ID: 946250325

View in Genome Browser
Species Human (GRCh38)
Location 2:218407424-218407446
Sequence CATGGAAGGCGGGTGAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946250325 Original CRISPR CATGGAAGGCGGGTGAGGAC AGG Intergenic
900156847 1:1206615-1206637 CGGGCAGGGCGGGTGAGGACGGG - Intronic
900609280 1:3537612-3537634 CACGGAAGGCGGGAGAAGGCGGG + Intronic
901058984 1:6463004-6463026 GAGGGGAGGCGGGTGAGGAGGGG - Intronic
902077621 1:13800478-13800500 CATTGGAGGTGGGTGAGGATGGG + Intronic
903165136 1:21514946-21514968 CAGGGAAGGGAGGAGAGGACAGG + Intronic
903396265 1:23003921-23003943 CACGGAGTGAGGGTGAGGACAGG + Intergenic
903853510 1:26322001-26322023 TATGGGAGCCGGATGAGGACAGG - Exonic
904323274 1:29710450-29710472 CCTGGCAGCCCGGTGAGGACAGG - Intergenic
904331065 1:29758076-29758098 AGGGGAAGGCAGGTGAGGACGGG + Intergenic
904378048 1:30094124-30094146 CATGCGAGGCGGTTGAGGCCAGG + Intergenic
904393729 1:30204114-30204136 CACGGAGTGAGGGTGAGGACAGG - Intergenic
904751124 1:32741935-32741957 CATGGCAGGCGGGGGCGGAGCGG - Exonic
905587957 1:39136379-39136401 CATGGGTGGAGGGTGAGGAGAGG + Intronic
905732112 1:40304465-40304487 CAGGGAAGGCAGGTGAGTGCAGG - Exonic
906049277 1:42857202-42857224 CATGAAGTGAGGGTGAGGACAGG - Intergenic
906367698 1:45224466-45224488 CAAGGCAGGCGGCTGAGGTCAGG - Intronic
906378489 1:45316398-45316420 CATGGAGTGAGGGCGAGGACAGG - Intergenic
907528200 1:55066565-55066587 CAGGGAAGGTGGGGCAGGACAGG + Exonic
909349067 1:74627361-74627383 CATGGAAGGCAAGAGAGGAGAGG + Intronic
909729158 1:78872669-78872691 CATGGAGTGAGGGTGAGGACAGG - Intergenic
909860132 1:80594395-80594417 CATGGGAGCTGGGTGAGGCCTGG + Intergenic
910203873 1:84727740-84727762 AGTGGAAGGAGGATGAGGACTGG - Intergenic
915367614 1:155324501-155324523 CCTGTAGGGCGGGAGAGGACGGG - Intronic
915515310 1:156409318-156409340 GATGGAAGGCTGGAGAGGCCTGG + Intronic
916324664 1:163543555-163543577 AATAGAAGGCTGGTGAGGTCTGG - Intergenic
917472348 1:175336640-175336662 CATGGGAGGAGGGTGGTGACAGG + Intronic
918994529 1:191739682-191739704 CATGGGAGTCAAGTGAGGACAGG - Intergenic
919400314 1:197107381-197107403 CATGGAAGGCTGATGAGAACAGG + Intronic
919617311 1:199823703-199823725 AAAGGAAGGCGATTGAGGACAGG - Intergenic
920427566 1:205890247-205890269 CATGGAGTGAGGGTGAGGACAGG + Intergenic
920907779 1:210188070-210188092 CACGGAGTGAGGGTGAGGACCGG - Intergenic
921236646 1:213138491-213138513 GGTGGGAGGAGGGTGAGGACTGG - Intronic
921583016 1:216916736-216916758 CATGAGAGGAGGGTGAGGAGTGG - Intronic
922323088 1:224504556-224504578 CATGGAAGGCAGGTGGGTACAGG - Intronic
922648682 1:227318380-227318402 GAGGGAAGGCGGGGGAGGGCTGG - Exonic
922845695 1:228682281-228682303 CACGGAGTGAGGGTGAGGACAGG + Intergenic
922942337 1:229478433-229478455 CATGGAAGGCTGGGGAGAACTGG + Intronic
1063106652 10:2998002-2998024 CATGGAGTGAGGGTGAGGACAGG + Intergenic
