ID: 946245126

View in Genome Browser
Species Human (GRCh38)
Location 2:218383037-218383059
Sequence TCTCTGGGAGGTGCTTGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946245126_946245137 25 Left 946245126 2:218383037-218383059 CCACAGCAAGCACCTCCCAGAGA 0: 1
1: 0
2: 2
3: 38
4: 381
Right 946245137 2:218383085-218383107 ATCCCAGACACAAAACCGGTGGG 0: 1
1: 1
2: 1
3: 6
4: 99
946245126_946245133 21 Left 946245126 2:218383037-218383059 CCACAGCAAGCACCTCCCAGAGA 0: 1
1: 0
2: 2
3: 38
4: 381
Right 946245133 2:218383081-218383103 CCCCATCCCAGACACAAAACCGG 0: 1
1: 0
2: 0
3: 29
4: 223
946245126_946245136 24 Left 946245126 2:218383037-218383059 CCACAGCAAGCACCTCCCAGAGA 0: 1
1: 0
2: 2
3: 38
4: 381
Right 946245136 2:218383084-218383106 CATCCCAGACACAAAACCGGTGG 0: 1
1: 0
2: 0
3: 14
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946245126 Original CRISPR TCTCTGGGAGGTGCTTGCTG TGG (reversed) Exonic
900177174 1:1296011-1296033 TCACCGGGAGCTGCTGGCTGTGG + Exonic
900226686 1:1536365-1536387 TCCCTGGGAGGTGCTGTCGGAGG + Intronic
900818693 1:4869908-4869930 GCTGTGGGATCTGCTTGCTGGGG - Intergenic
901167546 1:7230831-7230853 TCTCTAGGAGCTGTTGGCTGAGG + Intronic
902157393 1:14499470-14499492 TTTCTGGGAGGAGCTGGCTGTGG + Intergenic
902398347 1:16144364-16144386 ACTCTGGGAGCTGCTGGCTGTGG - Intronic
902976259 1:20090697-20090719 GGTCTGGGAGGAGCTCGCTGGGG - Exonic
903191709 1:21660151-21660173 TCTTGGGGAGGTGCTTTGTGAGG - Intronic
904490870 1:30858283-30858305 TCTCTGGGTGTCTCTTGCTGAGG - Intergenic
905442047 1:38001745-38001767 TCACTGGGAGGTGCCTTGTGAGG - Intronic
905517867 1:38575316-38575338 CCTCTGAGAGGGGCTTGCTCGGG + Intergenic
905862419 1:41360593-41360615 TCTGTGGGAGGTTCTTACTGCGG - Intergenic
906231600 1:44169408-44169430 GCTCTGGGAAGTGCATGCTTTGG + Intergenic
906616301 1:47235149-47235171 TTCCTTGGAGGTGCTGGCTGGGG - Intergenic
906698596 1:47841527-47841549 TCTCTGGGAGGTGCAGGAAGAGG + Intronic
906808224 1:48800969-48800991 TTTTTGGGAGGGGCTTGCTGTGG + Intronic
907275229 1:53313300-53313322 TCCCTGGGAAGCGCCTGCTGTGG - Intronic
908787486 1:67749592-67749614 CCTCTGAGACGTGCTTCCTGGGG - Intronic
909282416 1:73771550-73771572 TCTCTGTGAGGTTGTGGCTGCGG - Intergenic
909673586 1:78214545-78214567 TCTTTGGGCGGGTCTTGCTGCGG - Intergenic
911045467 1:93624113-93624135 TGGCTGGGAGGTGCTGGGTGTGG - Intronic
911149512 1:94583692-94583714 AGTTTGGGAGGTGCTTGCAGAGG - Intergenic
911265884 1:95742821-95742843 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
912393790 1:109323829-109323851 TAACTGGGAGCTGCCTGCTGAGG + Intronic
913446774 1:118958671-118958693 TCTCTGGGAGGTGGGAGGTGGGG - Intronic
913667574 1:121062707-121062729 TCTTTGGGAGATGCTGGCTTGGG - Intergenic
914019266 1:143849850-143849872 TCTTTGGGAGATGCTGGCTTGGG - Intergenic
914657816 1:149758057-149758079 TCTTTGGGAGATGCTGGCTTGGG - Intergenic
915669594 1:157477579-157477601 TCCTTGGGCGGGGCTTGCTGTGG + Intergenic
916358651 1:163942278-163942300 TCACTGGGAAGTGTTTTCTGAGG - Intergenic
917913643 1:179678057-179678079 TCCTTGGGAAGGGCTTGCTGCGG + Intronic
918171761 1:182004192-182004214 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
918578755 1:186099322-186099344 TGTCTGGGAGGTGCAGGGTGGGG + Intronic
919773018 1:201174805-201174827 GCTCTGGGAGGTCTTTGGTGAGG + Intergenic
919802693 1:201363093-201363115 GCACTAGGAGGGGCTTGCTGGGG - Intronic
920150744 1:203905481-203905503 TATCTGGGAGGTGGAGGCTGTGG - Intergenic
920291979 1:204929673-204929695 TCTGTGGCAGGTGCTCCCTGGGG + Intronic
923458747 1:234188534-234188556 TCCTTGGGAGGGGCTTGCTGTGG - Intronic
924068642 1:240253971-240253993 TCACTGGCAGGTGCTTGAGGTGG + Intronic
924261467 1:242235774-242235796 TCTCTGTGAGGTGTGTGATGAGG - Intronic
924344555 1:243062193-243062215 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
924571589 1:245241795-245241817 GGTCTGGAAGGTGCTTGCTTTGG + Intronic
