ID: 946270797

View in Genome Browser
Species Human (GRCh38)
Location 2:218591780-218591802
Sequence TACTTCATCTGGAAGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946270792_946270797 21 Left 946270792 2:218591736-218591758 CCATCTAAAAAAAAAAAAAGAAA 0: 155
1: 5242
2: 97020
3: 80651
4: 123455
Right 946270797 2:218591780-218591802 TACTTCATCTGGAAGAGAGGAGG 0: 1
1: 0
2: 0
3: 24
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946270797 Original CRISPR TACTTCATCTGGAAGAGAGG AGG Intronic
901547246 1:9967555-9967577 TTTTTCATCTGGATAAGAGGAGG + Intronic
901699623 1:11038252-11038274 TTCTTCATCTGCAAGATGGGGGG + Intronic
902353805 1:15880863-15880885 GACTTCAACAAGAAGAGAGGAGG + Intronic
902714733 1:18264850-18264872 TTCTTCATTTGGTAGAGAAGGGG - Intronic
903007270 1:20307054-20307076 TGCTACATCTGGAAAAGAGCTGG - Intronic
904843376 1:33389093-33389115 AACTTCATCTGTAGGTGAGGGGG - Intronic
905467870 1:38169246-38169268 TGCTCCATCTGGAAGAGGAGGGG - Intergenic
905769501 1:40628391-40628413 GACTTCATCTGTAAGAGACTCGG + Intronic
905878001 1:41445672-41445694 CACTCCATCTGGCAGACAGGTGG + Intergenic
907174785 1:52509145-52509167 TACTTGATCTAGAACAGGGGAGG - Intronic
907271008 1:53291133-53291155 TTCTTCATCAGGAAAAGAGAGGG + Intronic
907640960 1:56190061-56190083 TACTGCCTCTGCAAGAAAGGTGG + Intergenic
907774871 1:57504077-57504099 CACTACATCTGGCAGACAGGAGG + Intronic
908096252 1:60741999-60742021 TACTTTATTTGGGAGAGAAGAGG - Intergenic
910736981 1:90470214-90470236 AACTGCATCTGGAACAGAGCAGG - Intergenic
911662520 1:100518325-100518347 TTCTTCATCTGGACGAGCAGTGG + Intronic
912210758 1:107554440-107554462 TTCTTCATCTGTAAGGCAGGGGG - Intergenic
913500540 1:119468905-119468927 TTCCTCATCTGTAAGAAAGGAGG - Intergenic
917952248 1:180051265-180051287 CAGTTCATCTGGTAGAGCGGAGG - Intronic
918689855 1:187466593-187466615 TATTTCATCAGAAAGATAGGTGG - Intergenic
918752931 1:188295400-188295422 TACCTCACCAGGAAGACAGGGGG - Intergenic
918995741 1:191757052-191757074 CATTGCATCTGGAGGAGAGGTGG + Intergenic
920693258 1:208163027-208163049 CACTTCATCAGGCAGAGAGAGGG + Intronic
923203510 1:231735402-231735424 TACTTCCTATGGGAAAGAGGTGG + Intronic
923539295 1:234876633-234876655 CACTTCATCTGGAAGAGGTCAGG - Intergenic
924137016 1:240978576-240978598 AACTTAATCTGGAAGAGAGAAGG + Intronic
1063499655 10:6541832-6541854 TACTTCATATGGAAACGAGGAGG - Intronic
1065129372 10:22604989-22605011 TACTTGGTTTGGAAGAAAGGAGG - Intronic
1065866607 10:29920112-29920134 CCCTCCATCTGGAAGAGAAGAGG - Intergenic
1067521615 10:47011881-47011903 AACATCAGCTGGCAGAGAGGAGG - Intergenic
