ID: 946274767

View in Genome Browser
Species Human (GRCh38)
Location 2:218622874-218622896
Sequence CAGTGGTAAGAGAAATCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946274762_946274767 23 Left 946274762 2:218622828-218622850 CCTCTGAGCTTGCTCTGGAACTC 0: 1
1: 0
2: 1
3: 18
4: 182
Right 946274767 2:218622874-218622896 CAGTGGTAAGAGAAATCAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 217
946274763_946274767 -5 Left 946274763 2:218622856-218622878 CCGCTATGAACCTTCAGACAGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 946274767 2:218622874-218622896 CAGTGGTAAGAGAAATCAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946274767 Original CRISPR CAGTGGTAAGAGAAATCAGG TGG Exonic
902637248 1:17742680-17742702 CAGTTGTAACAGAAATCATATGG - Intergenic
903173928 1:21569662-21569684 CATTGCTAAGAGAAGGCAGGGGG + Intronic
904357774 1:29952102-29952124 CAGTGGTAAGAGCCACCAGCCGG - Intergenic
904718135 1:32484738-32484760 CAGGGGGAAGAGAAAGAAGGGGG - Intronic
906542423 1:46597594-46597616 AATTGGTTAGAGCAATCAGGTGG - Intronic
907831264 1:58066284-58066306 CAGGGGTAGGGGAAATCATGAGG + Intronic
908039623 1:60095308-60095330 GAGTGGAAAGTCAAATCAGGGGG - Intergenic
908754846 1:67460119-67460141 CAGTGGTTATAGAAAGGAGGTGG - Intergenic
909428599 1:75558123-75558145 CAGAGGGAAGAGAAATCAGAAGG - Intronic
911372129 1:97006333-97006355 CAGTGGGAAGAGAAACCAAAGGG - Intergenic
916493975 1:165328062-165328084 CAGTGGAAGGAGAGATAAGGAGG + Intronic
920077344 1:203347091-203347113 CAGTGCTAAGACAATTCAGTGGG - Intronic
920361309 1:205418457-205418479 CAGTTGTCATATAAATCAGGAGG + Intronic
920576353 1:207063621-207063643 CTGTGGTAAGAGCTATGAGGAGG + Intronic
921029440 1:211324971-211324993 CAATGGTAAGAGAAAGCGGGTGG + Intergenic
922653975 1:227364831-227364853 CAGTGGGAGGAGCAATCACGTGG + Intergenic
922865699 1:228859830-228859852 AAGGGGAAAGAGCAATCAGGAGG + Intergenic
924140876 1:241021979-241022001 CAGTGATCAGAGAACCCAGGAGG - Intronic
1062926383 10:1318577-1318599 CAGTGCCCAGAGAGATCAGGTGG - Intronic
1063980987 10:11451706-11451728 AAGTGGTGAGAGAACTCAGAGGG - Intergenic
1065991683 10:31016579-31016601 GAGTGGTAAGAGAAAACAGGAGG - Intronic
1070621075 10:78011614-78011636 CAGGAGTAAGAGCAGTCAGGTGG - Intronic
1071119588 10:82261967-82261989 CAGGAGTAAGAGAAAGAAGGGGG - Intronic
1072529521 10:96305879-96305901 CCTTGCAAAGAGAAATCAGGTGG - Intronic
1072929810 10:99652343-99652365 TCCTGGTAAGAGAAAGCAGGGGG + Intergenic
1079979820 11:27138890-27138912 CAGTGGAATGAGAAATAATGTGG - Intergenic
1080147211 11:29001003-29001025 AAGTGGAAACAGAAATCAGCAGG - Intergenic
1081380412 11:42407730-42407752 CAGTGGTTAGAGAATTGAGAAGG + Intergenic
1081399174 11:42622798-42622820 CCTTGGTAAGAGACAACAGGTGG + Intergenic
1083202895 11:61131114-61131136 CAGTGGTTGGAGAACCCAGGGGG - Exonic
1083880948 11:65547964-65547986 CAGTGGCAGGAGTAGTCAGGGGG + Exonic
1084264193 11:67996453-67996475 GAGAGGGAAGAGAAAGCAGGAGG + Intronic