1064202815 10:13299409-13299431 GAAGGACAGCGGGTGAGGACTGG - Intronic
1065828705 10:29595385-29595407 TATGGATGGCAGGTGAGGACAGG + Intronic
1066437590 10:35408222-35408244 CACGGAGTGAGGGTGAGGACAGG + Intronic
1066448006 10:35501428-35501450 CCTGGCAGGTGGATGAGGACTGG - Intronic
1068610643 10:59056571-59056593 CATGGACGGGGGGTGGGGGCGGG - Intergenic
1069859802 10:71463362-71463384 CTTGGCAGCCGGGTGCGGACAGG - Intronic
1073064260 10:100749028-100749050 CAAGGAAGGCGGATGAGGCAGGG - Intronic
1074278285 10:112025499-112025521 CATGGAAGGAAGGTGAGGACTGG + Intergenic
1074406058 10:113181136-113181158 AATGGCAGGGGGGTGAGGAGGGG - Intergenic
1074705915 10:116131741-116131763 CAGGGAATGGGGGTGAGGATTGG + Intronic
1076591255 10:131585101-131585123 CCTGAAAGCAGGGTGAGGACAGG - Intergenic
1076668560 10:132106451-132106473 CATGGCAGGAGGGGGAGGAACGG - Intronic
1076738384 10:132468627-132468649 GATGGAAGGCGGGGGAGGGGAGG + Intergenic
1076823786 10:132957178-132957200 CAAGGAGGGCAGCTGAGGACAGG - Intergenic
1077174390 11:1182022-1182044 CAGGGACCGCGGGTGGGGACAGG + Intronic
1079512545 11:21228515-21228537 CAGGGAAGGCTGGCGAGCACAGG - Intronic
1081159371 11:39734606-39734628 CATGGAATGAGGGTGAGGATAGG - Intergenic
1083293648 11:61703542-61703564 CCTGGGAGGCTGGTGAGGGCAGG + Intronic
1083751952 11:64765917-64765939 CATGGGAGGCGGAGGAGGAGGGG + Intronic
1084516467 11:69640552-69640574 CATGCAAGGACGGGGAGGACCGG - Intergenic
1084564286 11:69920558-69920580 CATGGAAGCCGGCTGGGGAGAGG - Intergenic
1085009679 11:73129729-73129751 CATGGACTGCGGGTGGGGTCAGG - Intronic
1086120395 11:83299565-83299587 CATGGAAAGGAGGTGAGGGCAGG + Intergenic
1088034138 11:105291233-105291255 CAGGGATAGCGGGTGGGGACAGG + Intergenic
1088811480 11:113395546-113395568 GAAGGAAGGAGGGTGAGGAGAGG - Intronic
1090772769 11:129936031-129936053 CATGGAAGGAGGGAGAGAAGGGG + Intronic
1091231197 11:133988986-133989008 CAGAGAAGGCGGGTGAGCTCAGG - Intergenic
1093302003 12:17470363-17470385 CACGGAGTGAGGGTGAGGACAGG - Intergenic
1094146514 12:27234020-27234042 CATGGATTGCGGGTAAGGGCCGG + Intergenic
1094236769 12:28177150-28177172 CATGGAAGAAGGTTGAGGAAGGG + Intronic
1097029581 12:56081294-56081316 CATGGGAGTCGGGGGAGGACTGG - Intronic
1099129682 12:78811490-78811512 CATGGGGGGCGGGGGAGGAAGGG + Intergenic
1100420706 12:94430076-94430098 CATGGGGGGTGGGTGAGGCCAGG - Intronic
1102117035 12:110410630-110410652 CATGGAGTGAGGGTGAGGACAGG + Intergenic
1102520648 12:113475931-113475953 GATCGAAGTCGGGAGAGGACGGG - Intergenic
1102604190 12:114056223-114056245 CATGGAGTGAGAGTGAGGACAGG - Intergenic
1104169351 12:126265037-126265059 ACAGGAAGGCAGGTGAGGACGGG + Intergenic
1104445367 12:128828804-128828826 CATGGGAAGCTGGTGGGGACAGG - Intergenic
1104759684 12:131289438-131289460 CAGGGGAGGCGGGTGGGGAAGGG + Intergenic
1104821029 12:131677775-131677797 CAGGGGAGGCGGGTGGGGAAGGG - Intergenic
