG - Intronic
1105009886 12:132748562-132748584 GCCCCCAGTGAGATTGTGGCCGG - Intronic
1106332098 13:28748715-28748737 CCAACCATTGACATTGAGTTGGG + Intergenic
1107875675 13:44788844-44788866 GCACCCAGTGTGATGCAGTCAGG + Intergenic
1112833969 13:103490977-103490999 CCACCTTGTGTGATTAAGTCTGG + Intergenic
1115833266 14:37365920-37365942 CAACCTACTGAGATTGAGCCAGG - Intronic
1117295980 14:54379290-54379312 CCACCCAGTGATATTGGCTGTGG - Intergenic
1117980068 14:61334130-61334152 CCACACACTGAGGTGGAGTCGGG - Intronic
1118483885 14:66195843-66195865 CCCCCCAGTGTGGCTGAGTCTGG + Intergenic
1119849916 14:77859919-77859941 CAACACAGTGAGTTTGAGACAGG - Intronic
1123684952 15:22790213-22790235 CCACCCAGTGCCACTGATTCAGG + Intronic
1123755512 15:23394800-23394822 ACACCCAGTTAGATTGAATGTGG + Intergenic
1131249298 15:90820116-90820138 GCACCCAGTGAGAGCCAGTCTGG + Intergenic
1131702780 15:94957380-94957402 CCAGCCACTGAGATTGTGTCTGG + Intergenic
1138331125 16:56216329-56216351 CCTCCCAGTGGAATTGAGGCTGG - Intronic
1140001949 16:71034416-71034438 CCACCCTGTGAGATTCTGCCTGG - Intronic
1142238253 16:88932947-88932969 CGACAGAGTGAGATTGTGTCTGG + Intronic
1144950142 17:18989511-18989533 TCACACAGTGAGTTTGAGGCAGG - Intronic
1151979552 17:77500358-77500380 CCACCAAGTGACATTGAGGCTGG - Exonic
1152465837 17:80465782-80465804 CCACCCAGCGAGAATGGCTCTGG + Intergenic
1154510576 18:15096774-15096796 CCATCCAGTCAGACTGAGGCTGG + Intergenic
1160533299 18:79577724-79577746 CCACCCAGTGAGAGGAAGGCTGG - Intergenic
1162666270 19:12215418-12215440 CAACCTACTGAGATTGAATCAGG - Intergenic
1165293132 19:34905156-34905178 CAACCGAGTGAGCTCGAGTCCGG + Intergenic
1166324092 19:42038500-42038522 CCACCCAGTGAGAGAGGGACTGG - Intronic
926990361 2:18673097-18673119 ACAAGCAGTGAGATTGACTCAGG - Intergenic
936698397 2:114979654-114979676 TCACCAAGTGAGATTTACTCAGG + Intronic
937274936 2:120678349-120678371 CCACCCAGAGGGACTGAGTGTGG - Intergenic
937986362 2:127639911-127639933 CCACCCAGGGAGATGGGGGCAGG - Intronic
938505792 2:131881221-131881243 CCATCCAGTCAGACTGAGGCTGG + Intergenic
939702144 2:145406101-145406123 CAACACAGAGAGTTTGAGTCAGG - Intergenic
939945897 2:148410539-148410561 CCACTCAGTGGGACTGAGGCAGG - Intronic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
1171175863 20:23050397-23050419 CCACCCGATGAGATGGGGTCTGG - Intergenic
1171279767 20:23886115-23886137 CAACCCTGTGAGATTCATTCTGG + Intergenic
1173337603 20:42125434-42125456 CTAACCACTGAGATTGAGCCTGG + Intronic
1176229367 20:64023960-64023982 CCACACAGTGTGATTGTGTGTGG + Intronic
1176787292 21:13272636-13272658 CCATCCAGTCAGACTGAGGCTGG - Intergenic
1177986452 21:27981130-27981152 CCATCCAGTCAGACTGAGGCTGG - Intergenic
1178386391 21:32154145-32154167 TTACCGAGTGAGATGGAGTCAGG + Intergenic
1178604248 21:34021413-34021435 CCCCACAGTGAGATTGTATCTGG - Intergenic
1179140001 21:38717015-38717037 TTTCCCAGTGAGATTGAATCTGG + Intergenic
1182164122 22:28155067-28155089 CCAGCCAGGGAGACTGAATCAGG - Intronic
949218425 3:1600333-1600355 CCTCCAAGGGAGACTGAGTCAGG + Intergenic
960364585 3:116755572-116755594 CTACCCAGTGAGATTGAAAGAGG + Intronic
960818298 3:121697404-121697426 CCACTCAGTGAGACTGAGAGGGG - Exonic
961382587 3:126505535-126505557 CCACCCAGTGAGGTCCAGTGGGG + Intronic
966432043 3:179842233-179842255 CCATGCAGTCAGATTGAGTCAGG + Intronic
