ID: 946250694

View in Genome Browser
Species Human (GRCh38)
Location 2:218409893-218409915
Sequence GTATTTAACCAGTTCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946250694_946250697 21 Left 946250694 2:218409893-218409915 CCAATAAAGAACTGGTTAAATAC No data
Right 946250697 2:218409937-218409959 TAGTCGTGAAAACTATGAGGAGG No data
946250694_946250696 18 Left 946250694 2:218409893-218409915 CCAATAAAGAACTGGTTAAATAC No data
Right 946250696 2:218409934-218409956 ATGTAGTCGTGAAAACTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946250694 Original CRISPR GTATTTAACCAGTTCTTTAT TGG (reversed) Intergenic
No off target data available for this crispr