1067998602 10:51304857-51304879 TTCTTCATCTGTAAGATATGTGG - Intronic
1068274624 10:54777467-54777489 TACCTCATCTGGGTTAGAGGAGG + Intronic
1068699328 10:60003181-60003203 TCCCACATCTGGAAGAGAAGGGG + Intergenic
1070168201 10:73913548-73913570 TAATTCTTCTGGAGGAGAGGAGG - Exonic
1070546308 10:77455660-77455682 TGATTCATGGGGAAGAGAGGAGG - Intronic
1071211045 10:83342428-83342450 GAATTCATTTGGAAGAGAAGAGG + Intergenic
1071939055 10:90567529-90567551 TACTACATCTGAAAGAGAAAAGG - Intergenic
1072230788 10:93412520-93412542 AACTCCATCTGGAAGAGGTGGGG - Intronic
1073107428 10:101040225-101040247 TCCTTTGTCTGGTAGAGAGGAGG - Exonic
1073282688 10:102366279-102366301 TACTCTTACTGGAAGAGAGGAGG - Intronic
1075384984 10:122049090-122049112 CAGCTCATCTGGATGAGAGGTGG + Intronic
1078544720 11:12239022-12239044 TACATCATCTGGCTGAGAAGAGG - Intronic
1078739580 11:14053884-14053906 TCCTTCATCTGGAAGAAGCGAGG + Intronic
1083437926 11:62655575-62655597 TCCTTCTTCTGGAAATGAGGAGG + Intronic
1083668430 11:64287578-64287600 TTCTCCATCTGTAAGAGTGGAGG + Intronic
1084582780 11:70034523-70034545 TTATTCATCTAGAAGAGAAGAGG + Intergenic
1084594127 11:70107074-70107096 AACTGCATGTGGAAGGGAGGAGG + Intronic
1085360956 11:75886868-75886890 TACTTCATCAGAAAGAGTTGTGG - Intronic
1087231953 11:95676183-95676205 GATGTCATCTGGCAGAGAGGAGG - Intergenic
1087885165 11:103472111-103472133 TAGTTCATATGGAAGAATGGTGG + Intronic
1087895538 11:103581821-103581843 TTTTTCATCTGGAACAGTGGAGG + Intergenic
1087949431 11:104202445-104202467 TACTTCACCTGGCTGAGATGAGG - Intergenic
1088181768 11:107121139-107121161 TCCTTCTGCTTGAAGAGAGGAGG + Intergenic
1089646449 11:119883164-119883186 AAATTCATCTGGAAGAGAAAGGG - Intergenic
1090033957 11:123231918-123231940 CACTTCAGCTGGCCGAGAGGAGG + Intergenic
1092818428 12:12331273-12331295 CACAGCATCTGGTAGAGAGGCGG - Intronic
1093074458 12:14743334-14743356 TACTTAGTCTGTAAGAGAGCAGG - Intergenic
1095119559 12:38400679-38400701 TACATAATCTGGTAGTGAGGGGG - Intergenic
1095570670 12:43681749-43681771 TATTTAATATGGGAGAGAGGAGG - Intergenic
1097235294 12:57535363-57535385 TGCTTCCTCAGGAACAGAGGAGG + Intronic
1097985973 12:65783488-65783510 TATTTCATCTGGGGGAGGGGAGG + Intergenic
1098065342 12:66608859-66608881 TCCTTTATCTGGAATAGATGAGG + Intronic
1098952500 12:76655653-76655675 TACTTTCTCTGGAACAGATGAGG - Intergenic
1102039790 12:109793593-109793615 TCTTTGATCTGGAAGACAGGAGG + Exonic
1102830140 12:115990661-115990683 AACTTGATCTGGAAGAATGGTGG + Intronic
1103292752 12:119860458-119860480 TACTTGATCTGGAAGAAACTTGG - Intronic
1104515993 12:129427271-129427293 GACTTCATCTGAAAAAGAGAAGG - Intronic