1084302931 11:68263065-68263087 CAGTGGGAAGAGAGATGGGGAGG - Intronic
1085510064 11:77083655-77083677 CAGTGGGAAGAGGAGTGAGGGGG - Intronic
1085564463 11:77500866-77500888 CTGTGGTAAGAGAAGTCTGTTGG - Intergenic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1086149720 11:83595426-83595448 TAATGGTAAGAAAAATGAGGAGG - Intronic
1087375276 11:97332125-97332147 GGGTTGTAAGAGCAATCAGGAGG + Intergenic
1089571302 11:119412424-119412446 CAGTAGAACAAGAAATCAGGAGG - Intergenic
1090575929 11:128103679-128103701 AAGTGGGAAGAGAAATGAGGTGG + Intergenic
1090794243 11:130120814-130120836 AAGAGGTAAGAGAACTCGGGGGG + Exonic
1092277960 12:7076575-7076597 CATTGGGAAGAGAATGCAGGAGG - Intergenic
1093617995 12:21251292-21251314 CATTGATAACAGAAATAAGGTGG + Intergenic
1094161833 12:27398983-27399005 CAGTTCAAAGAGAAATCTGGGGG - Intronic
1096658517 12:53106374-53106396 TAGTGGCCAGAGAAATGAGGGGG + Intronic
1098501387 12:71196513-71196535 CAGTGGAAAGACAGATCAGTCGG + Intronic
1100604123 12:96137091-96137113 CAGTGGGAAGAGTAATGAGCAGG + Intergenic
1102231210 12:111263769-111263791 CCTTAGTAAGAGAAGTCAGGAGG + Exonic
1103260877 12:119587438-119587460 AAGTGGTAATGGAAATCAGAGGG - Intergenic
1105671755 13:22626248-22626270 CTGTGGTTTTAGAAATCAGGTGG + Intergenic
1106208094 13:27618229-27618251 CAGTGGAAGGAGAAATGACGTGG - Intronic
1107516057 13:41131119-41131141 CAATGTTAAGAGAAACCAGTGGG - Exonic
1107521994 13:41192865-41192887 CAGTGTTCAGAGAAACCAGTGGG - Exonic
1107930489 13:45303032-45303054 CTGTGTAAAGAGAAGTCAGGGGG + Intergenic
1108472194 13:50778467-50778489 CATAGCTATGAGAAATCAGGTGG + Intronic
1108829626 13:54461330-54461352 GTGTTGTAAGAGAAAACAGGTGG + Intergenic
1110776803 13:79417229-79417251 CAGTATTCAGAAAAATCAGGGGG - Intergenic
1111447402 13:88365465-88365487 TAGAGGTGAGAGAAAGCAGGAGG - Intergenic
1111815522 13:93147966-93147988 AACTGGTAAGAGAAATGAAGCGG + Intergenic
1112947027 13:104941543-104941565 AAATGGTGAGAGAAAGCAGGAGG + Intergenic
1113123434 13:106949476-106949498 CAGTTGTAACAGACACCAGGGGG - Intergenic
1113648876 13:112019560-112019582 CAGGGGTTAGAGAAAGGAGGAGG + Intergenic
1114587082 14:23825145-23825167 CAGGTGTAAGAGGAAGCAGGAGG + Intergenic
1115037067 14:28870856-28870878 CACTGGTTGGAGAAATCAGGAGG + Intergenic
1118602235 14:67478900-67478922 TAGTGGTAAGAGAAAAAAGCAGG + Intronic
1120612054 14:86654088-86654110 CTGTTGTATGAGAAATTAGGAGG - Intergenic
1121797087 14:96744184-96744206 CTGTGGGAAGAGAAGTAAGGAGG + Intergenic
1124396289 15:29304793-29304815 CAGTTCTAAGAGCAACCAGGAGG - Intronic
1126452457 15:48823586-48823608 CAGAGTTTAGGGAAATCAGGAGG - Intergenic
1128213559 15:65918454-65918476 AAGTGGTAATAGAAAGCAGAAGG - Intronic
1128392986 15:67195654-67195676 CTGTGGGAAGACAAATCTGGTGG - Intergenic
1128787687 15:70410383-70410405 GAGTGGTGAGAGAAAACACGAGG + Intergenic
1131461240 15:92619090-92619112 CAATAGTAAAAGAGATCAGGAGG - Exonic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1134911647 16:18032429-18032451 CAGTGGCAAGAGAAAAAATGAGG + Intergenic