1107040098 13:35938875-35938897 AAAGGAAGGCCTGTGAGGACCGG + Intronic
1107212064 13:37869804-37869826 CATGGGAGGCGGGGGAGGGGCGG + Exonic
1107768284 13:43761128-43761150 CCTGGAAGGAGAATGAGGACAGG - Intronic
1110540444 13:76701258-76701280 CAAGGAAGGGGAGTGAGGACTGG + Intergenic
1112401932 13:99085821-99085843 CATGGAAGGAGAGGGAGGCCGGG + Intronic
1113435209 13:110286082-110286104 CCTGGAAGGAGGGAAAGGACTGG + Intronic
1113930090 13:113963593-113963615 CAAGGACTGCGGCTGAGGACAGG - Intergenic
1114206699 14:20578869-20578891 CATGGAAGTTGGATGAGGAAGGG + Intergenic
1117912920 14:60651628-60651650 CATGGCAGCTGTGTGAGGACCGG + Intronic
1118050265 14:62018795-62018817 CATGGAAAGGGGATGGGGACAGG - Intronic
1118434061 14:65753542-65753564 CATGAAGGGTGGGTGAGGAAGGG - Intergenic
1119248632 14:73133590-73133612 CATGCAGTGAGGGTGAGGACAGG + Intergenic
1121249405 14:92488547-92488569 CAAGGAAAGCTGGTGAGCACCGG + Intronic
1121249427 14:92488699-92488721 CAAGGAAAGCTGGTGAGCACCGG + Intronic
1121266602 14:92607251-92607273 CATTAAAGGCTGGTGAGGATGGG + Intronic
1121274381 14:92657732-92657754 CGTGGAAGGAGGGTCAGGAACGG + Intronic
1121437679 14:93929747-93929769 AAAGGAAGGAGGGTGAGGAGGGG + Intergenic
1121439327 14:93939021-93939043 CATGGGAGGCGGGCGGGGCCGGG - Intronic
1121817585 14:96940315-96940337 CAGTGAAGGAGAGTGAGGACAGG + Intergenic
1122156012 14:99750860-99750882 CATGGAAGGCTGGGGTGGCCTGG + Intronic
1122857551 14:104567178-104567200 CAAGGAAGCCGGGTGCGGGCAGG - Intronic
1123007116 14:105329290-105329312 CAAGGAAGCCGGGAGAAGACGGG - Intronic
1123031308 14:105452878-105452900 CAGGGAAAGCGGGTAAGGGCTGG + Intronic
1123419630 15:20121005-20121027 CAGGGAGGGAGGGAGAGGACAGG + Intergenic
1123446234 15:20332531-20332553 CAGGGAGGGAGGGAGAGGACAGG - Intergenic
1123528853 15:21127541-21127563 CAGGGAGGGAGGGAGAGGACAGG + Intergenic
1125628915 15:41131866-41131888 CATGGAGTGAGGGCGAGGACAGG - Intergenic
1125848847 15:42885235-42885257 CACGGAGTGAGGGTGAGGACAGG - Intronic
1126145396 15:45468822-45468844 CTTGGAAAGCTGGTGAGGCCAGG + Intergenic
1128600067 15:68988615-68988637 CACGGAGTGAGGGTGAGGACAGG - Intronic
1128980726 15:72183919-72183941 CAGGGATGGATGGTGAGGACAGG + Intronic
1130997602 15:88912579-88912601 CCTGGGAGGCGGAGGAGGACCGG + Intronic
1131306857 15:91252587-91252609 CATGGAATAAGGCTGAGGACAGG - Intronic
1131636415 15:94237406-94237428 CATTGAAAGCAGTTGAGGACAGG + Intronic
1133087123 16:3373535-3373557 AGTGGGAGGAGGGTGAGGACTGG - Intronic
1136288328 16:29257298-29257320 GATGGAGAGCGGATGAGGACCGG - Intergenic
1139506195 16:67399258-67399280 CATGGCAGGCGGGCGGGGATGGG - Intronic
1139649148 16:68353451-68353473 CCTGGCGGGCGGGTGTGGACGGG + Intronic
1142267574 16:89071525-89071547 CAGGGCAGCCGGGTGAGCACTGG + Intergenic
1142343033 16:89536520-89536542 CAGGTGAGGCGGGTGAGGTCAGG + Intronic
