ID: 946263418

View in Genome Browser
Species Human (GRCh38)
Location 2:218516666-218516688
Sequence GGACACATGCAGAATGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946263418_946263421 17 Left 946263418 2:218516666-218516688 CCTTGCACATTCTGCATGTGTCC 0: 1
1: 1
2: 2
3: 34
4: 247
Right 946263421 2:218516706-218516728 TAAAATAAAATAAAAAAATCAGG 0: 1
1: 28
2: 273
3: 2580
4: 17348
946263418_946263422 18 Left 946263418 2:218516666-218516688 CCTTGCACATTCTGCATGTGTCC 0: 1
1: 1
2: 2
3: 34
4: 247
Right 946263422 2:218516707-218516729 AAAATAAAATAAAAAAATCAGGG 0: 1
1: 23
2: 442
3: 4585
4: 50859
946263418_946263424 30 Left 946263418 2:218516666-218516688 CCTTGCACATTCTGCATGTGTCC 0: 1
1: 1
2: 2
3: 34
4: 247
Right 946263424 2:218516719-218516741 AAAAATCAGGGTCTGGCACTAGG 0: 1
1: 0
2: 1
3: 11
4: 206
946263418_946263423 23 Left 946263418 2:218516666-218516688 CCTTGCACATTCTGCATGTGTCC 0: 1
1: 1
2: 2
3: 34
4: 247
Right 946263423 2:218516712-218516734 AAAATAAAAAAATCAGGGTCTGG 0: 1
1: 6
2: 53
3: 624
4: 4723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946263418 Original CRISPR GGACACATGCAGAATGTGCA AGG (reversed) Intronic
900028427 1:351632-351654 GAACACATGCAGTATGGACAAGG + Intergenic
900630037 1:3629993-3630015 GGCCACCTGCAGGATGTGCAGGG + Exonic
902579010 1:17396715-17396737 GGTCACAGGCAGAAAGTGCCAGG + Intronic
903498100 1:23785072-23785094 GGTCACATGCAGCAAATGCATGG - Intronic
904298981 1:29541975-29541997 GGACACATGGAAGATGTCCAGGG + Intergenic
905869103 1:41392875-41392897 GGACACATGTGGAAAGGGCATGG - Intergenic
906132395 1:43468497-43468519 GGACAAGTGCAGGATGAGCAAGG + Intergenic
906644208 1:47461920-47461942 AGCTACATGCAGAATGTTCAAGG - Intergenic
912179003 1:107195229-107195251 GGGCAGATGCAGAATGTACGTGG - Intronic
912951491 1:114123592-114123614 GGAAAGACGGAGAATGTGCAGGG - Intronic
914453218 1:147811602-147811624 GGACACATGCAGCCTCTTCAAGG - Intergenic
915287217 1:154860703-154860725 GGACACCTGCAGACAGTGGAGGG + Intronic
917906012 1:179587773-179587795 GATTACATGCAGAATGTCCATGG + Intergenic
920241984 1:204559298-204559320 GGTCACATACAAAATGTGAAAGG - Intergenic
921151041 1:212403410-212403432 GGACAGATGGAAAATGAGCAGGG - Intronic
921234550 1:213112597-213112619 GTACATGTGCACAATGTGCAGGG + Intronic
921371745 1:214430643-214430665 TGACAAATGCAAAATCTGCAGGG - Intronic
921666401 1:217877528-217877550 ATACATATGCAGGATGTGCAGGG - Intergenic
921889866 1:220343066-220343088 GAACACATGGAGAAGCTGCATGG - Intergenic
922517036 1:226215283-226215305 GTACAAATGCAGAATGTGCCAGG - Intergenic
924354574 1:243157913-243157935 GAACATATGCAGAAAGTTCATGG + Intronic
1063654899 10:7978696-7978718 GCCCATATGCAGAATTTGCATGG - Intronic
1063927744 10:10997125-10997147 TGACACATGCAGTACGTGGAAGG - Intergenic
1066930793 10:41755305-41755327 GTACATGTGCACAATGTGCAAGG - Intergenic
1067163674 10:43848049-43848071 AGACCCATGCAGAAGCTGCAAGG + Intergenic
1067802442 10:49368369-49368391 GCACACACGCACAGTGTGCAAGG + Intronic
