ID: 946250697

View in Genome Browser
Species Human (GRCh38)
Location 2:218409937-218409959
Sequence TAGTCGTGAAAACTATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946250693_946250697 24 Left 946250693 2:218409890-218409912 CCACCAATAAAGAACTGGTTAAA No data
Right 946250697 2:218409937-218409959 TAGTCGTGAAAACTATGAGGAGG No data
946250694_946250697 21 Left 946250694 2:218409893-218409915 CCAATAAAGAACTGGTTAAATAC No data
Right 946250697 2:218409937-218409959 TAGTCGTGAAAACTATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946250697 Original CRISPR TAGTCGTGAAAACTATGAGG AGG Intergenic
No off target data available for this crispr