1144846869 17:18224771-18224793 CCTGGGAGGTGGGTGGGGACAGG + Intergenic
1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG + Intronic
1146629300 17:34458512-34458534 CAGGGAAGGCGGGTGAGGGGAGG - Intergenic
1147042952 17:37731949-37731971 AATGGAAGGCTGGGGAGGAGAGG + Intronic
1147336750 17:39730684-39730706 CAGGGAAGGAGGGTCTGGACCGG - Exonic
1148437384 17:47694586-47694608 AATGGAAGGCGGCTGGGGAAGGG - Intronic
1148492453 17:48032145-48032167 TGTGGATGGCGGGTGAGGAGGGG - Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149543954 17:57489333-57489355 GATGGAAGGGGAGTGAGGGCTGG + Intronic
1149685307 17:58531559-58531581 CAGGGTAGGTGGGTGAGGAGGGG + Intronic
1151414555 17:73952843-73952865 CCAGGACGGCGGGAGAGGACGGG + Intergenic
1151769432 17:76150364-76150386 CATGGGAGGAGAGTGAGGACTGG - Intronic
1152453661 17:80400290-80400312 CATGGAGTGAGGATGAGGACAGG - Intergenic
1155246439 18:23914583-23914605 CATGGAAGTTTGGTGAGCACAGG - Intronic
1156308017 18:35897199-35897221 CAGGGCAGGTGGGTGAGGAGTGG - Intergenic
1156450690 18:37264696-37264718 CATTGGAGGCGGCTGAGGAAAGG + Exonic
1158970549 18:62662436-62662458 CCTGGAAGGGGGCTGAGGAAAGG + Intergenic
1162247078 19:9410407-9410429 CTTGGAATCTGGGTGAGGACAGG - Intergenic
1162261768 19:9539818-9539840 CACGGAGTGAGGGTGAGGACGGG - Intergenic
1163177842 19:15576935-15576957 CATGGAAGGTGCTTGAGGAAAGG + Intergenic
1163187660 19:15650283-15650305 CATGGAAGGTGATTGAGGAAGGG + Intronic
1163217141 19:15889301-15889323 CATGGAAGGTGATTGAGGAAGGG - Intronic
1163727980 19:18933188-18933210 CATGGAGGGTGGGTGAGGTGGGG - Intronic
1163766383 19:19165648-19165670 CATGGAAGGTGTGTGAGGAGGGG + Intronic
1164080573 19:21858560-21858582 CATGGAGTGAGGGTGAGTACAGG - Intergenic
1164219099 19:23177439-23177461 CATGGAGTGAGGGTGAGGACAGG - Intergenic
1164258526 19:23549956-23549978 CATGGAGTGAGGGTGAGGACAGG - Intronic
1166369889 19:42294825-42294847 CCTGGAAGGCGGCTGTGGCCTGG - Exonic
1166568229 19:43777979-43778001 CATAGAAGGTGGGGGAGGGCTGG - Intronic
1166906033 19:46109012-46109034 CATGGAGTGAGGGTGAGGACAGG + Intergenic
1166917100 19:46202904-46202926 CATGGAGAGAGGGCGAGGACAGG + Intergenic
1167278332 19:48552233-48552255 CATGGCAGGTGGGTGAGGGTGGG - Exonic
1167315560 19:48761091-48761113 CATGGCGGGCGGGTGGGAACCGG - Intergenic
1167436322 19:49480687-49480709 CATGGAAGGGTGGTGAGCAGTGG + Intronic
1168115633 19:54220216-54220238 CACGGGAGGCGGGTGAGGGGCGG + Intronic
1168118620 19:54239962-54239984 CACGGGAGGCGGGTGAGGGGCGG + Intronic
925466725 2:4112521-4112543 CATGGCAGGAGGGAGAGGGCAGG - Intergenic
925587071 2:5474951-5474973 CAGGGCAGGCGGGTGTGGGCGGG - Intergenic
925780194 2:7375040-7375062 CATGAAAGACAGGTGAGGCCTGG - Intergenic
926117814 2:10224462-10224484 CATGAAAGGAGGCAGAGGACCGG - Intergenic
926217876 2:10916146-10916168 CAGGGAGGGCGGGAGAGGCCAGG + Intergenic