1105219121 13:18309205-18309227 GACATCAGGTGGAAGAGAGGAGG - Intergenic
1106077781 13:26475868-26475890 GGCTTCTCCTGGAAGAGAGGTGG + Intergenic
1106079317 13:26487493-26487515 TGCTTCCTCAGGATGAGAGGTGG + Intergenic
1106785146 13:33099998-33100020 GACTTCCTCTGGCAGTGAGGAGG + Intergenic
1109931041 13:69218094-69218116 TCCTTCATCAGGAAGAGAAGTGG - Intergenic
1110063582 13:71071728-71071750 CACTTCAGTTGGAAGAGAAGAGG + Intergenic
1110775599 13:79405537-79405559 TCCTGAATCTGGAAGCGAGGTGG + Intronic
1111883702 13:93991303-93991325 TACTTGTTCTAGAAGAGAGCAGG - Intronic
1113072586 13:106435801-106435823 TTCTTCATCTGCAAAATAGGAGG - Intergenic
1113566853 13:111324486-111324508 TGCTTCATCGGGAAACGAGGTGG + Intronic
1113770518 13:112905323-112905345 TACTTCAAATGGAACAGGGGTGG + Intronic
1119675498 14:76550630-76550652 TACAGCATCTGAAAGAGGGGTGG - Intergenic
1120710694 14:87789995-87790017 TACTTGATCTGTAAAAGTGGAGG - Intergenic
1120712006 14:87802591-87802613 TACTTCATCTGTAAAATAAGAGG + Intergenic
1122784843 14:104158834-104158856 TACACCATCAGGATGAGAGGAGG - Intronic
1125076653 15:35626940-35626962 TACATCATCTCAAAGAGAAGAGG - Intergenic
1125583355 15:40803128-40803150 TATTTATTCTGGAGGAGAGGAGG - Intronic
1126901434 15:53318716-53318738 TACTGCATCTACAGGAGAGGAGG + Intergenic
1127357308 15:58212695-58212717 TTCTTCATCTGAAAAAGAAGGGG + Intronic
1128664756 15:69530026-69530048 TTCTCCATCTGTAAAAGAGGAGG - Intergenic
1128958463 15:71974403-71974425 TGGTTCATCTGGGAAAGAGGCGG + Intronic
1130984492 15:88836185-88836207 TAGTTCACCTGGAAGAGGGGAGG - Exonic
1132483600 16:178491-178513 TATTTCATCAGGAAGAATGGAGG + Intergenic
1133143725 16:3768042-3768064 TTCTTCTTCCGGAAGAGAAGAGG - Intronic
1137458829 16:48639316-48639338 AACTTCTTCTGGTAGAGATGGGG + Intergenic
1138196048 16:55052993-55053015 TACTTTATCTGTAAGAGGGCGGG + Intergenic
1138379819 16:56591921-56591943 TACTTCCTCTTGAAGACAGGAGG - Intergenic
1140204935 16:72925832-72925854 TACGTCCTCTTGAAGACAGGAGG + Intronic
1141995136 16:87632162-87632184 TACTTTATCCAGGAGAGAGGTGG - Intronic
1143345465 17:6245708-6245730 TTCTTCATTTGTAAGATAGGTGG - Intergenic
1144326235 17:14184068-14184090 TTCTTCATCTGTAAGATGGGAGG - Intronic
1144475112 17:15580940-15580962 TTCTTCATCTGTAAGATGGGAGG - Intronic
1145827030 17:27884759-27884781 TCCTTCATCTGGAACATAAGGGG - Intronic
1146728786 17:35176368-35176390 TTCTTCATCTGTAAAATAGGGGG + Intronic
1148259911 17:46172391-46172413 TCTTTCATCTGGGAGAAAGGGGG + Intronic
1148541299 17:48482773-48482795 TTCTGCATCTGGAAAATAGGAGG + Intergenic