1068897213 10:62219177-62219199 GGAGACAGGCAGAATGAGAATGG + Intronic
1071324608 10:84500338-84500360 GGACAGATGCATAATGTGTGGGG + Intronic
1072795558 10:98351890-98351912 AGACACATGCAGGCTATGCAGGG + Intergenic
1073659607 10:105460550-105460572 GTACATGTGCACAATGTGCAGGG + Intergenic
1073968961 10:109024837-109024859 GTACATGTGCAGAATGTGTAGGG - Intergenic
1076452930 10:130569296-130569318 GGACACATGTTCAATGTCCATGG - Intergenic
1076757185 10:132578742-132578764 GGACACCAGGAGAGTGTGCAGGG + Intronic
1080056434 11:27911436-27911458 TGACAGATGCTGAATGTCCAGGG + Intergenic
1081570212 11:44286127-44286149 TGACACAAGCAGTGTGTGCAGGG - Intronic
1083332459 11:61905326-61905348 GGCCACATGCAGAATGAGGGAGG + Intronic
1088107308 11:106221977-106221999 GGACACAAGAAAAATGAGCATGG + Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1090448816 11:126788181-126788203 GGACAAATGCACAATCTGGAAGG + Intronic
1090911575 11:131124263-131124285 GGACATATCCAGAATATACAAGG - Intergenic
1091203758 11:133803014-133803036 GGAGACATGCAGAAATTGAAGGG + Intergenic
1092156683 12:6287044-6287066 GGAAACAGGCAGCATGTACAAGG + Intergenic
1092512902 12:9176420-9176442 GTACAAGTGCAGAATGTGAAGGG - Intronic
1097640780 12:62178666-62178688 TGCCACATGCAGCATCTGCATGG - Intronic
1099336698 12:81369437-81369459 TGTAACATGCAGACTGTGCATGG + Intronic
1101958983 12:109233954-109233976 GGACACATTCAGAATGTGGATGG - Exonic
1103073956 12:117967637-117967659 GACCACCTGCAGAATGCGCAAGG + Intronic
1103613702 12:122139221-122139243 AGCCACTTGCAGAAGGTGCAGGG + Intronic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1105961303 13:25343357-25343379 GTACATGTGCACAATGTGCAGGG + Intronic
1105967390 13:25397162-25397184 GGACAACTGGAGAATGTGCTGGG - Intronic
1108832335 13:54495616-54495638 TGGCACATGAAGAATGGGCAGGG + Intergenic
1109572176 13:64207031-64207053 GGACAACTGCAGAGTGAGCAAGG + Intergenic
1111005106 13:82237033-82237055 AGCCACATCCAGCATGTGCAGGG - Intergenic
1112650908 13:101397266-101397288 TGATACATGCAGGATCTGCATGG - Intronic
1113050091 13:106201517-106201539 CGACACATTCAGAACGGGCATGG + Intergenic
1113717738 13:112525225-112525247 GGACAAAGGAATAATGTGCATGG - Intronic
1115131782 14:30062387-30062409 GGACACAGACAGAAAGTGAAGGG - Intronic
1115302847 14:31903695-31903717 GGACACAAGCAGAGCATGCAGGG - Intergenic
1118824200 14:69365746-69365768 GTACATGTGCAGGATGTGCAGGG - Intergenic
1121976592 14:98410159-98410181 GGACCCATGCAGAAGGTCTAGGG - Intergenic
1123668033 15:22624907-22624929 GGACACATGCAGCGTGTGAGGGG - Intergenic
1124524008 15:30431344-30431366 GGACACATGCAGTGTGTGAGGGG - Intergenic
1124534658 15:30534872-30534894 GGACACATGCAGTGTGTGAGGGG + Intergenic
1124763991 15:32472727-32472749 GGACACATGCAGTGTGTGAGGGG - Intergenic
1124774636 15:32576320-32576342 GGACACATGCAGTGTGTGAGGGG + Intergenic
1125418239 15:39475588-39475610 TGAGCCAGGCAGAATGTGCAAGG - Intergenic
1125822178 15:42641399-42641421 GTACATGTGCACAATGTGCAGGG + Intronic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1129258508 15:74348403-74348425 GGACACAGGAAGAATGCGCAAGG - Intronic