928166100 2:28973244-28973266 TAAGGCAGGCAGGTGAGGACAGG - Intronic
928392349 2:30919343-30919365 AAGGGAAGGCAGGTGAGGAATGG + Intronic
928511651 2:32009690-32009712 CAGGGAAGACGGGAGAGGAAAGG + Intronic
929635574 2:43517645-43517667 CATGGAAGCGGGGAGGGGACTGG - Intronic
929684820 2:44024352-44024374 CATGGAGTGAGGGTGAGGACAGG + Intergenic
930237336 2:48900621-48900643 CATGGAAGGAGGGAGAGGCTGGG + Intergenic
932726196 2:74181888-74181910 GATGAAAGGCGGGTGGGGAGAGG - Intergenic
933832460 2:86221957-86221979 CATGGAAGTGGGGTGGGTACCGG + Intronic
935241018 2:101178335-101178357 CACGGAGTGAGGGTGAGGACCGG + Intronic
936544115 2:113375346-113375368 CATGGAATGGAGGTGGGGACAGG - Intergenic
937322704 2:120970498-120970520 CCAGGAAGGTGGGTGAGGGCTGG - Exonic
940174012 2:150859311-150859333 CATGGGAGGAGGGGGAGAACTGG - Intergenic
946250325 2:218407424-218407446 CATGGAAGGCGGGTGAGGACAGG + Intergenic
946264352 2:218525827-218525849 GATGGAAGGAGGGAGAGGATTGG - Intronic
1168839042 20:897279-897301 CATGGAATGAGGGCAAGGACAGG - Intronic
1170668696 20:18409772-18409794 CAAAGAAGGTGGGTGAGGCCAGG + Intronic
1171290902 20:23982338-23982360 CTTGGGAGTCGGGTGGGGACGGG - Intergenic
1171726123 20:28622531-28622553 CAGGGTAGGCGGGTGAGGTGGGG + Intergenic
1171752007 20:29060845-29060867 CAGGGTAGGCGGGTGAGGTGGGG - Intergenic
1171790324 20:29517018-29517040 CAGGGTAGGCGGGTGAGGTGGGG + Intergenic
1173651740 20:44670741-44670763 CACGGAGTGAGGGTGAGGACAGG - Intergenic
1173900787 20:46587424-46587446 GAAGGAAAGCGGGTGAGGAAAGG - Intronic
1173961485 20:47075835-47075857 GATGGAAGGAAGGTGAGGACTGG - Intronic
1174736953 20:52973468-52973490 CAGAGAAGGCGAGAGAGGACGGG - Intronic
1174796855 20:53529393-53529415 CATGGAAGTGGGGTGAGGGTGGG + Intergenic
1175334049 20:58183695-58183717 CATGGAGAGACGGTGAGGACAGG - Intergenic
1175777122 20:61660430-61660452 CATCGAAGGCAGGTGACGCCGGG + Intronic
1175925674 20:62470213-62470235 CAAGGAAGGCGGGAGAGGGAAGG + Intronic
1177312421 21:19414121-19414143 CATGGAAGGCGAGAGAGAAGGGG - Intergenic
1178879891 21:36441054-36441076 CATGGCAGGGGGGTGGGGGCGGG - Intergenic
1179168213 21:38951967-38951989 CATCGAAGGAGAGAGAGGACAGG + Intergenic
1179203470 21:39249211-39249233 CGTGGAAAAAGGGTGAGGACCGG + Intronic
1179296268 21:40065651-40065673 CCTGGAAGGCAGGAGAGTACTGG - Intronic
1180391028 22:12282139-12282161 CAGGGTAGGCGGGTGAGGTGGGG + Intergenic
1180408714 22:12582618-12582640 CAGGGTAGGCGGGTGAGGTGGGG - Intergenic
1181703035 22:24631661-24631683 CTTGGGAGTCGGGTGGGGACGGG + Intergenic
1184678315 22:46055219-46055241 CATGGAAGGCGGGTGTGGCCTGG + Intronic
1185245613 22:49771340-49771362 CCTGGACGGCGGGCGAGGCCAGG + Intergenic
949549906 3:5104157-5104179 CATCGAAGGAGGAAGAGGACTGG - Intergenic
951894625 3:27599483-27599505 CACGGAATGAGGGCGAGGACAGG - Intergenic
952159637 3:30680907-30680929 TGTGGAAGGCGGGTGAAGGCGGG + Intronic