1148666838 17:49381343-49381365 TATTTGATCTGGAAGATAGTAGG + Intronic
1149376269 17:56047334-56047356 TAGTTCATCTCCAAGAGAGGGGG + Intergenic
1149975710 17:61263617-61263639 AACTTCATGTGGAAGATCGGAGG + Intronic
1150309999 17:64120459-64120481 TCCTTCATCTGACAGAGAGGGGG + Intronic
1151894323 17:76969742-76969764 GACTTCCTCTGGGAGAGGGGAGG + Intergenic
1152590804 17:81211056-81211078 TACTTTCTCTGGAAGAATGGTGG - Intronic
1152946151 17:83198674-83198696 TGCCTCTTCTAGAAGAGAGGAGG + Intergenic
1154071543 18:11156584-11156606 TCCTTCATCAGAAAGAGAGAAGG - Intergenic
1155155755 18:23156131-23156153 GAGGTCATCTGGAACAGAGGGGG + Intronic
1155301007 18:24428902-24428924 TACTTCAACTGGTAGATAGGTGG - Exonic
1155560092 18:27066257-27066279 TACTACACCTGGAAGAGAGAGGG - Intronic
1155824541 18:30422814-30422836 TACTCCATATGGAAGAAAAGAGG + Intergenic
1159445141 18:68533007-68533029 TGCCTCATCTGTAAGAGAAGTGG - Intergenic
1159679545 18:71330772-71330794 TACTTCATATGGAAGACATTAGG - Intergenic
1163748673 19:19062846-19062868 TGTTTCATTTGGAAAAGAGGGGG - Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1164996391 19:32722472-32722494 AACTTCATCTGCAGGACAGGTGG - Intronic
1165444646 19:35850204-35850226 TTCTTCATGGGGAACAGAGGTGG - Intronic
925323105 2:2992261-2992283 TACTTCTTTTGGAAGTGAGCTGG + Intergenic
925687197 2:6484299-6484321 TACTTCAAATGGAGCAGAGGTGG + Intergenic
926936617 2:18092234-18092256 ATCTTCATATGGCAGAGAGGGGG + Intronic
927036864 2:19187184-19187206 GACTTCATCTGGAAGAGCTTGGG - Intergenic
927884077 2:26707789-26707811 CCCCTCATCTGGAAGAGAGAAGG - Intronic
928799947 2:35076889-35076911 TACTTCATCTGTAAGAATTGGGG - Intergenic
931441061 2:62290851-62290873 CTCTTCATTTGGAGGAGAGGGGG + Intergenic
931814555 2:65887984-65888006 TTCTCCATCTGGAAGAGACTGGG - Intergenic
933630755 2:84654521-84654543 GGCTTCATGTGGAAGAGAGTGGG - Intronic
934042217 2:88136984-88137006 TACTGGAACTGGAGGAGAGGGGG - Intergenic
934756302 2:96827152-96827174 TTGGTCATCTGGCAGAGAGGAGG - Intronic
938257994 2:129875199-129875221 TGCTTCATTTGTAAAAGAGGTGG + Intergenic
939300768 2:140334551-140334573 TACATCATCCTGAAGAGAGCGGG + Exonic
939582588 2:143968126-143968148 CACTTCATCTTGCACAGAGGAGG - Intronic
940318256 2:152347256-152347278 CACTTCATGTGGAAGAGAGTAGG + Intronic
943445046 2:187974269-187974291 TTCTTCATCTAGAAGAGGGTGGG + Intergenic
944012088 2:194984404-194984426 TGCTGCTTCTGGTAGAGAGGGGG - Intergenic
944634378 2:201660689-201660711 TACTGCCTCGGGGAGAGAGGAGG - Intronic
945168155 2:206967835-206967857 AATTTCATCTGGAAGCCAGGTGG + Intronic
945612578 2:212022917-212022939 TACTTTATGTGGAAGTAAGGAGG + Intronic
