ID: 946250696

View in Genome Browser
Species Human (GRCh38)
Location 2:218409934-218409956
Sequence ATGTAGTCGTGAAAACTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946250694_946250696 18 Left 946250694 2:218409893-218409915 CCAATAAAGAACTGGTTAAATAC No data
Right 946250696 2:218409934-218409956 ATGTAGTCGTGAAAACTATGAGG No data
946250693_946250696 21 Left 946250693 2:218409890-218409912 CCACCAATAAAGAACTGGTTAAA No data
Right 946250696 2:218409934-218409956 ATGTAGTCGTGAAAACTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946250696 Original CRISPR ATGTAGTCGTGAAAACTATG AGG Intergenic
No off target data available for this crispr