924768090 1:247052946-247052968 TCCTTGGGAGAAGCTTGCTGAGG + Intronic
1063873563 10:10446457-10446479 TCTGAGGGTGGTGCTTGCAGGGG - Intergenic
1064768829 10:18702600-18702622 TCACAGGAAGGTGCTTTCTGAGG + Intergenic
1065821054 10:29525944-29525966 TCTCCGGGAGGGCCCTGCTGTGG + Intronic
1066669513 10:37821982-37822004 TCTGAGGGAGCTGATTGCTGAGG - Intronic
1067007696 10:42680451-42680473 TCTCTGGGAGGCTCTTGCTGGGG - Intergenic
1067513942 10:46920683-46920705 TCCTTGGGCGGGGCTTGCTGAGG + Intronic
1067648312 10:48131149-48131171 TCCTTGGGCGGGGCTTGCTGAGG - Intergenic
1069461521 10:68599511-68599533 TGTCTGGCAGGTGCTAGCTGTGG + Intronic
1069773374 10:70913114-70913136 TTTCTGGGAGGGGTCTGCTGGGG + Intergenic
1070122545 10:73592851-73592873 TTTATGGGAGGTGTTTTCTGAGG - Intronic
1070154367 10:73824543-73824565 TCTCTGGGCTCAGCTTGCTGAGG - Intronic
1071081006 10:81811000-81811022 AATCTGGGAGGTGGTGGCTGTGG + Intergenic
1071870556 10:89789661-89789683 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1071932134 10:90484562-90484584 TCTTTGGTTGGGGCTTGCTGAGG + Intergenic
1072769564 10:98126280-98126302 TCCTTGGGCGGGGCTTGCTGTGG + Intergenic
1073097504 10:100988699-100988721 TCTCTGGGAGCTGCCTGATCAGG + Exonic
1073919024 10:108437911-108437933 TCTTTGGGTGGTGCTTGTTTAGG - Intergenic
1074419177 10:113294007-113294029 TCTCTGGCAGGGCCTGGCTGGGG - Intergenic
1074949164 10:118312104-118312126 TATCCTGGAGATGCTTGCTGGGG - Intronic
1075734529 10:124655700-124655722 TGTGTGGGAGGAGCTGGCTGTGG - Intronic
1076238061 10:128881199-128881221 TCTCTGGGAGCTGTTGGGTGTGG + Intergenic
1076285133 10:129288165-129288187 GCTGTGGGTTGTGCTTGCTGGGG + Intergenic
1077468153 11:2743512-2743534 CCTCTGGGAGCTGCATGCCGGGG - Intronic
1077555210 11:3222630-3222652 TCTCTGGGAGGGGTCTGGTGCGG + Intergenic
1078487648 11:11738965-11738987 TAGTTGGGAGGTTCTTGCTGTGG - Intergenic
1078743896 11:14092610-14092632 TCTCTAGGAGGGGCTAGATGTGG + Intronic
1079130527 11:17744529-17744551 TCTTTTGGGGGTGCTTGCTCAGG + Intronic
1080891469 11:36412204-36412226 TCTCTGGCCTGTGCTTGCTTGGG + Intronic
1082261996 11:50083532-50083554 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
1083043271 11:59708655-59708677 TCTCTGGGATGTGACTGCTATGG - Intergenic
1083132166 11:60634582-60634604 GCTCTGGGTGGTGCTTTCAGTGG - Intergenic
1083823019 11:65183081-65183103 TTTCTGGGAGGGGCTGGCCGAGG + Intronic
1083891492 11:65597999-65598021 TCTCAGGGAATTGCCTGCTGGGG - Exonic
1084455592 11:69266330-69266352 TCTCGTGGAGGTGCTGCCTGGGG + Intergenic
1084675455 11:70631324-70631346 AATCTGGGAGGAGCCTGCTGGGG + Intronic
1084727708 11:70952799-70952821 TCTCTGGTAGCTGCTTTCTGTGG + Intronic
1085390227 11:76178553-76178575 TCTCTGGAAGGAGCTTGCAAAGG - Intergenic
1087602076 11:100329266-100329288 TCTTTGAGTGGGGCTTGCTGTGG - Intronic
1088720865 11:112590687-112590709 TCTTTGGGAGGGGCTGTCTGAGG + Intergenic
1088720883 11:112590765-112590787 TCTGAGGGAGGTGCTCCCTGAGG + Intergenic
1089637293 11:119823374-119823396 TCTCTGGGAGGTGCAGGGAGAGG + Intergenic
1090763336 11:129855938-129855960 TCTCTGGGATGCGCTCGGTGGGG - Intronic
1090895021 11:130964366-130964388 TCTTTGGGAGGGTCTTGCTGCGG + Intergenic
1091235591 11:134020254-134020276 TCTCTGGGGCGAGCATGCTGTGG - Intergenic
1091317597 11:134625384-134625406 TCTCTGAGGGCTGCTTCCTGTGG - Intergenic
1093604493 12:21073749-21073771 TCTTTGGGTAGGGCTTGCTGTGG + Intronic
1094004825 12:25738362-25738384 TCTGTGGGAGGTCTTTCCTGAGG - Intergenic
1096956362 12:55529987-55530009 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
1097084106 12:56454701-56454723 TCCCTGGGAGGGGCAGGCTGAGG + Intronic
1097192197 12:57224955-57224977 GCTCTGGGAGCTGCTGGCCGGGG - Exonic
1097302540 12:58034255-58034277 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1098867945 12:75783753-75783775 TCTCTGCCAGGTGCCTTCTGAGG - Intergenic