1129935946 15:79450348-79450370 GGACACCTACAGAATCTTCAAGG + Intronic
1132220225 15:100099814-100099836 AGAAACATGCAGAAAGTGCTTGG + Intronic
1132905296 16:2279322-2279344 GGACACAGGAAGGATGTGCCTGG + Intronic
1133477196 16:6134878-6134900 GTACATATGCACAACGTGCAGGG + Intronic
1134871693 16:17657733-17657755 GGATCCATGCACAATATGCAGGG - Intergenic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1139719520 16:68841270-68841292 GGACAGAACCTGAATGTGCAGGG + Intergenic
1140266326 16:73424423-73424445 GTACATATGCAGAAGGTGCAAGG - Intergenic
1141311015 16:82913309-82913331 CGGCTCATTCAGAATGTGCAGGG + Intronic
1203137880 16_KI270728v1_random:1740859-1740881 GTATATGTGCAGAATGTGCAGGG + Intergenic
1143270585 17:5672115-5672137 GGACACAGGCAGATTGAGCGGGG - Intergenic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1145723792 17:27098106-27098128 GTACATGTGCACAATGTGCAGGG + Intergenic
1146662825 17:34675957-34675979 GGACGAAAGCTGAATGTGCAGGG + Intergenic
1148763410 17:50021428-50021450 GCACATCTGCAGATTGTGCAAGG - Intergenic
1151125619 17:71841632-71841654 GCACAGATACAGAATGTGCACGG + Intergenic
1151198064 17:72445882-72445904 GGACAGAGGCAGTATGTGCCCGG - Intergenic
1152715495 17:81898405-81898427 GGAGACATGCTGAGTGTTCAGGG - Intronic
1153800419 18:8663339-8663361 GGACACAGACAGGAGGTGCAAGG + Intergenic
1155124694 18:22861060-22861082 TGACACATCCAGAATATACAAGG + Intronic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156565253 18:38181529-38181551 GGACAGCTACAGAGTGTGCATGG + Intergenic
1157503011 18:48203967-48203989 GGACTCATGCAGAATGGTCAAGG - Intronic
1158441700 18:57480241-57480263 GGAAACATGGAGTATGAGCAAGG - Exonic
1158906693 18:62019972-62019994 GGAGACAGTCAGAATGTGCAGGG + Intergenic
1160654388 19:255491-255513 GAACACATGCAGTATGGACAAGG + Intergenic
1162302858 19:9854112-9854134 GGACACAGGCAGAATGAAAAGGG + Exonic
1162707592 19:12566870-12566892 GTACATGTGCACAATGTGCAGGG - Intronic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
1163597658 19:18229728-18229750 GGAGTCAAGCAGAATGAGCAGGG + Intronic
1164342093 19:24413803-24413825 GTACATGTGCACAATGTGCAGGG + Intergenic
1164421080 19:28093432-28093454 GTACATGTGCACAATGTGCAGGG - Intergenic
1164538935 19:29107814-29107836 CAATACATGCAGAATATGCAAGG - Intergenic
1164748666 19:30635136-30635158 GGACACCAGCCGAATGTGCATGG - Intronic
1168078740 19:53994046-53994068 GGGCACATGCAGAGTGGGCACGG - Intronic
1168483251 19:56739295-56739317 GGAGACATGCGGAGTGTGCAGGG + Intergenic
926353886 2:12022186-12022208 GGTCACAAGCAGAATTTCCATGG + Intergenic
926422090 2:12709912-12709934 GGACAAAAGGAGAAAGTGCAGGG + Intergenic
926422208 2:12711048-12711070 GGACACAAGGAGAAAGTGCAGGG - Intergenic
926711190 2:15882397-15882419 GTACATGTGCACAATGTGCAGGG - Intergenic
926827609 2:16922935-16922957 ACACACATACAGAATGAGCAGGG - Intergenic
928419928 2:31130456-31130478 GGACAGAAGAAGAATGTGAAGGG + Intronic
932608434 2:73180104-73180126 GGATCCATGTAAAATGTGCAGGG - Intergenic