952379881 3:32796389-32796411 CACGGAGTGAGGGTGAGGACAGG + Intergenic
953834682 3:46332346-46332368 CACGGAATGAGGGTGAGGACAGG + Intergenic
953841428 3:46392892-46392914 CATGGAGTGAGGGTGAGGAGAGG + Intergenic
954808915 3:53236091-53236113 CATGCAAGTAGGGTGAGGAGTGG + Intronic
955503875 3:59611902-59611924 CATGGAAGGCTGGTGATAACAGG + Intergenic
957155335 3:76537607-76537629 CATGGAGAGAGGGTGAGGACAGG + Intronic
957417837 3:79929304-79929326 CATGGAAGGAGGCTGAGGGGTGG + Intergenic
959493004 3:107014145-107014167 TATGGATGGAGGGTGAGGATTGG + Intergenic
960167699 3:114422415-114422437 CATGTAAGGCGGGTAACGTCCGG - Intronic
962524257 3:136223213-136223235 CATGGAGTGAGGGTGAGGACAGG + Intergenic
962807942 3:138939962-138939984 CGAGGGAGGCGCGTGAGGACTGG + Intergenic
963035288 3:141020377-141020399 CAAGGAAGGAGGCTGAGGCCTGG - Intergenic
963897919 3:150705574-150705596 CAGGAAAGGAGGGTCAGGACAGG + Intergenic
964176412 3:153828907-153828929 CATGGAGTGAGGGTGAGGACAGG + Intergenic
966398686 3:179525888-179525910 CATGGAGTGAGGGTGAGGACAGG + Intergenic
966914045 3:184575284-184575306 CAGGGATGGGGGCTGAGGACGGG - Intronic
967005605 3:185379530-185379552 CATGGAGTGAGGGTGAGGACAGG + Intronic
967943302 3:194782940-194782962 CACGGAGGGGGCGTGAGGACTGG - Intergenic
968843619 4:3026704-3026726 CCTGGGAGGCGGGAGAGCACAGG - Intronic
971374761 4:26048017-26048039 CCTGGAAGCCGAGTGTGGACTGG + Intergenic
972817205 4:42657208-42657230 CAAGGAAGGCGGGTGAGGGGCGG + Intergenic
974069586 4:57111204-57111226 CCTGGAATGCTGGTGAAGACTGG - Intergenic
978201983 4:106032979-106033001 CATGGGAGAGGGGTGAGGCCTGG - Intergenic
981527729 4:145723108-145723130 CATGGAAGGTGGGTGGGCAGGGG - Intronic
983435786 4:167713301-167713323 CATGAATGGCAGGTGAGGATGGG - Intergenic
983792168 4:171812786-171812808 CGTGCAAGGCGGGGGAGGAGCGG + Intronic
984007054 4:174324671-174324693 CATGGAAGGAGAGTGAGGAGGGG - Intronic
984321269 4:178199298-178199320 CATGGAAGGCTAGAGAGGGCTGG - Intergenic
989096751 5:37788935-37788957 CATGCAAGGGGGCTGAGGAGAGG - Intergenic
990247030 5:53873421-53873443 CATGGAAGGAAGGGGAAGACAGG - Intergenic
990565364 5:57021996-57022018 CATGGAGTGAGGGTGAGGACAGG + Intergenic
991021430 5:61983668-61983690 CAAGGTAAGAGGGTGAGGACTGG + Intergenic
994324594 5:98435003-98435025 CATGGAGTGAGGGTGAGGACAGG - Intergenic
994376076 5:99016451-99016473 CACGGAGTGAGGGTGAGGACAGG + Intergenic
995847912 5:116513761-116513783 CATGGAAGGAGGGAGAGCATCGG - Intronic
996486819 5:124044885-124044907 CATGGAAGTGGGCTGAGGATTGG + Intergenic
996726167 5:126674889-126674911 CATGGAGTGAGGGCGAGGACAGG + Intergenic
997111496 5:131079777-131079799 CATGAAAGGCTGGAGAGGGCTGG - Intergenic
997157008 5:131572213-131572235 CACGGAGGGAGCGTGAGGACAGG - Intronic
997885360 5:137625267-137625289 CATGAAAGACTGGTGAGAACTGG - Intronic
997980676 5:138465826-138465848 CATGGTGGGCGAGTGAGGAAAGG - Exonic