945884098 2:215356386-215356408 TCCTTCATGAGGAAGAGATGTGG - Intergenic
946270797 2:218591780-218591802 TACTTCATCTGGAAGAGAGGAGG + Intronic
946522198 2:220478634-220478656 GACTTTATCTGGAAGAAAGTCGG + Intergenic
948149634 2:235734805-235734827 AAGTTCACATGGAAGAGAGGAGG + Intronic
1169344638 20:4820765-4820787 TTCTCGCTCTGGAAGAGAGGAGG + Intronic
1169810327 20:9603299-9603321 AGCTTTACCTGGAAGAGAGGAGG + Intronic
1170516010 20:17131030-17131052 TACTTCTTGTGGGAGGGAGGAGG - Intergenic
1170684164 20:18553984-18554006 TAGTTGATATAGAAGAGAGGAGG + Intronic
1172221851 20:33279642-33279664 TACTTCATCTGGAAAATGGGAGG + Intronic
1172321508 20:33998645-33998667 GACTTCATCCGGAGGTGAGGGGG + Intronic
1172478984 20:35259953-35259975 TTCTTCCTCTGGAAGATAGAAGG - Intronic
1175552323 20:59825646-59825668 TACTTCAGCTGGAGGAGTCGGGG + Intronic
1176035061 20:63032114-63032136 GATTTCATCTGGATCAGAGGAGG + Intergenic
1180742064 22:18060644-18060666 TACTTCACATGTAAGAAAGGTGG - Intergenic
1181960945 22:26621486-26621508 TGCTTCAACTGGAAGAGAAAGGG + Intergenic
1185189237 22:49423606-49423628 CACTACATCAGGAAGGGAGGGGG + Intronic
951161986 3:19434615-19434637 GACTTCATTAGGATGAGAGGTGG - Intronic
951588341 3:24237563-24237585 GACTTTGTCTGGGAGAGAGGTGG - Intronic
951706740 3:25551421-25551443 TACTGGATAAGGAAGAGAGGAGG + Intronic
953017754 3:39094684-39094706 CACTTCATATGGAAGAGCGGTGG + Exonic
953481410 3:43255514-43255536 CACTTCATTTGGAAGAGACGTGG - Intergenic
954064959 3:48098434-48098456 TACTTCCCCTGGTAGAGATGAGG - Intergenic
955526971 3:59831062-59831084 TACTTCATCTGTAAAATGGGAGG + Intronic
960031360 3:113058115-113058137 TTCTTCATCTGCAAGATGGGTGG - Intergenic
961512804 3:127413374-127413396 TTCCTCATCTGTAAGAAAGGGGG - Intergenic
962412508 3:135153602-135153624 TACTTTAAAAGGAAGAGAGGAGG - Intronic
963136384 3:141909260-141909282 GACTTCTGCTGGAAGGGAGGAGG - Intronic
963234917 3:142947110-142947132 AACTCCATCTTGAATAGAGGAGG - Intergenic
963712003 3:148756743-148756765 TACTTCATCTGTAAAATAAGGGG - Intergenic
964696868 3:159518281-159518303 GATTGCATTTGGAAGAGAGGAGG + Intronic
964839667 3:160980085-160980107 AAATTCATCTGAAAGAGAGCAGG + Intronic
964841462 3:160997820-160997842 TATTTAATCTAGAAGAAAGGAGG - Intronic
965953169 3:174335304-174335326 TCCTTCATTTGGAGCAGAGGTGG + Intergenic
968096143 3:195932136-195932158 TCCTTCTACTGGATGAGAGGAGG + Intergenic
968848118 4:3058649-3058671 AACTTCATCTTGAATAGGGGCGG - Intergenic
970265187 4:14275041-14275063 TAATTCATCTGGTACAGAGGGGG - Intergenic
974005993 4:56557932-56557954 AACTTCATCAGGAAGTGGGGAGG - Intronic