1100331009 12:93582250-93582272 CTTCTGGGAGGTGCTGTCTGAGG + Intronic
1101875749 12:108596065-108596087 GCTCTGAGAGGTGCTACCTGTGG - Intronic
1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG + Exonic
1102303556 12:111788470-111788492 TCTCTGGGGTGTCCTTGCAGAGG - Intronic
1102432158 12:112891919-112891941 TCTCTGCCAGCTGCTGGCTGTGG + Intronic
1103902831 12:124312061-124312083 CCTCTGGGTGCTGCTTCCTGGGG + Intronic
1104796239 12:131521444-131521466 CCTCTGGGAGGTGATGGGTGAGG + Intergenic
1104877398 12:132045185-132045207 TCTTTGGCAGGTGCTTTCTGTGG + Intronic
1104930762 12:132338304-132338326 TCTCTGGGTGGTGCCGACTGTGG + Intergenic
1104979810 12:132568809-132568831 TCGCTGGGTGGTGGCTGCTGTGG + Intronic
1105812370 13:24006903-24006925 TCTCTGGAAGGAGGATGCTGTGG + Intronic
1106320557 13:28633450-28633472 TCTATGAGTGGTGCTGGCTGGGG - Intergenic
1106755795 13:32821678-32821700 TCTCTGGGTGGTGGATGCAGGGG + Intergenic
1107079303 13:36357221-36357243 TATCTGGGACCTGCTTCCTGAGG + Intronic
1107756006 13:43622913-43622935 TCCTTGGGAGGGTCTTGCTGAGG + Intronic
1107948796 13:45443719-45443741 CCTTTGGGAGGTGCTTGCTTTGG + Intergenic
1107964163 13:45584759-45584781 TCTTTGGGTTGTGTTTGCTGTGG + Intronic
1108346941 13:49555661-49555683 TCTCTTGTAGGTGTTTGCTTGGG - Exonic
1110181803 13:72626130-72626152 TCCCTGGGTGGGTCTTGCTGTGG - Intergenic
1112614639 13:100990982-100991004 TCTCTGGGAGGTGGCCTCTGTGG + Intergenic
1113014534 13:105813330-105813352 TCTCTGGGATCTGCTGGCTTGGG + Intergenic
1113271429 13:108679055-108679077 TCTCTGGGAGGTGATTACCTGGG - Intronic
1113709937 13:112456514-112456536 TCTCTGGGAGTGGCCTCCTGTGG + Intergenic
1113862342 13:113495629-113495651 TCCCTGGGCGGTGCAGGCTGTGG + Exonic
1114447926 14:22803804-22803826 TATGTGGCAGGTGCTTGCAGGGG - Intronic
1116476001 14:45340189-45340211 TCTCTGGGATATGCTTGTAGTGG - Intergenic
1117163187 14:53008829-53008851 TCTCCTTGAGGAGCTTGCTGTGG + Intergenic
1117510790 14:56448794-56448816 TCCCTGGGCGGGTCTTGCTGTGG + Intergenic
1118276380 14:64389176-64389198 TGTCTGGGAGGTGACTGGTGAGG + Intronic
1120057790 14:79946018-79946040 TCTCTGGGATGGGGCTGCTGGGG - Intergenic
1120131039 14:80808020-80808042 GCTCTGGAAGGTGCTTGCCTTGG - Intronic
1122072299 14:99212670-99212692 TCTCTGGGAAGTCTCTGCTGAGG - Intronic
1122508977 14:102250521-102250543 TTGCTGTGAGGTGCTTGATGGGG - Intronic
1202858922 14_GL000225v1_random:69053-69075 TCTCTGGGATCTGCTTACAGGGG + Intergenic
1202866369 14_GL000225v1_random:121288-121310 TGTCTGGGATGTGCTTACAGGGG + Intergenic
1202922487 14_KI270723v1_random:38068-38090 TTTCTGGGATGTGCTTACAGGGG - Intergenic
1124073647 15:26421009-26421031 TCTCTGGGAAGTCCTGCCTGGGG - Intergenic
1124910559 15:33916010-33916032 TCCGTGGGTGGGGCTTGCTGCGG - Intronic
1125545739 15:40503175-40503197 TATCTAGCAGGTGCCTGCTGTGG - Intergenic
1126433181 15:48608717-48608739 ACTGTGGGTGGTGCTTTCTGAGG - Intronic
1128213801 15:65920387-65920409 CCTCTGGGAGGTGCTTGATTTGG + Intronic
1128524259 15:68401752-68401774 TCTCTGGGAGGTGATTACATAGG + Intronic
1128580673 15:68807547-68807569 TCTCCAGAAGGTGCTTGCTGGGG - Intronic
1129418079 15:75399906-75399928 TCTATGGTAAGTGCTTGTTGTGG - Intronic
1129562763 15:76589373-76589395 TCCTTGGGTGGGGCTTGCTGCGG + Intronic
1131079286 15:89521236-89521258 TCTCTGGGCAGGTCTTGCTGAGG - Intergenic
1131344826 15:91636919-91636941 CCCCTGGGAGGTCCTGGCTGGGG - Intergenic
1131869114 15:96743361-96743383 TCTCTGGGAAGTGCTCGGTTAGG + Intergenic
1131986103 15:98044103-98044125 TCTTTGGGAGGTGCTAGCACAGG - Intergenic
1135883227 16:26279599-26279621 TCCTTGGGCGGGGCTTGCTGCGG + Intergenic
1138098976 16:54236370-54236392 GCTCTGGGAGGCCCTTGCTCAGG + Intergenic
1138349774 16:56340286-56340308 TCTCGGGGGTGAGCTTGCTGTGG - Intronic
1138589144 16:57990191-57990213 TCTCTTGGAGTTGCTGGCAGTGG + Intergenic
1139375304 16:66493210-66493232 TCTCTGAGCTGTGCCTGCTGTGG - Intronic