1000617982 5:163451110-163451132 TATGGATGGCGGGGGATGACAGG + Exonic
1001354749 5:171008342-171008364 CACGGAGTGAGGGTGAGGACAGG + Intronic
1001685742 5:173593620-173593642 AAGGGAAGGAGAGTGAGGACTGG - Intergenic
1004924313 6:20403239-20403261 GCTGGAAGCCGGGTGCGGACTGG + Intronic
1005786818 6:29252295-29252317 CACGGAGTGAGGGTGAGGACAGG + Intergenic
1005898060 6:30195240-30195262 CATGGCAGGGGCGTGAGGAGAGG + Intronic
1009269557 6:61600686-61600708 CATGGAGTGAGGGTGAGGGCAGG - Intergenic
1010035409 6:71320059-71320081 TATGGAAGGTGGGTGAGACCTGG - Intergenic
1013161565 6:107550020-107550042 CCTGGAAGGCCAGTGGGGACAGG + Intronic
1014115580 6:117664701-117664723 CACGGAGTGAGGGTGAGGACAGG + Intergenic
1017266619 6:152453571-152453593 AATGGAAGGTGAGTCAGGACAGG - Exonic
1017269558 6:152490794-152490816 CATGGAGTGAGGGTGAGGACAGG - Intronic
1017894577 6:158668178-158668200 CCTAGCAGGCGGGAGAGGACTGG - Intronic
1018560080 6:165092951-165092973 CATGGAGGTGGGGAGAGGACAGG + Intergenic
1018689553 6:166333697-166333719 CATGGGGGGCTGATGAGGACTGG - Intronic
1019155299 6:170034430-170034452 CATGTAGGGAGGGTGAGGTCGGG + Intergenic
1019415635 7:925480-925502 CCTGGAAGGCGGGTGGGGGTTGG - Intronic
1020793957 7:12660270-12660292 CACGGAGTGAGGGTGAGGACAGG - Intergenic
1021027391 7:15686312-15686334 CATGGAGGGCGAGAGAGGATTGG + Exonic
1021612590 7:22472769-22472791 CAGGGAAGGAGGGGGAGGATGGG - Intronic
1021660378 7:22913879-22913901 CATGGAGTGAGGGTGAGGACAGG - Intergenic
1023038935 7:36155191-36155213 CCTGGAAAACAGGTGAGGACAGG + Exonic
1024579087 7:50787566-50787588 CAGGGACGGTGGGTCAGGACAGG + Intronic
1024972257 7:55081513-55081535 GATGGCAGGTGGCTGAGGACAGG - Intronic
1026071884 7:67129116-67129138 CATGGAAGGCCGGTGCTGGCTGG + Intronic
1027157989 7:75781986-75782008 CATGGAGTGAGGGTGAGGACAGG - Intronic
1029316848 7:99723625-99723647 CATGGAGTGAGGGCGAGGACAGG - Intronic
1031613790 7:123857161-123857183 CCTGGAAAGGGGGTGAAGACAGG - Intronic
1033084479 7:138329737-138329759 CACGGAGTGAGGGTGAGGACAGG - Intergenic
1033625347 7:143105553-143105575 CATGGAGTGAGGGCGAGGACAGG - Intergenic
1034178163 7:149116720-149116742 CACAGAAGGCTGGTGAGGAAGGG - Intronic
1035455730 7:159007432-159007454 CATGGAGGGCGGGTGCAGAGGGG + Intergenic
1036549386 8:9803393-9803415 CATGGAGTGAGGGCGAGGACAGG - Intergenic
1037724778 8:21474129-21474151 GATGGAAGCCCCGTGAGGACAGG + Intergenic
1039702709 8:39978536-39978558 CATGGAGGGCGGGGGTGGAGGGG + Intronic
1041720017 8:60967343-60967365 CAAAGATGGCTGGTGAGGACAGG + Intergenic
1043597686 8:81903495-81903517 CATGGAGTGAGGGTGAGGACAGG + Intergenic
1043943167 8:86219518-86219540 AATGGGAGGCTGGTGAGGAGAGG - Intronic
1045594950 8:103643831-103643853 CATTGAAGGCTAGAGAGGACTGG + Intronic
1046246989 8:111577044-111577066 CAGGCAAAGGGGGTGAGGACAGG - Intergenic