1138392431 16:56679979-56680001 CAGTGGTAAGAGCACTGAGCTGG - Intronic
1140394492 16:74615081-74615103 CAGTTGTAGGAAAAATGAGGTGG + Intergenic
1142920007 17:3176513-3176535 CAGAAGTAAGGGAAAACAGGGGG + Intergenic
1143284741 17:5780793-5780815 CTGGAGAAAGAGAAATCAGGAGG + Intronic
1143523047 17:7456482-7456504 CAGTGGTAGGAGGACTCAAGCGG + Intronic
1145921303 17:28612229-28612251 CAGTGGTAAAGGAAATGGGGAGG - Intronic
1148441704 17:47714917-47714939 CAGTGGTAATGCAAATTAGGAGG - Intergenic
1149013591 17:51883337-51883359 AAGTGGGAAGAGTGATCAGGAGG - Intronic
1151279127 17:73058795-73058817 CAGATGAAAGAGAACTCAGGAGG + Intronic
1152702499 17:81825980-81826002 CAGTGGTGAGAGCCAGCAGGGGG - Exonic
1153763575 18:8354275-8354297 AAGTGGAAAGAGAAAAGAGGAGG + Intronic
1157154830 18:45255235-45255257 CAGTAGGAAGAGAAAACAGCAGG - Intronic
1157908082 18:51587338-51587360 AAGTGGAAAGAGAAATAATGAGG + Intergenic
1158031069 18:52965817-52965839 CAGTGGAAAGAGAACTCATTTGG - Intronic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1159642473 18:70879551-70879573 CAGTGGTATCAGAAACCATGTGG - Intergenic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1165454580 19:35903328-35903350 CTGTGGAAAGAGAAAGAAGGTGG - Intronic
1166667363 19:44689115-44689137 GAGTGGGGAGAGAAAGCAGGCGG + Intergenic
1168523178 19:57068822-57068844 CAGTGGTAAGAGGAGGCTGGAGG + Intergenic
926044940 2:9703490-9703512 CAGTGCCAAGAGACATCAGTGGG - Intergenic
926546384 2:14245542-14245564 CAGTGAAAAGACAAATCAGGAGG - Intergenic
926631367 2:15139287-15139309 CAGTACTTAGAGAAATCATGGGG + Intergenic
927847971 2:26481016-26481038 CAGTGGGAACAAAAATGAGGGGG + Intronic
929732842 2:44514128-44514150 CAGTGCTTAGAGAAATCAGAGGG + Intronic
932130399 2:69182182-69182204 CAGTGAGAAAAGAAATCACGAGG - Intronic
935062746 2:99622465-99622487 GAGTGGTAAGAAAAAGAAGGGGG + Intronic
935729272 2:106051661-106051683 CAGAGAGAAGAGAAAGCAGGTGG + Intergenic
939064639 2:137467917-137467939 CAGAGGTCAGAGAAAACAGAAGG - Intronic
939792242 2:146592340-146592362 CAGTGGCAAGAGAAATAAGATGG - Intergenic
939866906 2:147482905-147482927 CAGCTGGAAGAGAATTCAGGAGG - Intergenic
940281601 2:151994764-151994786 CAAGGCTAATAGAAATCAGGAGG - Intronic
941407772 2:165112674-165112696 CAGTGGTAAGAGCAAACACAGGG - Intronic
941838024 2:170047536-170047558 CAGTGGGATGAGAAATGAGAAGG + Intronic
942938755 2:181591278-181591300 AAGGGGTAAGAGAGATGAGGTGG + Intronic
943960112 2:194253852-194253874 CAGTGGTAATAGAGAGCAAGGGG + Intergenic
946274767 2:218622874-218622896 CAGTGGTAAGAGAAATCAGGTGG + Exonic
947389843 2:229627871-229627893 CAGTGGTGAGAGGCAGCAGGCGG + Intronic
1170053605 20:12174502-12174524 CAGTTCTAAGAGGAAGCAGGAGG - Intergenic
1170579922 20:17691040-17691062 GATTGGAAAGAGAAAGCAGGGGG - Intergenic
1170692743 20:18629834-18629856 CAGAAATAAGAGAAAGCAGGGGG + Intronic
1171154731 20:22861581-22861603 CAATGGAAAGAGAATGCAGGTGG - Intergenic