1140777527 16:78263728-78263750 TCTCTGGGAAGTTCTGGCTCAGG - Intronic
1140941649 16:79726706-79726728 TCTATGAAAGGTGCTTCCTGGGG + Intergenic
1141045469 16:80712623-80712645 TCTCTGCGAGGTGCTTGGAAAGG + Intronic
1141279599 16:82619063-82619085 GCTCTGGGAGATGGATGCTGAGG + Intergenic
1141282264 16:82639391-82639413 TCACTGGGATGTTCTTGCTGGGG - Exonic
1141302994 16:82835471-82835493 TTCCTGGGATGTGCTTCCTGGGG + Intronic
1141944371 16:87299198-87299220 TTTCTGGGGTGTTCTTGCTGTGG - Intronic
1142376463 16:89709332-89709354 TCTGGGGGAGGAGCTTGGTGGGG + Exonic
1142401178 16:89859444-89859466 TCCCTGGGAGCTGCCTGCTCAGG - Intronic
1143474616 17:7195617-7195639 TCTCTCGGAGGTGCTGGCCCTGG - Intronic
1144438372 17:15261101-15261123 TCGCCGGGAGGTGCTTGGGGTGG - Intronic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1144996504 17:19272964-19272986 TCTCTGGGAGGAGCAGCCTGTGG - Intronic
1146110361 17:30084038-30084060 ACTCTGGGAGGTGCTTGGTTGGG + Intronic
1146376706 17:32299392-32299414 ATTCTGGGAGGGGCTTGCAGGGG - Intronic
1146600145 17:34206888-34206910 TCTCTGGCAGGAACTTGCAGAGG + Intergenic
1147305655 17:39562391-39562413 GCTCTGGGAGGTCCTGACTGTGG + Intronic
1148065676 17:44867855-44867877 TCTCTGGGAGCTGCTAGTTGGGG + Exonic
1148193008 17:45692890-45692912 CCTCTGGGAGAGACTTGCTGAGG - Intergenic
1148725915 17:49789680-49789702 TTTCTGCGCGGTGGTTGCTGTGG + Intronic
1152178900 17:78805666-78805688 TCTCTGGCAGGTGTCTGCAGAGG + Intronic
1152269080 17:79313330-79313352 TCACTGGGAGGTCCGTGCTCTGG - Intronic
1152740558 17:82016652-82016674 TCTCGGGGAGGTGGTTACTGGGG - Intronic
1152829076 17:82486222-82486244 TCTCCGGGAAGGACTTGCTGAGG + Intronic
1152879900 17:82808746-82808768 TGTCAGGGAGGTCCCTGCTGTGG + Intronic
1152879918 17:82808808-82808830 TGTCAGGGAGGTCCCTGCTGTGG + Intronic
1153280037 18:3406415-3406437 TCTCTGGGTGGAGCAGGCTGGGG + Intergenic
1154090018 18:11349464-11349486 TCCCTGGGCAGGGCTTGCTGTGG - Intergenic
1154472867 18:14721930-14721952 GCCCTGGGAGGTTATTGCTGGGG + Intergenic
1155005920 18:21729066-21729088 TCTCAGGCAGGTGCCTGCAGAGG + Intronic
1156020901 18:32598102-32598124 TCCCTGGGTGGGGTTTGCTGTGG - Intergenic
1158828597 18:61252839-61252861 TCTTTGAGAGGTTCTTGGTGTGG + Intergenic
1160496688 18:79380198-79380220 TCACAGGAAGGTGCGTGCTGCGG + Intergenic
1160685641 19:435282-435304 TCTCGGGGCCGTGCTTGCTGAGG - Intronic
1160794461 19:938495-938517 TCTCTGGCAGGTGCATCCCGGGG - Intronic
1160898326 19:1413323-1413345 TGTCTGGGAGGTGCCTGCCCAGG + Intronic
1162072296 19:8161253-8161275 TCTCCGGGAGCTGCAGGCTGGGG + Intronic
1162392904 19:10400200-10400222 TCTGTGGGCCCTGCTTGCTGGGG - Intronic
1162939501 19:14000022-14000044 TCTTTGGGAGGGCCTTGCTGAGG - Intronic
1163665944 19:18604156-18604178 TCTCTGGGGGGTCCTGGCTGGGG + Intronic
1164018322 19:21273237-21273259 TCCTTTGGAGGTGCTTGCAGTGG + Intronic
1165396639 19:35567902-35567924 TCTCTGGGAGGTGAACACTGAGG + Intergenic
1165969812 19:39617946-39617968 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
1167539554 19:50076499-50076521 TCTCAGGTAGGTGTTTGCAGTGG + Intergenic
1167630157 19:50621373-50621395 TCTCGGGTAGGTGTTTGCAGTGG - Intronic
1168645590 19:58057046-58057068 TCTTTGGGGGGTGCTGGCAGAGG - Intergenic
925491297 2:4396115-4396137 TCTTTGGGAGGTGATCTCTGGGG + Intergenic
925705552 2:6681548-6681570 TCTTTGGGTGGGGTTTGCTGCGG - Intergenic
926169282 2:10541382-10541404 TCTCTGGCAGGTCCTTCCTTTGG - Intergenic
926563669 2:14445536-14445558 TCTCTGGCAGGGGGTTGGTGGGG + Intergenic
928435696 2:31253230-31253252 TGTGTGGGAGGGGGTTGCTGTGG - Intronic
928723659 2:34147803-34147825 TCCCTGGGCTGTTCTTGCTGAGG + Intergenic
928733742 2:34261726-34261748 TCTCTGGGCAGATCTTGCTGCGG - Intergenic
930373732 2:50538216-50538238 TCTCAGGGAGTTGGCTGCTGGGG + Intronic
930574313 2:53127423-53127445 TCCTTGGGCGGGGCTTGCTGGGG + Intergenic
