ID: 946247701

View in Genome Browser
Species Human (GRCh38)
Location 2:218396896-218396918
Sequence GTCTCCCGCCGCTGGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946247701_946247706 11 Left 946247701 2:218396896-218396918 CCCACACTCCAGCGGCGGGAGAC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 946247706 2:218396930-218396952 CAAGTCCCTGTGGCAGGATGCGG 0: 1
1: 0
2: 3
3: 20
4: 274
946247701_946247710 18 Left 946247701 2:218396896-218396918 CCCACACTCCAGCGGCGGGAGAC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 946247710 2:218396937-218396959 CTGTGGCAGGATGCGGTGAAGGG 0: 1
1: 0
2: 0
3: 14
4: 390
946247701_946247709 17 Left 946247701 2:218396896-218396918 CCCACACTCCAGCGGCGGGAGAC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 946247709 2:218396936-218396958 CCTGTGGCAGGATGCGGTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 229
946247701_946247704 1 Left 946247701 2:218396896-218396918 CCCACACTCCAGCGGCGGGAGAC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 946247704 2:218396920-218396942 GCTGTGCAAACAAGTCCCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 155
946247701_946247705 5 Left 946247701 2:218396896-218396918 CCCACACTCCAGCGGCGGGAGAC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 946247705 2:218396924-218396946 TGCAAACAAGTCCCTGTGGCAGG 0: 1
1: 0
2: 2
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946247701 Original CRISPR GTCTCCCGCCGCTGGAGTGT GGG (reversed) Intergenic
900166477 1:1246086-1246108 GTCTCCAGCCGCAGGAGTCATGG + Intronic
901929310 1:12586549-12586571 GTCTTCCCCCACTGGAATGTGGG - Intronic
904833309 1:33319629-33319651 CTCTCCTGCTGCTGGAGTGCAGG - Intronic
904833805 1:33322191-33322213 CTCTCCTGCTGCTGGAGTGCAGG - Intergenic
905394826 1:37660587-37660609 GTCTCCCTCCCCAGGAGGGTCGG - Intergenic
905932050 1:41795540-41795562 AATTCCCTCCGCTGGAGTGTGGG - Intronic
912429109 1:109619903-109619925 GACTCCCGCGGCCGGACTGTGGG - Intronic
923942609 1:238844527-238844549 GTCTGCCTCAGCTGGTGTGTTGG + Intergenic
924334474 1:242973481-242973503 GTCTCCCTGCGCTGGGGTTTGGG - Intergenic
1065073554 10:22053010-22053032 GTCTCCCCAAGCTGGAGTTTGGG + Intergenic
1070934139 10:80280476-80280498 GTCTCCCCCTCCTAGAGTGTTGG - Intronic
1075297094 10:121287190-121287212 GTCTCCCGGAGCTGGGGTCTGGG - Intergenic
1075791222 10:125085704-125085726 GACTCTCGCAGCTGGGGTGTGGG + Intronic
1076908147 10:133373404-133373426 GTCTCGCGGCGCTGGCCTGTGGG - Exonic
1079426055 11:20343035-20343057 GTCTGCCTCAGCTGGTGTGTTGG - Intergenic
1081549801 11:44100655-44100677 ATCTCCTGCAGCTGGAGGGTGGG + Intronic
1084849854 11:71929801-71929823 GTCTCCCACCACTAGACTGTGGG - Intronic
1088004839 11:104927417-104927439 GTCTGCCACAGCTGGTGTGTGGG - Intergenic
1090734414 11:129598685-129598707 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
1092144057 12:6202455-6202477 GTCTCTCCCGGCTGGTGTGTTGG + Intronic