1172099993 20:32479647-32479669 CAGAGGCTAGAGAAACCAGGGGG - Intronic
1172360248 20:34307670-34307692 CAGTTGTAAGAAAACACAGGGGG - Intronic
1173003217 20:39120523-39120545 CAGAGGTAAGAGAGAACATGGGG + Intergenic
1173034700 20:39397283-39397305 CAGTTGTAAGAGAAATGAACCGG + Intergenic
1173522569 20:43710674-43710696 CAGTGGAGAGAGACAGCAGGGGG - Intronic
1173843456 20:46174026-46174048 CAGTCGTCAGAGAAACCATGAGG - Exonic
1173971155 20:47153338-47153360 CAGTGTAAAGATAAATGAGGAGG + Intronic
1174562013 20:51437976-51437998 CAGTTGTCTGAGAAAACAGGGGG - Intronic
1174890397 20:54385556-54385578 CCGTGATAAGAGAAAACAAGGGG - Intergenic
1177212339 21:18086937-18086959 CAGTGGTTAGAGCAATCCAGTGG + Intronic
1177350251 21:19929965-19929987 CAGTGGAAAGAAAAATAAAGAGG - Intergenic
1177672336 21:24248531-24248553 CATTGCTTAGAAAAATCAGGTGG + Intergenic
1178485694 21:33019002-33019024 CAGTGGAAACAGATTTCAGGGGG + Intergenic
1179276678 21:39898216-39898238 CAGTAACAAGAGAAACCAGGAGG - Intronic
1180895711 22:19330674-19330696 AAAAGGCAAGAGAAATCAGGAGG + Intergenic
1182711996 22:32328989-32329011 CAGTAGGAAGAGGAAGCAGGAGG - Intergenic
1182875874 22:33690687-33690709 GAATGGTAAGAGAAATCCCGAGG + Intronic
1184226446 22:43131498-43131520 AAGGGGTAAGAGAAATCAGCTGG - Intergenic
1184399540 22:44265873-44265895 CAGTAGGAAGAGGAAGCAGGAGG - Intronic
1184847122 22:47095581-47095603 CAGTGTTAAGAGAACTCATGTGG + Intronic
950191208 3:10977390-10977412 CGGTGCAAAGAGAACTCAGGAGG + Intergenic
952110958 3:30123562-30123584 CAGGGTTAAGAGAAATGAGCAGG - Intergenic
955324452 3:57999207-57999229 CTGTGGTAAGAGAATGAAGGCGG - Intergenic
955459394 3:59163947-59163969 ATGTGCTAAGAGAAATCAGAAGG - Intergenic
955928167 3:64028440-64028462 CAGTGGTCAGAAAATTCATGGGG + Intergenic
956890468 3:73608123-73608145 CAGTGGGAAGAGAAAGCAAAGGG + Intronic
957131895 3:76233610-76233632 CAGTGGTAAGACATAACTGGAGG - Intronic
958687154 3:97413379-97413401 CAGGGGAAAGAGCAAGCAGGAGG + Intronic
959608346 3:108266536-108266558 CAATGGAAAGAGAATTCTGGAGG + Intergenic
960273703 3:115702279-115702301 CAGTGGTAATATAAATCAGGTGG + Intronic
963638749 3:147832993-147833015 GAGTGATAAGAGAAAGCAGGAGG - Intergenic
963889461 3:150617687-150617709 CAGCTGTAAGAGAAATCACCTGG + Intronic
964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG + Intronic
964836307 3:160941561-160941583 CAGTGGCAAGAGAAAAAATGAGG - Intronic
965030736 3:163363642-163363664 CGGGAGCAAGAGAAATCAGGAGG + Intergenic
965610241 3:170535844-170535866 CAGTGGGCAGAGAAATCATGAGG - Intronic
967259553 3:187628520-187628542 CAGTGGTAAGAGAAGTTAATAGG - Intergenic
967640443 3:191856425-191856447 CACTTGTAAGAGAAAACATGTGG + Intergenic
970177841 4:13357181-13357203 CAGTGGTAAGGGAAATGGGCAGG - Intergenic
971114643 4:23630548-23630570 CAGGAGTAAGAGAAACCAGGAGG + Intergenic
972629248 4:40829146-40829168 CCATGTGAAGAGAAATCAGGGGG + Intronic
973049911 4:45584404-45584426 CACTGATAATAGAAATCAGGGGG - Intergenic