933635970 2:84709267-84709289 GGGCACATGCAAAATGTGGTGGG - Intronic
934593666 2:95583416-95583438 GTACATGAGCAGAATGTGCAGGG + Intergenic
936392950 2:112092316-112092338 GGACAGTGGCAGAATGTCCAGGG + Intronic
936571183 2:113617227-113617249 GAACACATGCAGTATGGACAAGG + Intergenic
936650517 2:114421222-114421244 GGACAAAAGCAGAAGTTGCAGGG - Intergenic
936798511 2:116236815-116236837 GTACATGTGCAGAAAGTGCAGGG - Intergenic
938204724 2:129410642-129410664 GTACATGTGCACAATGTGCAGGG + Intergenic
938710983 2:133976118-133976140 GGACAGATGCAGACTTTCCAAGG + Intergenic
939245461 2:139617944-139617966 GTACACTTTCAGAAAGTGCAAGG + Intergenic
939660134 2:144878998-144879020 GGACACATGGGGACTGTGGATGG + Intergenic
940254884 2:151718252-151718274 GGACACAGGAAGAAGGTACAGGG + Intronic
941269467 2:163407685-163407707 GGACACAGGCAGAATCTGTAAGG - Intergenic
941961139 2:171255048-171255070 GGACACATGCAGACTCTTCAAGG + Intergenic
943137748 2:183937304-183937326 GCACACAGGCACAATGGGCATGG - Intergenic
943616372 2:190097092-190097114 GTACATGTGCAGAATGTGCAGGG + Intronic
945477626 2:210304108-210304130 AGAAACATGCAGAATGTGCATGG - Intronic
945704352 2:213210638-213210660 GGACTCATGAAGAATGAGGATGG - Intergenic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
948171696 2:235908738-235908760 GATTACATGCAGAATGTTCATGG + Exonic
1169329171 20:4703199-4703221 GGACACAAGCACAAGGTGTAAGG + Intergenic
1169362714 20:4964655-4964677 GCACACATGCAGAAAATGAAGGG + Intronic
1170902717 20:20481446-20481468 TGACAAATGAAGAATGTGCGTGG + Intronic
1171527874 20:25830082-25830104 GGGCACATGGAGAATGTGTCAGG - Intronic
1171548952 20:26025798-26025820 GGGCACATGGAGAATGTGTCAGG + Intergenic
1172788895 20:37488732-37488754 GGACACATGAAGAAACAGCAGGG - Intergenic
1175863178 20:62160988-62161010 GGGCACATGCAGCAGGAGCACGG + Intronic
1176672809 21:9750516-9750538 GGAGACATGAAGAAACTGCATGG - Intergenic
1177414130 21:20772350-20772372 AGACACATGCAGAATGTGCAGGG - Intergenic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1179147409 21:38780543-38780565 GGACACATGGTAAGTGTGCAAGG - Intergenic
1180552700 22:16553416-16553438 GTATATGTGCAGAATGTGCAGGG + Intergenic
1182684381 22:32110195-32110217 GGACTCAGGCAAAATATGCATGG - Exonic
1183018213 22:35007198-35007220 GGACACATGGAGTTTGTGTAGGG - Intergenic
1183984550 22:41562284-41562306 GGAAACATTCAGAATTTGGAGGG - Intronic
1185186659 22:49404997-49405019 AGACACATGCAGAACCTTCAGGG + Intergenic
952224227 3:31357798-31357820 AGACACAGGCAGAATGAGCTTGG + Intergenic
953757430 3:45658858-45658880 GGACATATTTAGAATCTGCATGG - Intronic
953855585 3:46497232-46497254 AGACACATGCAGTTTGTGGACGG + Intergenic
954383521 3:50232386-50232408 TAAAACATGCAGAATGTGCATGG - Intronic
954572501 3:51653889-51653911 GTACACATGCACAACGTGTAGGG - Intronic
954871887 3:53773550-53773572 GCACACGTGGAGAATCTGCAAGG - Intronic
956736545 3:72243046-72243068 TGACACATGCTGAATGTGCCGGG + Intergenic
958411361 3:93820510-93820532 TGACACGTGTAAAATGTGCAAGG - Intergenic