1094275326 12:28668775-28668797 GTCTACCACAGCTGGTGTGTTGG - Intergenic
1094436391 12:30425048-30425070 GTCTCCTGCTGCTGGAGCCTAGG - Intergenic
1101252110 12:102946614-102946636 GTCCACTGCTGCTGGAGTGTTGG + Intronic
1104405024 12:128510058-128510080 GTCACCAGCCTCAGGAGTGTTGG - Intronic
1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG + Intergenic
1108815643 13:54287097-54287119 GTCTTCCCCAGCTGGTGTGTTGG + Intergenic
1111951603 13:94712827-94712849 CTCTCCCGCTGCTGGACTGACGG + Intergenic
1112090020 13:96073199-96073221 GTCTCCCTCTGCTAGAGTGTGGG + Intergenic
1113314001 13:109159582-109159604 GTCTCCTTCCTCTGGAATGTGGG - Intronic
1114007575 14:18331686-18331708 GTCTCCAGCTGCAGGAGAGTGGG - Intergenic
1118530680 14:66702005-66702027 GTCTGCCACAGCTGGTGTGTTGG - Intronic
1119158683 14:72434635-72434657 GTTTCAAGCCCCTGGAGTGTAGG + Intronic
1120880147 14:89409330-89409352 GTCCCCCACCGCTGGATTCTGGG - Intronic
1121409635 14:93740628-93740650 GTCCCCAGCCACAGGAGTGTCGG - Intronic
1124402997 15:29366592-29366614 GTCACCTGGCGCTGGGGTGTGGG - Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132864217 16:2085664-2085686 GGCCCCCGCTGCTGGTGTGTGGG - Intronic
1135636254 16:24078219-24078241 GTCTGCAGCCGCTGCAGCGTGGG + Intronic
1138425986 16:56932326-56932348 GGCGACCGCGGCTGGAGTGTGGG + Exonic
1139639731 16:68282528-68282550 GTTTACCTCCCCTGGAGTGTTGG + Intronic
1142328302 16:89432912-89432934 GTCACCCATGGCTGGAGTGTGGG - Intronic
1152601405 17:81264054-81264076 TTGTCCTGCCACTGGAGTGTGGG + Intronic
1161084102 19:2326102-2326124 GTGCCCCTCCTCTGGAGTGTGGG + Intronic
1165895170 19:39136932-39136954 GTCTCCCGGCGGGGGAGTGCAGG + Intronic
925180390 2:1813573-1813595 GAATCCCGCCGCTGACGTGTCGG - Intronic
925303775 2:2835196-2835218 GTCTCCCTCCCCAGGAGTGCTGG - Intergenic
927211563 2:20642137-20642159 GTCTCCCCCGACTGAAGTGTGGG + Intronic
929780895 2:44956176-44956198 GTCTCCTACAGCGGGAGTGTGGG + Intergenic
930314844 2:49785275-49785297 GTCTGCCACCACTGGACTGTAGG - Intergenic
932013471 2:68000813-68000835 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
939192413 2:138931891-138931913 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
940410731 2:153360580-153360602 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
946247701 2:218396896-218396918 GTCTCCCGCCGCTGGAGTGTGGG - Intergenic
948601815 2:239111750-239111772 GTCTCCCGCCCCTGGGCTGCAGG + Intronic
1168924378 20:1567155-1567177 ATCTATAGCCGCTGGAGTGTTGG + Intronic
1169695763 20:8385309-8385331 GTCTGCCACAGCTGGTGTGTTGG + Intronic
1170496602 20:16930997-16931019 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
1174534670 20:51241697-51241719 CTCTCCCACCCCTGGACTGTGGG + Intergenic
1174786798 20:53440606-53440628 GTTTCTCCCCACTGGAGTGTTGG - Intronic
1177511375 21:22091821-22091843 GTCTTCCACAGCTGGTGTGTTGG + Intergenic
1180432082 22:15262496-15262518 GTCTCCAGCTGCAGGAGAGTGGG - Intergenic