974012901 4:56623718-56623740 CAGTGGCAAGAGAAAAAATGAGG - Intergenic
975771834 4:77732988-77733010 CAAAGGCAAGAGAAATCAAGAGG + Intronic
977071062 4:92388410-92388432 CAGTGGGAAGGTAAATGAGGTGG - Intronic
978141957 4:105328163-105328185 CAGTGGAAATAGAAAACAGCTGG - Intergenic
978184801 4:105844455-105844477 CAGTGGAAGGTGAAATCAGTAGG - Intronic
980655631 4:135780812-135780834 CATTGGTAATAGAAATAAGGTGG + Intergenic
982637186 4:157911552-157911574 CAGTGGAGAGAAAAATGAGGAGG - Intergenic
983366232 4:166793805-166793827 TATTTCTAAGAGAAATCAGGTGG + Intronic
984596819 4:181678393-181678415 CAGAGGTAAGAGAATTGAGGAGG + Intergenic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
987461654 5:18218703-18218725 AAATGGTAAGAAAAAACAGGGGG - Intergenic
987558289 5:19483777-19483799 TAGTGGGAAGACAAAGCAGGAGG + Intronic
987588093 5:19885060-19885082 CAGTGGAAAAAGGAAGCAGGAGG - Intronic
988580266 5:32462726-32462748 CAGAGGAAAGGGAAATGAGGGGG - Intergenic
989632367 5:43498637-43498659 CAGTGGTAGGAAAAATGAGAAGG - Intronic
990347317 5:54883636-54883658 CAGTGCTAAGAAGGATCAGGAGG + Intergenic
993169701 5:84402418-84402440 AAGTGTTAAAAGAAATCAGTAGG + Intergenic
993484220 5:88462569-88462591 CTGTGGAAAGAGAAAGCAGGGGG + Intergenic
993573775 5:89576178-89576200 CAGGGGTAAAAAAAAACAGGGGG + Intergenic
994594555 5:101815663-101815685 GAGTGCTGAGAGAAATCCGGAGG - Intergenic
994637534 5:102362484-102362506 CAGTGGCAAGAGAAAATAAGAGG + Intergenic
995399212 5:111721443-111721465 CAGGGAAAAGAGAAAACAGGAGG + Intronic
996192388 5:120561816-120561838 CAGTGGCAAGAGAAAGAATGAGG - Intronic
996339010 5:122415618-122415640 CCTTGGTAAGAGAGAACAGGAGG - Intronic
996615184 5:125432956-125432978 CAGTGGTAATAGAAATCTCTAGG + Intergenic
997317957 5:132953754-132953776 CAGTGGAAAAAGAAGTGAGGAGG - Intronic
998610141 5:143679771-143679793 CAGTGATAAGAGAAAACTGATGG + Intergenic
999272127 5:150302748-150302770 CAGAGGAGAGAGAAATTAGGAGG - Exonic
999931891 5:156442564-156442586 CAATGGAAAGAGAAATGAGCAGG - Intronic
1004058844 6:12170722-12170744 AAGTGGAAAGAGCAATCAGTGGG + Intergenic
1004108557 6:12690446-12690468 TAGTGCCAAGAGACATCAGGAGG - Intergenic
1004420499 6:15465203-15465225 CAGTGCTATGGGAGATCAGGTGG + Intronic
1004657625 6:17679649-17679671 CACTGGTGAGAGAGAACAGGAGG + Intronic
1005044407 6:21628466-21628488 CAGTGGTAAGAGAAATGAAAGGG - Intergenic
1005106713 6:22231734-22231756 AAGGGGTAAGGGAAATAAGGTGG + Intergenic
1008501588 6:52189029-52189051 CAGAGGGGAGAAAAATCAGGAGG - Intronic
1009898379 6:69780954-69780976 GAAAGGTAAGAGAAACCAGGTGG + Intronic
1011808011 6:91095287-91095309 TAGTGGTAAGAAGAGTCAGGAGG + Intergenic
1011899828 6:92278420-92278442 AAGTAGTAAGAGACATTAGGTGG - Intergenic
1016015688 6:139183328-139183350 AAGTGGTAACAGAAAACAGAAGG - Intergenic
1017303817 6:152893311-152893333 CAGTGGAATAAGGAATCAGGTGG - Intergenic
1017399009 6:154038676-154038698 AAGTGGTTACAGAAATCAGAAGG - Intronic