958517767 3:95141494-95141516 GGACTCATACAGCATGTGCAGGG - Intergenic
959557175 3:107733894-107733916 CTACAAATGCAGACTGTGCATGG - Intronic
959692758 3:109217542-109217564 GGACAGATGCAGAACATGCAAGG - Intergenic
960265011 3:115611194-115611216 GGACAAATGCAGAATATGAGTGG + Intergenic
960753995 3:120989513-120989535 AGTCACATGCAGAATCTACAAGG - Intronic
961218110 3:125177517-125177539 GGACACATAGAAAATGTGCTAGG + Intronic
962252249 3:133842491-133842513 GGACACAGCCTGAATGTCCACGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963672630 3:148271029-148271051 GGAAACAATCACAATGTGCATGG - Intergenic
963737944 3:149042247-149042269 GGACATCTGCATAATGTGCCAGG + Exonic
963988572 3:151626971-151626993 GGAAATATGTAGAATGTGCCTGG + Intergenic
964946595 3:162232873-162232895 GGACACATGTAGAATGTGTCTGG + Intergenic
965056412 3:163722285-163722307 GGACAAATGGAGAATGAGCAAGG + Intergenic
965970611 3:174551027-174551049 GTACATGTGCACAATGTGCAGGG + Intronic
966498790 3:180612860-180612882 GGACTCATCCAGAATTTACAAGG + Intronic
967521541 3:190438204-190438226 GTACATGTGCACAATGTGCAGGG - Intronic
968373839 4:20593-20615 GAACACATGCAGTATGGACAAGG + Intergenic
968920633 4:3520649-3520671 GGCCACCTGCAGACTGTGCAGGG + Intronic
970310827 4:14780579-14780601 GGGCCCATGCAGATTGTTCAAGG - Intergenic
970588757 4:17540374-17540396 GGAGACAAGCAGAGTGTGGAAGG + Intergenic
971215680 4:24660363-24660385 GGAGACTTCCAGAATATGCAGGG + Intergenic
971862149 4:32121760-32121782 GGAAACATGCAGAATGGGGAAGG - Intergenic
972782108 4:42295078-42295100 GGACCCATGCAGGACCTGCAGGG + Intergenic
974697982 4:65398893-65398915 GGACAACTGTAGAATGAGCAAGG - Intronic
976040880 4:80883893-80883915 GTACACGTGCAGGATGTGCAGGG + Intronic
977102511 4:92834852-92834874 AGACACGTGCAGAATGTTCTGGG + Intronic
978112904 4:104984474-104984496 GTACATGTGCAGGATGTGCAGGG - Intergenic
979247231 4:118521737-118521759 GAACATATGCAGAAAGTTCATGG - Intergenic
979899875 4:126202284-126202306 AGACACCTGAAGAATGAGCAAGG + Intergenic
982285852 4:153733678-153733700 GGAGAAATGCAGACTGTGCAAGG - Intronic
982686795 4:158500371-158500393 GTACATGTGCATAATGTGCAGGG + Intronic
982883262 4:160746629-160746651 GGAAAAATGCAGTATTTGCATGG - Intergenic
983475627 4:168208545-168208567 GGACACATGGAGAATTGTCAGGG - Intergenic
984217709 4:176934947-176934969 GTACACGTGCACAATGTGCAGGG + Intergenic
984337895 4:178415740-178415762 GGACAAATAGAGAATGAGCAAGG - Intergenic
984680689 4:182605827-182605849 GGACACTTGCAGAGTGAGAAGGG + Intronic
985038197 4:185862274-185862296 GCACACAGGCAGATTCTGCAGGG + Intronic
985401906 4:189601309-189601331 GGAGACATGAAGAAACTGCATGG + Intergenic
985460895 4:190105671-190105693 GAACACATGCAGTATGGACAAGG - Intergenic
987089597 5:14499044-14499066 GGTCTCATGTAGAATGTGCATGG + Intronic
987500810 5:18707497-18707519 GTACATGTGCAGAATGTGCAGGG + Intergenic
987641939 5:20623346-20623368 GTACATGTGCACAATGTGCAGGG - Intergenic
987876213 5:23684893-23684915 GTACAGGTGCAGGATGTGCAGGG + Intergenic
988031033 5:25762524-25762546 GTACACGTGTAGGATGTGCAGGG + Intergenic