1048985565 8:139732964-139732986 CAAGGAAGGAGGCTGAGGTCAGG + Intronic
1049632322 8:143665468-143665490 ATTGTAAGGCGGGTGGGGACAGG + Intergenic
1050913391 9:11102192-11102214 CACGGAGTGAGGGTGAGGACAGG + Intergenic
1053060201 9:35024599-35024621 CATGGAGTGAGGGTGAGGACAGG + Intergenic
1053078693 9:35156163-35156185 CATGGAGTGATGGTGAGGACAGG + Intergenic
1055292961 9:74802962-74802984 CTTGGAAGGTGGGTGGGGAGGGG - Intronic
1056261407 9:84852366-84852388 CAGGGAAGGCAGGTGATGTCTGG - Intronic
1056363477 9:85881415-85881437 CATGGAGTGATGGTGAGGACAGG - Intergenic
1056391646 9:86146565-86146587 CATGGAGTGAGGGTGAGGACAGG - Intergenic
1057197325 9:93122261-93122283 CCTGGAAGGAGGGAGAGGAGAGG + Intronic
1057197332 9:93122291-93122313 CCTGGAAGGAGGGAGAGGAGAGG + Intronic
1057197340 9:93122321-93122343 CCTGGAAGGAGGGAGAGGAGAGG + Intronic
1057197348 9:93122351-93122373 CCTGGAAGGAGGGAGAGGAGAGG + Intronic
1057197373 9:93122442-93122464 CCTGGAAGGAGGGAGAGGAGAGG + Intronic
1057197380 9:93122472-93122494 CCTGGAAGGAGGGAGAGGAGAGG + Intronic
1057218948 9:93245380-93245402 CATGGAAGTCAGGCGAGGAAAGG - Intronic
1057292445 9:93815295-93815317 CAGGGAAGGGAGGTGAGGAAGGG - Intergenic
1058784853 9:108376923-108376945 CCTGGAAGGGGAGAGAGGACTGG + Intergenic
1059129087 9:111725507-111725529 CAGGGAGGGCGGGGGAGGTCAGG + Intronic
1059349952 9:113657253-113657275 CAAGGCAGGCGGATGTGGACGGG - Intergenic
1059458002 9:114411977-114411999 CAGGGAATGAGGCTGAGGACAGG - Intronic
1061384730 9:130282542-130282564 CAGGGCAGGCGAGGGAGGACAGG + Intergenic
1061569081 9:131464974-131464996 CACGAAAGGCAGGTGAGGCCCGG + Exonic
1061750449 9:132773337-132773359 CCAGGAAGGCTGGAGAGGACAGG - Intronic
1186310439 X:8311916-8311938 GGTGGGAGGAGGGTGAGGACTGG + Intergenic
1187104006 X:16221801-16221823 CATGGAGTGAGGATGAGGACAGG + Intergenic
1188214149 X:27457856-27457878 CGTGGAAAGCGAGTGAGGAGAGG - Intergenic
1188890824 X:35609855-35609877 CATGGAGTGAGGGTGAGGACAGG - Intergenic
1189030369 X:37443199-37443221 CATGGACAGAAGGTGAGGACTGG + Intronic
1191014428 X:55793227-55793249 CACGGAGTGAGGGTGAGGACAGG + Intergenic
1192935135 X:75850933-75850955 CATGGCAGGAGGGTGTGGGCAGG + Intergenic
1193536820 X:82727247-82727269 CACGGAGTGAGGGTGAGGACAGG - Intergenic
1193995266 X:88359001-88359023 CATGGAAGGGGGGAGTGGAATGG + Intergenic
1195017196 X:100791430-100791452 CATGGAGTGAGGGCGAGGACAGG + Intergenic
1195571403 X:106401921-106401943 CATGGAGGATGGCTGAGGACTGG + Intergenic
1199326581 X:146505119-146505141 CAAGGAGTGCAGGTGAGGACTGG + Intergenic
1199770647 X:150973254-150973276 GATGGAAGGGAGGTGAGGGCAGG + Intergenic
1199846541 X:151695724-151695746 CAGCGAAGGTGGGCGAGGACAGG + Intronic
1200812574 Y:7501074-7501096 CATGGAGTGAGAGTGAGGACAGG - Intergenic
1201146527 Y:11067856-11067878 AATGGAAGGAGGGAGAGGAAGGG + Intergenic
1201540899 Y:15103553-15103575 CATGGAGTGAGGGAGAGGACAGG + Intergenic