931238567 2:60432724-60432746 TCTCAGGGAGGGGGCTGCTGAGG - Intergenic
931920115 2:67005906-67005928 TCTCTGTGAACTGCTGGCTGTGG + Intergenic
932412655 2:71556367-71556389 TCTCCAGGAGGAGCTGGCTGGGG + Intronic
932625321 2:73292278-73292300 GCCCTGGGAGCTGCTTTCTGTGG - Exonic
935261794 2:101362120-101362142 GCTCAAGGAGCTGCTTGCTGAGG + Intronic
936530487 2:113273198-113273220 TCTCAGCGAGGAGCTTGCTAGGG - Intronic
936857703 2:116980172-116980194 TCTTTGGGCAGGGCTTGCTGCGG - Intergenic
937078039 2:119121298-119121320 TCTCTCAGAGGTCCTTTCTGTGG + Intergenic
938991569 2:136635231-136635253 TAGCTGGGAGGTGCTGGCTCAGG + Intergenic
940762399 2:157751789-157751811 TCCTTGGGTGGGGCTTGCTGTGG - Intronic
944847521 2:203683707-203683729 TCTCTGGGAAGTCCCTGCTCAGG + Intergenic
945657622 2:212644430-212644452 TCCCTGGGCAGGGCTTGCTGTGG + Intergenic
946221957 2:218235446-218235468 TCTCTGGGAGGCGGAGGCTGAGG - Intronic
946245126 2:218383037-218383059 TCTCTGGGAGGTGCTTGCTGTGG - Exonic
946374884 2:219302104-219302126 TCACAGGGAGGTGGATGCTGAGG + Intronic
948135626 2:235633977-235633999 TTGCAGGGAGGGGCTTGCTGGGG - Intronic
948278492 2:236728459-236728481 TCTCTGGGACTTGCTAGTTGTGG - Intergenic
948593774 2:239066898-239066920 TTTCTGGGCTGTGCTGGCTGCGG - Intronic
948713985 2:239847120-239847142 TCCTTGGGTGGGGCTTGCTGAGG - Intergenic
1168880686 20:1203841-1203863 TATATGGGAGGTGCTGGGTGTGG + Intronic
1169648015 20:7835316-7835338 TCTGTGGTAGGTACTTGATGAGG - Intergenic
1170093257 20:12616638-12616660 TCTCTGGGAAGTGTGTGCTTTGG - Intergenic
1171066931 20:22026620-22026642 TCCATGGGTGGGGCTTGCTGTGG + Intergenic
1172529255 20:35618834-35618856 CCTCTGGGAGCTGGTTGCTTTGG - Intronic
1173653751 20:44684647-44684669 TCTCTGTGTGGTGCTGGATGAGG - Intergenic
1174802184 20:53573747-53573769 TATATGGGAGGTGCTGGATGTGG - Intronic
1175693336 20:61082281-61082303 TCTCAGGGAGAGGCCTGCTGTGG - Intergenic
1175853663 20:62107365-62107387 ACTCTGGGAGGTACATGATGAGG - Intergenic
1176189191 20:63799765-63799787 TCTCATGGGGGAGCTTGCTGTGG - Intronic
1176801617 21:13435919-13435941 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
1180021116 21:45127708-45127730 TCTCTGGGAGGTGTGTCCAGGGG - Intronic
1180229862 21:46420751-46420773 ACTCTGGGATGTGACTGCTGCGG - Intronic
1180289517 22:10784129-10784151 TCTCAGGAAGGTGGCTGCTGTGG - Intergenic
1180305382 22:11068670-11068692 TCTCAGGAAGGTGGCTGCTGTGG + Intergenic
1180713122 22:17853406-17853428 TCTCTGGCCTGTGCCTGCTGTGG - Intronic
1181011061 22:20040885-20040907 TCTCAGGGATGTGCTGCCTGGGG - Intronic
1183141691 22:35947467-35947489 CCTCAGGGAGGTCCTTCCTGAGG + Intronic
1183472346 22:38016409-38016431 TCTCTGGGAGGTGGCGGATGGGG - Intronic
1183696590 22:39427161-39427183 GCTCTGTGAATTGCTTGCTGGGG - Intronic
1184155414 22:42663572-42663594 GCTCTGGGAGCTGCTGGGTGAGG + Intergenic
1184599114 22:45532245-45532267 GCTATGGGAGGAGCTTTCTGGGG + Intronic
1185047243 22:48534634-48534656 TCTCCTCTAGGTGCTTGCTGGGG + Intronic
1185417873 22:50720083-50720105 TCTGTGGGAGGGGGTTGCCGGGG + Intergenic
949572052 3:5302923-5302945 TCTCTGATAGGTACTTGGTGGGG - Intergenic
949749316 3:7332797-7332819 TCGTTGGGTGGGGCTTGCTGAGG - Intronic
950603552 3:14057776-14057798 TCTTTGGGTGGGTCTTGCTGTGG + Intronic
950677981 3:14565971-14565993 TCTCTGGGTGCTGCTTCCTGTGG + Intergenic
951302669 3:21017590-21017612 TCCTTGGGTGGGGCTTGCTGCGG + Intergenic
951691018 3:25396690-25396712 TCTTTGGGTGGGGTTTGCTGTGG + Intronic
951750077 3:26025325-26025347 TCCTTTGGAGGGGCTTGCTGTGG + Intergenic
952543588 3:34395333-34395355 ATTCTGGTAGGTGCTTGCTTTGG + Intergenic
952594547 3:35000217-35000239 TCTGTGGAGGGTGCTTGGTGTGG - Intergenic
954257563 3:49417217-49417239 ACTCTGCCAGGTGCTGGCTGTGG - Exonic
957309044 3:78495510-78495532 TCCCTGCGTGGTGCATGCTGAGG - Intergenic
963674774 3:148296369-148296391 GCGGTGGGAGGTGCTTGCTCTGG - Intergenic