988688452 5:33548474-33548496 GGACACACTCAAAATATGCAGGG + Intronic
989754772 5:44939520-44939542 AGACCCATCCAAAATGTGCATGG + Intergenic
991106049 5:62843181-62843203 GTACATGTGCACAATGTGCAGGG - Intergenic
992871193 5:81007193-81007215 GGAAACCTGCAGAAGGTGAAGGG + Intronic
993312115 5:86347439-86347461 GGAAACATTCAAAATGTGAAAGG + Intergenic
993954767 5:94218687-94218709 GGACACATGGAGTAAGTTCATGG - Intronic
994376644 5:99022358-99022380 GGACTCTTCCAGAAAGTGCATGG + Intergenic
994518014 5:100794563-100794585 GGACACCTGCAGGATGAGCAAGG - Intergenic
996066167 5:119081733-119081755 GGACAAATTGAGACTGTGCATGG + Intronic
996492420 5:124113776-124113798 GGACACATGGAGAAAGTAAAGGG + Intergenic
996999641 5:129744247-129744269 AGACAGATGCAGCATGTGCCTGG - Intergenic
997843060 5:137259596-137259618 GCACATGTGCAGAATGTGCAGGG - Intronic
999949570 5:156634391-156634413 ATACATATGCAGGATGTGCAAGG - Intronic
1001929592 5:175663575-175663597 GGAGAAATGCAGACAGTGCACGG - Intronic
1002745563 5:181468739-181468761 GAACACATGCAGTATGGACAAGG - Intergenic
1003704804 6:8513293-8513315 GAACACCTGCAGAAGGAGCATGG - Intergenic
1003849848 6:10210312-10210334 AGACAAATGAAGAATATGCATGG - Intronic
1005671117 6:28107147-28107169 GTACATGTGCACAATGTGCAGGG - Intergenic
1005861550 6:29906389-29906411 GGACACTTGGAGAGTGTGGAGGG + Intergenic
1006516827 6:34550002-34550024 GGAGCCATGCAGAGTGGGCAGGG + Intronic
1006930202 6:37683127-37683149 GGACACACCCAGAATCTACAGGG - Intronic
1008038553 6:46773124-46773146 GGAGACTAGCACAATGTGCATGG - Intergenic
1008169594 6:48186804-48186826 GGCCACATCCAGTGTGTGCAGGG - Intergenic
1008311903 6:49986922-49986944 GGACTCATGGAGAATCTGGATGG + Intergenic
1009054129 6:58315202-58315224 GTACATGTGCACAATGTGCAGGG - Intergenic
1012475883 6:99614203-99614225 GGACAGCTGCTGATTGTGCATGG - Exonic
1014877568 6:126679514-126679536 GTACATGTGCACAATGTGCAGGG - Intergenic
1017400272 6:154053336-154053358 GGTCACATGCAGTGGGTGCAGGG - Intronic
1018176452 6:161182564-161182586 GGACACATGCAGCATGGAAATGG - Intronic
1019007992 6:168819144-168819166 GGAAACAACCAAAATGTGCATGG + Intergenic
1019250480 6:170742294-170742316 GAACACATGCAGTATGGACAAGG - Intergenic
1019628359 7:2032898-2032920 GCACACAGGGAGAGTGTGCATGG + Intronic
1019675289 7:2308026-2308048 GCACACATACACAATTTGCAAGG - Intronic
1020921066 7:14265001-14265023 GGACACTGGCAGAATCTGTAAGG + Intronic
1021569313 7:22048401-22048423 GGACAAATGGAGGATGTGAAGGG + Intergenic
1022370487 7:29766470-29766492 TGACAAAGGCTGAATGTGCAGGG - Intergenic
1022661611 7:32372722-32372744 GGACTCATACAGAATATACAAGG + Intergenic
1023071537 7:36439756-36439778 TGACACATGCAGACAGTGGAAGG + Intronic
1023360780 7:39413293-39413315 GTAAAAATGCAGAACGTGCATGG - Intronic
1024745722 7:52403736-52403758 GGACACATCAAGAATGGACATGG + Intergenic
1025016640 7:55444373-55444395 GCACACATGAAGAATGTACTGGG - Intronic
1025026083 7:55517456-55517478 GGACACATGGCCAGTGTGCAGGG - Intronic
1025272481 7:57538052-57538074 GTACATATGCACAATGTGCAAGG + Intergenic