1180859259 22:19067920-19067942 GTCACCCAGCGCTGGAGTGGTGG - Intronic
1181024005 22:20117476-20117498 GTTTCCCGCCGCTGGGGTCAGGG + Intronic
1181695339 22:24590099-24590121 GCCACCCGCCACTGGACTGTTGG - Intronic
1183672979 22:39283724-39283746 GTGTCCAGCCGCTGGAACGTGGG + Intergenic
953129955 3:40128302-40128324 GTCTGCCACCACTGGACTGTAGG - Intronic
956975706 3:74576022-74576044 GTCTGCCTCCTGTGGAGTGTTGG + Intergenic
960602132 3:119469011-119469033 GTCTGCCGGCGATGGAGTGGTGG + Exonic
962592729 3:136907203-136907225 GTCCCCCTCTGCTGCAGTGTAGG + Intronic
969099993 4:4761693-4761715 CTCTCCCCCTGCTGGGGTGTGGG - Intergenic
987988571 5:25181222-25181244 GTCTGCCACAGCTGGTGTGTTGG + Intergenic
994000491 5:94773510-94773532 GTCTCCCTCCCCTTGAGTGTGGG + Intronic
995594212 5:113731015-113731037 GTCTGCCACAGCTGGTGTGTTGG + Intergenic
996082262 5:119268954-119268976 CTCTCCCGCCGCTGGGCTGCGGG + Intronic
998459765 5:142301242-142301264 TTCTCCCTCCCCTTGAGTGTAGG - Intergenic
998788827 5:145744036-145744058 GTCTGCCACAGCTGGTGTGTTGG - Intronic
1002874479 6:1199526-1199548 GTCTCTCTCCACTGGAGGGTAGG - Intergenic
1003849018 6:10202939-10202961 GTCTGCCACCACTGGACTGTAGG + Intronic
1004797020 6:19097917-19097939 GTCTGCCTACTCTGGAGTGTAGG + Intergenic
1008244244 6:49150747-49150769 GTCTGCCACAGCTGGTGTGTTGG + Intergenic
1012350785 6:98247930-98247952 GTCTCCTGCAGCAGGAGTGAAGG - Intergenic
1016311613 6:142739395-142739417 GTATCAAGCCGCTGAAGTGTTGG + Intergenic
1019334030 7:474481-474503 GTCTCAGGGTGCTGGAGTGTGGG - Intergenic
1020525262 7:9251178-9251200 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
1020637292 7:10712527-10712549 CTCTCCCGACTCTGGAGAGTTGG + Intergenic
1021828129 7:24573997-24574019 GACTCCCGCCGCAGAGGTGTAGG - Intronic
1023207496 7:37766528-37766550 GTCACCTGCTGCTGGAGTCTGGG + Intronic
1024099499 7:46015763-46015785 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
1028132419 7:87191761-87191783 GTTTCCTGCAGCTGAAGTGTAGG + Intronic
1031804588 7:126292711-126292733 GACTGCCACCGCTGGTGTGTTGG - Intergenic
1035757501 8:2045084-2045106 GCCTTCCTCGGCTGGAGTGTGGG + Exonic
1038073694 8:24046429-24046451 GTCTCCCACAGCCGGTGTGTTGG - Intergenic
1040959770 8:53019274-53019296 GTCTGCCACAGCTGGTGTGTTGG - Intergenic
1048574239 8:135678471-135678493 GTCTTCCTCCACTGGACTGTGGG + Intergenic
1048587711 8:135790625-135790647 GTCTGCCACAGCTGGTGTGTTGG + Intergenic
1056718485 9:89053532-89053554 GTCTCCCTGCCCTGGAGTCTGGG - Intronic
1056831936 9:89924293-89924315 ATTTCCCGCCCCTTGAGTGTGGG - Intergenic
1061943178 9:133893839-133893861 GACTCTCGCCGCTGCTGTGTGGG - Intronic
1062499957 9:136848063-136848085 GCCTCCAGCCGCTGCAGTCTGGG + Exonic
1192980171 X:76330733-76330755 GTCTTCCACTGCTGGTGTGTTGG - Intergenic
1194489682 X:94530745-94530767 GACTCCCACAGCTGGTGTGTTGG - Intergenic
1197768197 X:130072470-130072492 GTCTCCCAGCGCTGGAGAGACGG + Intronic