974021834 4:56698412-56698434 GACTTCGTCTGGGAGTGAGGAGG - Intergenic
975428239 4:74255640-74255662 TACTAGAAGTGGAAGAGAGGGGG - Intronic
977830709 4:101588950-101588972 TTCTTTATTTGTAAGAGAGGAGG - Intronic
980560001 4:134460394-134460416 TACATCATCTGAAAGCTAGGTGG - Intergenic
981261844 4:142729834-142729856 AGATTCCTCTGGAAGAGAGGTGG - Intronic
983763163 4:171439859-171439881 TACTTGATCTGGCAGAAAAGTGG - Intergenic
984102542 4:175502593-175502615 TACTTTATTTGGGAGAGAGAAGG - Intergenic
985228764 4:187791651-187791673 TTCTTCATCTGTAAAAGAGGTGG - Intergenic
986916348 5:12625205-12625227 TACTTCCTCTGGAATCTAGGCGG - Intergenic
987289742 5:16497290-16497312 TGTTTCATCTGGAAGAGAACGGG - Intronic
989572573 5:42958333-42958355 TCCTACATCTGGAAAAGAGAAGG + Intergenic
990119336 5:52430274-52430296 TACTTCCTCTGGAACAGAGTAGG + Intergenic
991296744 5:65089650-65089672 TACTGCATCTAGAAGAGAAAAGG + Intergenic
991527631 5:67579499-67579521 TATTTTATCTGGAGGAGAAGAGG - Intergenic
991958859 5:72021752-72021774 TTCTTCATCTGTAAATGAGGAGG - Intergenic
992212071 5:74490418-74490440 AACTTTATCTGTAACAGAGGAGG - Intergenic
993115305 5:83713520-83713542 AAAATCATCTGGAAGAGAGAAGG - Intronic
995264434 5:110140838-110140860 TACCACATCTGGAGGAGAGGAGG - Intergenic
996415971 5:123210593-123210615 TGCTTCAAGTGGAAAAGAGGAGG - Intergenic
996619361 5:125481266-125481288 TACTTCAGGAGGATGAGAGGAGG - Intergenic
997765226 5:136496411-136496433 TACTTTATGTTGAAGAGAAGTGG + Intergenic
997826823 5:137113921-137113943 TCCTTCATTTGGAAGAGGGTAGG - Intronic
998889567 5:146731449-146731471 TACTTTATGTGGCAGAGAGAAGG + Intronic
999126634 5:149250863-149250885 TACTTCTTGTTGAAGAGTGGGGG - Intronic
999222766 5:149995104-149995126 TACTTCATTTGGGACACAGGTGG + Exonic
999587601 5:153108266-153108288 TTTTTCATCTGGAAGACAGAAGG + Intergenic
999851208 5:155541540-155541562 GAATTCAACTGGCAGAGAGGAGG + Intergenic
1000048955 5:157545640-157545662 TTCTTCATCTGTAAAAGTGGAGG - Intronic
1002856213 6:1040286-1040308 CACTTCATGGGGAAGAGAGGTGG - Intergenic
1004526885 6:16417403-16417425 TACTTCATCAAGTAGAGAGAGGG + Intronic
1004549390 6:16632049-16632071 TACTTCATGGGGTAGTGAGGAGG + Intronic
1005245937 6:23885243-23885265 TTCTTGATATGGAAGGGAGGAGG + Intergenic
1008814716 6:55551491-55551513 TATTTCAGCTGAAGGAGAGGAGG - Intronic
1010127820 6:72454339-72454361 TATTACATGTGAAAGAGAGGGGG - Intergenic
1010793425 6:80091499-80091521 TACTTTATTTAGAAGAGAAGAGG + Intergenic
1011744337 6:90395076-90395098 TACTTCATATATAAGAGAGGTGG - Intergenic
1012391767 6:98749114-98749136 GACTTCATTTGGAGGAAAGGTGG - Intergenic