1026170330 7:67948432-67948454 AGACCCAGGCAGAATCTGCAAGG - Intergenic
1027928979 7:84506699-84506721 TGAGACATGAAGAATGTTCATGG + Intergenic
1028291442 7:89070341-89070363 GGACACACTCAGAATGAGCTGGG + Intronic
1029231799 7:99076024-99076046 GGACACATGAAGAAGGTGACTGG - Intronic
1033271932 7:139939802-139939824 GGAAACCAGCAGAATGTGGAAGG + Intronic
1033378443 7:140788108-140788130 GTACATGTGCAGGATGTGCAGGG - Intronic
1035643186 8:1198931-1198953 GGATACAGGCAGACTGTGCTTGG + Intergenic
1036019800 8:4831851-4831873 TGCCACATCCAGAAGGTGCAAGG + Intronic
1036614695 8:10379333-10379355 GAACAGATACAGAATCTGCAGGG + Intronic
1037305359 8:17497750-17497772 GGTCCCCTGCAGAATGTGAAGGG - Intronic
1037691909 8:21188525-21188547 GGACACATAGGGAATGTGCTTGG - Intergenic
1041115342 8:54530393-54530415 GGACAGAAGGAGGATGTGCAGGG - Intergenic
1042301382 8:67286204-67286226 AGACACATACATTATGTGCATGG + Intronic
1042988559 8:74612213-74612235 GGATACCTGTAGAATGTGCTGGG - Intronic
1043202990 8:77395319-77395341 GGAGACTTGCAGAATCTGCATGG + Intergenic
1043645096 8:82507885-82507907 GTACATGTGCACAATGTGCAGGG + Intergenic
1044243903 8:89918661-89918683 GGACACCTGCAGAATAATCAAGG - Intronic
1045902875 8:107306167-107306189 AGACACTAGCAGAATGTGGAAGG + Intronic
1048114395 8:131505408-131505430 GGACAAAAGCAGATTGTGGAGGG - Intergenic
1048919579 8:139215707-139215729 AGACACATGCTGTGTGTGCAGGG + Intergenic
1050922614 9:11224021-11224043 GTACATGTGCACAATGTGCAGGG - Intergenic
1051147890 9:14048339-14048361 GTACATGTGCACAATGTGCAGGG - Intergenic
1051346174 9:16153049-16153071 GGTAACAAGCAGAATGAGCAGGG + Intergenic
1051558312 9:18410232-18410254 GTACATTTGCAGGATGTGCAGGG + Intergenic
1055556386 9:77478060-77478082 GTACATATGCATAATGTGCAGGG + Intronic
1058094051 9:100838823-100838845 GGACATATGCAGGATTTGAAAGG - Intergenic
1185532880 X:835728-835750 GTATATGTGCAGAATGTGCAGGG + Intergenic
1186823130 X:13312044-13312066 GGACACCTGCAAAATGTCCATGG - Intergenic
1186824764 X:13328574-13328596 GGACACCTGCAAAATGTCTACGG - Intergenic
1187280635 X:17856249-17856271 AGACACATTCAGACTATGCATGG - Intronic
1190183747 X:48217323-48217345 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190193399 X:48296131-48296153 GGACAGAATCAGAGTGTGCAAGG - Intergenic
1190360511 X:49644632-49644654 GGACAAATGGACAATGAGCAAGG + Intergenic
1190663628 X:52677732-52677754 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190675795 X:52780690-52780712 GGACAGAATCAGAGTGTGCAGGG - Intronic
1192165285 X:68824039-68824061 GGTTACCTGGAGAATGTGCAAGG - Intergenic
1192465072 X:71348964-71348986 TGACACATGGAGAATGTGTTAGG + Intergenic
1193223207 X:78951786-78951808 GTACATGTGCAGGATGTGCAGGG + Intronic
1193354087 X:80496754-80496776 GTACACGTGCAGGATATGCAGGG + Intergenic
1197758573 X:130012890-130012912 GGACACTTGCACCATCTGCAGGG + Intronic
1198572043 X:137967888-137967910 GTACATGTGCACAATGTGCAGGG + Intergenic
1201231994 Y:11874012-11874034 GAACACATAGAAAATGTGCAAGG - Intergenic