1018511272 6:164526945-164526967 CAGAGGTAATTGAAATCATGGGG + Intergenic
1018651508 6:165995471-165995493 GAGTGGTGAAAGAAATTAGGGGG - Intergenic
1019853927 7:3585629-3585651 CAGTGGTAACAGAGAACAGAGGG + Intronic
1021120670 7:16791894-16791916 CAGGGGCCAAAGAAATCAGGAGG + Exonic
1022053626 7:26705556-26705578 CAGTGATTAAAGAATTCAGGCGG + Intronic
1024482495 7:49878653-49878675 CACAGATAAGAGAAACCAGGAGG - Intronic
1025815340 7:64905564-64905586 AAATGTTAAGAGAATTCAGGGGG - Intronic
1027776899 7:82476600-82476622 TAGTGGCAAGAGAAATAATGTGG + Intergenic
1031955656 7:127939855-127939877 CACTAGTCAGAGAATTCAGGAGG - Intronic
1032342760 7:131091150-131091172 AAGTGGAAAGAGAAAGCAGGAGG - Intergenic
1035044723 7:155956131-155956153 CAGTGATAAGAGGGACCAGGTGG - Intergenic
1038080308 8:24127470-24127492 CAGTGGTAAGGGCAATGATGTGG - Intergenic
1038724105 8:30064269-30064291 CAGTGGTAAGAGACGTAATGTGG + Intronic
1039329904 8:36525541-36525563 AAGTGGTAGTGGAAATCAGGAGG + Intergenic
1043973692 8:86562057-86562079 AAGTGGTAAAAGAAATGAGGTGG + Intronic
1045061436 8:98414643-98414665 CAGGAGGAAGAGGAATCAGGCGG - Intronic
1045502214 8:102752178-102752200 CAGTGGTAACAGATACCAGCAGG + Intergenic
1046105099 8:109655647-109655669 AAGTGGTAGAAGAAAGCAGGAGG - Intronic
1046620324 8:116522324-116522346 CAGTGGGGAGAGAAAACAGTAGG - Intergenic
1047340040 8:123972213-123972235 GAGTGGAAAGAGAAATGAGGAGG + Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1050293559 9:4181360-4181382 CAGAGTTCAGAGAGATCAGGAGG - Intronic
1050447160 9:5736962-5736984 TGGTGGTAGGAGAAATCAGATGG - Intronic
1050586134 9:7113471-7113493 CAGTGGGAAAACAAATTAGGGGG - Intergenic
1052070061 9:24070605-24070627 CATTGGTATGAAATATCAGGTGG + Intergenic
1055778387 9:79791475-79791497 CAGAGGCAGCAGAAATCAGGAGG - Intergenic
1056117537 9:83455486-83455508 CAGTGGCAAGAGAAAAAATGAGG - Intronic
1057980745 9:99660207-99660229 CAGTGCTAATAGAAATTGGGGGG - Intergenic
1057999549 9:99850916-99850938 CAGTGGCATGAGGAAACAGGTGG + Intronic
1062048790 9:134436774-134436796 AAGTAGTAACAGAAATAAGGAGG - Exonic
1062495458 9:136829480-136829502 CAGTGGTAAGAGGGAGCTGGCGG + Exonic
1062664125 9:137657987-137658009 CTGTGTTAAGTGAAATCAGCTGG - Intronic
1187310450 X:18136381-18136403 CACTGGTTAAAGAAATCAGGGGG - Intergenic
1188399831 X:29730872-29730894 CTGAGCTAGGAGAAATCAGGAGG - Intronic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190472594 X:50797890-50797912 CACTGGGAAGGGAAATTAGGTGG + Intronic
1193076233 X:77359124-77359146 CAGTGGTAAGGGCAATCATTGGG + Intergenic
1193335342 X:80281331-80281353 CAGTGGTAAATGAAATCAGTAGG - Intergenic
1195325747 X:103756965-103756987 CAGTGCAAAGAGAATTCTGGTGG - Intergenic
1196173831 X:112618350-112618372 CTGTGGTAAGTGTAATGAGGGGG - Intergenic
1199599489 X:149533485-149533507 GAGTGGTCTGAGAAAGCAGGTGG + Exonic
1199651142 X:149946722-149946744 GAGTGGTCTGAGAAAGCAGGTGG - Intergenic
1201378667 Y:13348508-13348530 CAGCTATAAGAGAAATCAAGAGG + Intronic