976421873 4:84854232-84854254 CCTCAAAGTGAGATTGATTCTGG + Intronic
980559575 4:134455376-134455398 CCAACAAGTGAGATTAAGTCAGG - Intergenic
981939821 4:150270951-150270973 GCTCCCAGTGAGATTGACGCTGG + Intronic
983912718 4:173258018-173258040 TCTCCCAGTGAGATTGAGTTGGG + Intronic
987343373 5:16957739-16957761 CCACCCAGTGCCACTGTGTCTGG - Intergenic
995028095 5:107447857-107447879 CCCCCCTCTGAGATGGAGTCTGG + Intronic
996886462 5:128360947-128360969 CCACACAGTGAGATTTAAACAGG + Intronic
999369464 5:151045202-151045224 CCACCCACTCAGACTGAGGCAGG - Intronic
1001963269 5:175893470-175893492 TAGCCCAGTGAGATTGAGTCTGG + Intergenic
1002078528 5:176723966-176723988 CCACACAGAGAGATGGATTCTGG - Intergenic
1002986357 6:2192786-2192808 CCTCCAAGGGAGACTGAGTCAGG - Intronic
1003487604 6:6593126-6593148 CTACCCAGTGAAATTGATTTTGG - Intronic
1006284532 6:33082425-33082447 CCACCCAGGGAATCTGAGTCTGG - Intronic
1007159077 6:39774430-39774452 CCACCCACTGGCATGGAGTCAGG + Intergenic
1007427972 6:41759479-41759501 CCACCCAGAGAGACCTAGTCTGG - Intergenic
1007730523 6:43942716-43942738 CCAGCAAGTGAGATGGAGCCAGG + Intergenic
1010664289 6:78609484-78609506 CCACCCACTAAGATAGATTCTGG - Intergenic
1011571981 6:88747424-88747446 CCATCCAGTGATATAGAATCAGG + Intronic
1014515574 6:122374448-122374470 CCACCCCCTGAGACTAAGTCAGG + Intergenic
1015560613 6:134511241-134511263 CCACTCAATGTGATTGTGTCTGG - Intergenic
1023858568 7:44201694-44201716 CCACCCAGTGATTCTGACTCTGG + Intronic
1026200126 7:68207216-68207238 ACACCCACTGTGAGTGAGTCAGG - Intergenic
1027692380 7:81364312-81364334 CACCCCAGTGACATTGAGCCAGG - Intergenic
1028196138 7:87910342-87910364 CCAGCCAGTGAGATGAAGGCAGG + Intergenic
1034265819 7:149780178-149780200 CCACCCTGTGGGATTGACTGGGG + Intergenic
1034533198 7:151710279-151710301 CCACGCACTGAGATAGAGACAGG - Intronic
1037698474 8:21249403-21249425 CCAGGCAGTGAGAGTGAGCCTGG - Intergenic
1042629968 8:70805670-70805692 TCACCCAGTAAGGATGAGTCAGG - Intergenic
1044238257 8:89856663-89856685 CCCCCCAGTGACATAGACTCAGG + Intergenic
1044625580 8:94232898-94232920 CTACTCAGAGAGCTTGAGTCAGG - Intergenic
1045017680 8:98013036-98013058 ACACCCAGTGGTACTGAGTCAGG + Intronic
1045477382 8:102564781-102564803 CCACCCAGGTAGATGGGGTCAGG - Intergenic
1045561274 8:103266043-103266065 CCACCCAGGGAGCTTTAGTGGGG + Intergenic
1048485922 8:134847646-134847668 CCTCCAAGTGTGGTTGAGTCTGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049498203 8:142946610-142946632 CCTCCGAGTGAGACTGTGTCTGG - Intergenic
1055586880 9:77764137-77764159 CAAGAAAGTGAGATTGAGTCAGG + Intronic
1056421670 9:86434235-86434257 TCACCCAGAGAGAGGGAGTCAGG + Intergenic
1056713739 9:89011850-89011872 CTAACCAGTGAGGATGAGTCAGG - Intergenic
1057954264 9:99395428-99395450 CCACCCACAGAGATAGAGTGAGG - Intergenic
1062220204 9:135410968-135410990 GCACCCAGTGAGCTTGGCTCTGG - Intergenic
1190491223 X:50984081-50984103 CCACACAGAGAGAAGGAGTCAGG - Intergenic
1193932162 X:87566740-87566762 CCACCAAGTGGGATTTATTCTGG + Intronic
1193944190 X:87711774-87711796 CAACCCACTGAGATTGAATCAGG + Intergenic
1197767082 X:130066371-130066393 GCAGCCAGTGAGATAGAGCCAGG + Exonic
1199784761 X:151095189-151095211 CATCCCATTGTGATTGAGTCTGG - Intergenic
1200065440 X:153502316-153502338 CCTCCCAGGGAGAGTGAGTCAGG - Intronic