964004382 3:151811039-151811061 TTTCTGGGAGGAGGTTTCTGGGG - Intergenic
968493006 4:900593-900615 TGTCTGGGTGGTTCTTCCTGAGG - Intronic
968677996 4:1895866-1895888 CCTCTGGTGGGTGTTTGCTGAGG + Intronic
969480635 4:7445191-7445213 TCTCTGGGACATGCCTGCAGAGG + Intronic
970006533 4:11416397-11416419 TCTCTGGGAGCTGTCTCCTGAGG + Intronic
970140038 4:12972172-12972194 TTTCTGGGAGGTGCTTTCAGAGG + Intergenic
970312070 4:14793142-14793164 TCTTTGGGTGGGTCTTGCTGTGG - Intergenic
971268693 4:25117234-25117256 TCTCTGGGAGGTACATACTGAGG + Intergenic
973168229 4:47105442-47105464 TCTTAGGCAGGTGCTTGCTTTGG + Intronic
973372469 4:49262818-49262840 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
975534591 4:75435874-75435896 TCTTTGGGTAGGGCTTGCTGTGG - Intergenic
975640436 4:76494754-76494776 CCTCTGTGTGGTGCTTGCTGTGG + Intronic
976033948 4:80793906-80793928 ACTTTCTGAGGTGCTTGCTGAGG - Intronic
976108868 4:81649048-81649070 TGTCTGGTAGGTGGTTGCTGTGG - Intronic
976272918 4:83248515-83248537 ACTCTGCCAGGTGCTGGCTGTGG + Intergenic
976530137 4:86142223-86142245 TCTGAGGTAGGTACTTGCTGTGG - Intronic
980392085 4:132159728-132159750 TCCTTGAGAGGCGCTTGCTGTGG + Intergenic
980409953 4:132403974-132403996 TCTTTGGGTGGGACTTGCTGTGG + Intergenic
982159654 4:152554947-152554969 TCTGTGGCAGGTCCATGCTGGGG - Intergenic
982451042 4:155552536-155552558 TCTTTGGATGGGGCTTGCTGCGG - Intergenic
983547039 4:168975743-168975765 TCCCTGGGCGGGACTTGCTGTGG + Intronic
985092902 4:186381956-186381978 TCCTTGGGCGGTCCTTGCTGCGG - Intergenic
985217754 4:187671891-187671913 TCCTTGGGCGGTCCTTGCTGCGG + Intergenic
985355759 4:189116993-189117015 TCCCTGGGCAGTGCTTGCTGTGG - Intergenic
985923343 5:2996603-2996625 TCTCTGGGAGGTCCTGGTGGTGG - Intergenic
985966622 5:3342925-3342947 GCTCTGGGATGTGGTGGCTGAGG - Intergenic
986001713 5:3635590-3635612 TCTCTGGGAGGTGATTGTCATGG + Intergenic
986737567 5:10679529-10679551 AGGCTGGGAGGTGCTTGCTGGGG + Exonic
988111635 5:26830285-26830307 TATCTGTGAGGTTCTTGCTAAGG - Intergenic
988942301 5:36158830-36158852 TCTCTGGGAGATGGGGGCTGGGG - Intronic
989045851 5:37272724-37272746 TCTTAGGGTGGTGTTTGCTGAGG - Intergenic
989204876 5:38800440-38800462 TCTCTGCTAGGTGCTGGCGGGGG + Intergenic
989431545 5:41361058-41361080 TCCATGGGTGGGGCTTGCTGTGG + Intronic
990538528 5:56749029-56749051 TCTCAGCGAGGTGCCTCCTGAGG - Intergenic
992763652 5:79974307-79974329 TCTCAGGGAGGAGGCTGCTGTGG - Intergenic
994887451 5:105582713-105582735 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
996080814 5:119256035-119256057 TCCTTGGGCGGGGCTTGCTGTGG - Intergenic
998495721 5:142587680-142587702 TCTCTGGAAGCAACTTGCTGGGG - Intergenic
1000058447 5:157631235-157631257 TCTCTGGAAGTTGCTGGGTGTGG - Intronic
1001463057 5:171935509-171935531 TCTCTTGGAGTTTATTGCTGTGG - Intronic
1001733762 5:173981601-173981623 TCTTGGGCAGGGGCTTGCTGTGG + Intronic
1001823234 5:174725667-174725689 TGCCGGGGAGGTGCTGGCTGCGG - Intronic
1003198537 6:3937618-3937640 TCTCTGGGACCTGCTTGATTAGG - Intergenic
1004248223 6:14000996-14001018 GCACTGGTAAGTGCTTGCTGTGG - Intergenic
1004496542 6:16168712-16168734 TCTATGGAAGCTGCTTGCAGCGG - Intergenic
1005366743 6:25086002-25086024 TTCCTGAGAGGTGCTTGGTGGGG + Intergenic
1006148739 6:31975157-31975179 TCCCTGGGAGGTGACTGCTGTGG + Intronic
1006307575 6:33233520-33233542 TTTTTGGGAGATGCATGCTGAGG - Intergenic
1006455013 6:34126663-34126685 TCTCTGCGAGCTCCTGGCTGTGG - Intronic
1006516451 6:34548279-34548301 TCTCTCTGAGGTGCATGCTCTGG + Intronic
1007023697 6:38547741-38547763 TCTCTGAGAGGTCCTCCCTGAGG - Intronic
1008169328 6:48183187-48183209 TCTGTGGGAGGTGCTTTCCAGGG + Intergenic
1008185889 6:48389568-48389590 TCCTTGGGCGGGGCTTGCTGTGG + Intergenic
1009990875 6:70841425-70841447 TCTTTGTGAGATGCTTTCTGGGG - Intronic
1010014168 6:71085260-71085282 TCACTGGGTTGTGCTTGCAGAGG + Intergenic