1012600148 6:101086596-101086618 TACTGCAGCTGAAGGAGAGGAGG + Intergenic
1016206374 6:141472770-141472792 TCTTTCATCTGAAAGAGAGGTGG + Intergenic
1016229742 6:141788665-141788687 TAATTCAACTTGAGGAGAGGAGG + Intergenic
1019702632 7:2481357-2481379 CACTGAATCTGGAAGAGAGAAGG + Intergenic
1024294129 7:47829454-47829476 TACTGCAGCTTGAAGAGAAGGGG + Exonic
1024888780 7:54178054-54178076 GAATTCATCTGGTAAAGAGGAGG - Intergenic
1029412615 7:100425085-100425107 TAATTCACCTGAAACAGAGGAGG - Exonic
1030568299 7:111188410-111188432 TTCTTCATATGGCAGAAAGGGGG + Intronic
1032882358 7:136103164-136103186 GACTTAATCTGGAAGTGTGGTGG - Intergenic
1034171743 7:149067966-149067988 TTCTTCATCTGGTTGTGAGGTGG + Intergenic
1037121042 8:15287292-15287314 TACTTGTTCTGTAAGAGAAGCGG - Intergenic
1040291329 8:46126930-46126952 TCCTTGATCTGGAAGGGAGGGGG - Intergenic
1041042726 8:53863359-53863381 TATTGCATCTGGGAGTGAGGTGG - Intronic
1044301898 8:90594110-90594132 TGATTCATCTGTAAGACAGGAGG - Intergenic
1045068428 8:98474651-98474673 AACTTCATCAGGCAGAGATGAGG - Intronic
1047478704 8:125259957-125259979 TGCTTCATCTATAAGAGAAGAGG - Intronic
1048235039 8:132681549-132681571 TTTTCCATCTGGAAGAGAAGTGG + Intergenic
1051784582 9:20728545-20728567 TACTTAGTCTGTATGAGAGGTGG + Intronic
1052152391 9:25133116-25133138 TACTTCCTTTGGAAGATTGGAGG - Intergenic
1052404944 9:28047415-28047437 TATTTCAACTGGAAAAGAAGTGG - Intronic
1055975424 9:81950270-81950292 GACTTCATCAGGGAGAGAAGGGG - Intergenic
1057824380 9:98360868-98360890 ACCTTCATCTAGAATAGAGGCGG + Intronic
1058719398 9:107749980-107750002 CACTTCCTCTGGCAGAGTGGAGG + Intergenic
1062561222 9:137142922-137142944 AACATCAGCTGGAAGAGAGGAGG + Intronic
1185887360 X:3794788-3794810 AACCACATCTGGAAGAGGGGAGG + Intergenic
1187244329 X:17540252-17540274 TATTGCATCTGTAAGAGAGATGG - Intronic
1187431116 X:19225896-19225918 TGCTTCACCTGGAAGTGAAGTGG + Intergenic
1189854597 X:45210867-45210889 CTCTTCATAGGGAAGAGAGGAGG - Intergenic
1192394919 X:70770425-70770447 TACATAATCTGGGAGAGGGGAGG + Intronic
1195336907 X:103864190-103864212 TTCGTCATCTGGTAGTGAGGGGG + Intergenic
1195450288 X:105003835-105003857 TATTTCTCATGGAAGAGAGGAGG - Intronic
1196021544 X:110996088-110996110 TACTTCATCTAGAAGAGGCCTGG - Intronic
1196076906 X:111587626-111587648 AACTACATATGGGAGAGAGGGGG - Intergenic
1196325711 X:114399905-114399927 TATTTCATCTGTAAAAAAGGGGG - Intergenic
1196647426 X:118132968-118132990 TATTTCACCTGGCAGAGATGAGG + Intergenic
1197662732 X:129191629-129191651 TAATTCATCTGTAACAGAGTAGG + Intergenic
1200774989 Y:7162363-7162385 AACCACATCTGGAAGAGAGGAGG - Intergenic