1010817524 6:80376161-80376183 TCTCTGGGTGGGGCTTGCTGCGG + Intergenic
1011121511 6:83958709-83958731 CCTCTGGGAGCTGCCAGCTGGGG + Intronic
1011156624 6:84340805-84340827 TCTTTGGGTAGGGCTTGCTGTGG + Intergenic
1012068392 6:94578923-94578945 TATCTTGGAGGTGCATTCTGAGG - Intergenic
1012203783 6:96436823-96436845 TCCTTGGGTGGGGCTTGCTGCGG - Intergenic
1013457000 6:110338966-110338988 TCTCTGGGAGGTCATCTCTGTGG - Intronic
1013632483 6:111998742-111998764 TCTCAGGCAGGTGCTTTATGGGG - Intergenic
1014125689 6:117774621-117774643 TCTCTGGAAGGAGCCAGCTGTGG - Intergenic
1014313180 6:119830686-119830708 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1015899854 6:138053259-138053281 TTTTTGGGTGGGGCTTGCTGTGG - Intergenic
1017061742 6:150491119-150491141 CCTCTGGGAGCTGATAGCTGAGG - Intergenic
1017650379 6:156576125-156576147 TCTCTGTGCTGTGCTTCCTGGGG - Intergenic
1018610176 6:165640882-165640904 TTCCTGGTAGGTGCTGGCTGAGG - Intronic
1018754383 6:166837120-166837142 TTGCTGGGAGGTGCGTGGTGAGG + Intronic
1018897143 6:168027600-168027622 ACTGTGGGAGGTGGGTGCTGGGG + Intronic
1021913012 7:25405246-25405268 TCTGTGAGAGTTGGTTGCTGAGG - Intergenic
1022046266 7:26624845-26624867 TCTGTGGGTGGTGCTGGCTTGGG + Intergenic
1022047268 7:26631829-26631851 TCTTTGGGAGGTGCTGGAGGTGG + Intergenic
1023400147 7:39786799-39786821 GCCCTGGGAGGTTATTGCTGGGG + Intergenic
1024082675 7:45868083-45868105 TCTCTGGGAAGTTCTGGCTTGGG + Intergenic
1024174766 7:46827748-46827770 TCCTTGGAAGGGGCTTGCTGTGG - Intergenic
1024650257 7:51397638-51397660 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
1024713941 7:52053163-52053185 TCTCTGTGTGGTACTTTCTGTGG + Intergenic
1024768036 7:52684551-52684573 TGTCTGAGAGGTGGTTTCTGTGG + Intergenic
1025054401 7:55753288-55753310 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
1025132453 7:56383440-56383462 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
1025183511 7:56837897-56837919 GCCCTGGGAGGTTATTGCTGGGG - Intergenic
1025688414 7:63739070-63739092 GCCCTGGGAGGTTATTGCTGGGG + Intergenic
1026010965 7:66635841-66635863 GCTGTGGGAGCTGCTAGCTGGGG - Intronic
1026016228 7:66672948-66672970 GCTGTGGGAGCTGCTAGCTGGGG - Intronic
1026873246 7:73865847-73865869 TCTCTGGGAGTTTCTTGCTCTGG - Exonic
1026973051 7:74479491-74479513 TCTAGGGGAGGTGGGTGCTGCGG + Intronic
1028825302 7:95265601-95265623 TCTTTGGTAGGTGCTTCTTGTGG + Intronic
1028962232 7:96761810-96761832 TCTTTGGGTGGGTCTTGCTGCGG + Intergenic
1030455807 7:109772629-109772651 TCCTTGGGCAGTGCTTGCTGTGG - Intergenic
1031090419 7:117347897-117347919 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1032073929 7:128827420-128827442 TATCTGGGCAGTGCTGGCTGGGG - Intergenic
1033526939 7:142225579-142225601 ACTCTGGGAGATGCATGATGAGG - Intergenic
1034705483 7:153139457-153139479 TCCTTGGGAGGGGCTTGCTGTGG + Intergenic
1035159028 7:156937721-156937743 TCTGTGGGAGATGCTTCCAGTGG - Intergenic
1035290168 7:157832939-157832961 TCTCCAGGAGGTGCGTGATGTGG + Intronic
1035359302 7:158299815-158299837 GCCCTGGCAGGTGCTTGCTGGGG + Intronic
1037952533 8:23028314-23028336 GCTCAGGTAGGTGCTGGCTGAGG - Exonic
1037967490 8:23145651-23145673 GCTCAGGTAGGTGCTGGCTGAGG - Exonic
1037974595 8:23200488-23200510 GCTCAGGTAGGTGCTGGCTGAGG - Exonic
1038492673 8:27981904-27981926 TTCCTGGGAGGGGCTGGCTGGGG - Intronic
1041927070 8:63248240-63248262 TCCTTGGGTGGAGCTTGCTGTGG + Intergenic
1042995534 8:74693799-74693821 TCCTTGGGTGGGGCTTGCTGTGG - Intronic
1043678937 8:82997081-82997103 TCCTTGGGTGGTGCTTGCTATGG - Intergenic
1045294588 8:100862217-100862239 GCAGTGGGAGGTGCCTGCTGTGG - Intergenic
1045470184 8:102505426-102505448 GCTGTGGGAGGGGATTGCTGGGG - Intergenic
1045736962 8:105307687-105307709 TCTCTGAGAGGTGGGTTCTGTGG + Intronic
1047135855 8:122077674-122077696 ACTCTAGGAAGTGTTTGCTGAGG + Intergenic
1047607340 8:126488379-126488401 TCCTTGGGCGGGGCTTGCTGTGG + Intergenic
1048021990 8:130547731-130547753 AATCTGGGAGCTGCATGCTGGGG + Intergenic
1048076590 8:131078233-131078255 TCCCAGGGCGGTCCTTGCTGGGG - Intergenic
1048476716 8:134749523-134749545 CCTTTGGGAGGTGATTGATGAGG - Intergenic
1048534822 8:135283457-135283479 TCTCTGGGAGCTGCTGTCTCTGG + Intergenic
1049210293 8:141383444-141383466 CATGTGGGAGGTGCTGGCTGAGG - Intergenic
1049728342 8:144161954-144161976 TCTCTGGGAAGTATGTGCTGTGG + Intronic
1050133596 9:2439191-2439213 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1050718573 9:8558472-8558494 TCTCTGGGAGGTGCTATATGGGG - Intronic
1050889773 9:10809763-10809785 TCTCTCTGAGGTCCTTTCTGAGG + Intergenic
1051885653 9:21890098-21890120 TCCTTGGGTGGGGCTTGCTGTGG + Intronic
1052772412 9:32701995-32702017 TCGCTGGGAGGTTCTGGCTAAGG - Intergenic
1053231729 9:36416153-36416175 TCCTTGGGCGGGGCTTGCTGTGG + Intronic
1054702886 9:68431794-68431816 TGTCTGAGAGGGGATTGCTGGGG + Intronic
1054706147 9:68464224-68464246 TCTCTTAGAGCTGCTTCCTGGGG - Intronic
1056116638 9:83447419-83447441 TCTCTGGTTGGTGCTGGCTAGGG - Intronic
1056948075 9:91017798-91017820 TCCTTGGGTGGGGCTTGCTGAGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1057948683 9:99352374-99352396 TCTCGTGTAGCTGCTTGCTGTGG - Intergenic
1059457700 9:114410115-114410137 TCTCTGGGAGGGCCTCGCTGAGG - Intronic
1059932264 9:119272745-119272767 TCTCTGCGATGTGGCTGCTGGGG - Intronic
1060719910 9:125969893-125969915 TGTGTGGGAGGTGCTTGGTGGGG - Intergenic
1061034120 9:128103916-128103938 TCTCTGGCTGGTGCCTGCTTTGG + Intronic
1061293468 9:129665424-129665446 TATCTGGGAGGTGATGGCAGAGG - Intergenic
1062040440 9:134401970-134401992 CCTCTGGGAGGTAGGTGCTGTGG + Intronic
1062446021 9:136595299-136595321 CCACTGGGAGGCCCTTGCTGTGG + Intergenic
1062630921 9:137462718-137462740 TGTCTGGGTGGTGGCTGCTGTGG - Exonic
1186308385 X:8289941-8289963 TCCTTGGGTGGGGCTTGCTGTGG - Intergenic
1186963083 X:14758205-14758227 TCTTTGGGCAGGGCTTGCTGTGG - Intergenic
1187091733 X:16103983-16104005 TCTCCCAGAGGTGCTAGCTGTGG - Intergenic
1188114141 X:26223205-26223227 TCTCAGGGAGGTGCTGGCTTTGG + Intergenic
1188292772 X:28409751-28409773 TCTCTGGGAGATGCTTTTAGAGG + Intergenic
1188719009 X:33500123-33500145 TCTTTGGGTGGGGCTTGCTAAGG - Intergenic
1189962167 X:46333940-46333962 TCTTTGGGTGGGTCTTGCTGTGG - Intergenic
1190123545 X:47683570-47683592 TCACTGGGAGGTGGTCACTGCGG + Intergenic
1191138625 X:57092865-57092887 TCCTTGGGCGGTGCTTGCTGTGG - Intergenic
1191144873 X:57155319-57155341 TCCTTGGGTGGAGCTTGCTGTGG + Intergenic
1192869429 X:75172239-75172261 TCTTTGGGCTGAGCTTGCTGAGG + Intergenic
1192994560 X:76498983-76499005 TCCTTGGGTGGGGCTTGCTGTGG + Intergenic
1193007928 X:76642202-76642224 TATTTGGGTGGGGCTTGCTGTGG + Intergenic
1193196952 X:78643586-78643608 TCCCTGGGTGGGGCTTGCTGTGG - Intergenic
1194361601 X:92958591-92958613 ACTCTGTGAGGTGTTGGCTGGGG - Intergenic
1194919788 X:99750812-99750834 TATCTGGCAAGTGGTTGCTGGGG - Intergenic
1195829477 X:109040151-109040173 TCTCTGGGAGAGGCATGCAGAGG + Intergenic
1196218905 X:113088398-113088420 TCTTTGGGTGGGTCTTGCTGTGG - Intergenic
1196225182 X:113157868-113157890 TCTTTGGGTGGGTCTTGCTGTGG + Intergenic
1197079398 X:122394162-122394184 TCCTTGGGAAGGGCTTGCTGCGG - Intergenic
1197639924 X:128956198-128956220 TCCCTGGGAGGTGCCTGTTGGGG - Intergenic
1197902856 X:131392623-131392645 TCTCTGGGATGTCCTTGCCTTGG + Intronic
1198741925 X:139851457-139851479 TCCCTGGTAGGAGCTTTCTGTGG - Intronic
1198943283 X:141982238-141982260 TTTTTGGGTGGGGCTTGCTGCGG + Intergenic
1199768399 X:150957544-150957566 TCTGTGAGAGGTCCTTTCTGGGG + Intergenic
1199913725 X:152315834-152315856 TCCTTGGGTGGTGCTTGCTGTGG - Intronic
1200212742 X:154354102-154354124 TCTCTGTGAGGTGGTGGCGGTGG + Intronic
1200669794 Y:6074465-6074487 ACTCTGTGAGGTGTTGGCTGGGG - Intergenic