ID: 946281865

View in Genome Browser
Species Human (GRCh38)
Location 2:218671760-218671782
Sequence CTGGGGAACGGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 0, 2: 9, 3: 66, 4: 801}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946281865 Original CRISPR CTGGGGAACGGGAGGGTGGA GGG (reversed) Intronic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
901213652 1:7540993-7541015 CTGGAGAACTGGAGGTTGCAGGG + Intronic
901836399 1:11926464-11926486 ATGGAAAACGGGAGGGCGGAGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901928551 1:12582762-12582784 CTGGTGAACGGGAGAGTGGACGG - Intronic
902282154 1:15382565-15382587 TTGGTGAACGGATGGGTGGAAGG + Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902374948 1:16026280-16026302 CTGGGGCAGGGTAGGGTGGGCGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902534230 1:17110008-17110030 CTGGGGAATAGGAGGGTGTGGGG - Intronic
902640448 1:17763245-17763267 CTGGGGAGCGGGAGTGTGTGGGG + Intronic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
902763426 1:18599267-18599289 CTGGGGAGCGGGAGTGGGGCTGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903131215 1:21280579-21280601 TTTGGGAAGGGCAGGGTGGAGGG + Intronic
903339294 1:22643944-22643966 CTGGGGAATGAGAGGGTTGGGGG + Intronic
903846194 1:26280940-26280962 CTGGGGGACGGGGGGGTGGGGGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904282981 1:29434313-29434335 CCTGGGAATGGGGGGGTGGAAGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904433475 1:30479603-30479625 CTGGGGAAGGGGTGGAGGGAAGG - Intergenic
904645067 1:31959403-31959425 CTGGGGAAAGGGAGTCTAGATGG - Intergenic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905393252 1:37651389-37651411 CTGGGGATTGGAGGGGTGGAGGG - Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905773757 1:40654937-40654959 CTGGGCACCAGGAGGATGGAGGG - Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906640086 1:47436686-47436708 CTGGGGCACGGAAGGGGAGATGG - Exonic
907160551 1:52366011-52366033 CTGGGGACCGCGGGGGTAGATGG - Intronic
907220697 1:52905118-52905140 CTGGGGGACCGGATGGGGGAGGG - Intronic
907304965 1:53508354-53508376 GTAGTGAGCGGGAGGGTGGAGGG - Intronic
907467862 1:54651441-54651463 CTGGGGAAGGGGAGTGGAGATGG + Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
910968688 1:92832465-92832487 CTGGGGAACGCCAGAATGGAGGG + Intronic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912442793 1:109712111-109712133 CTGGGGACTGGGAGGCGGGAGGG + Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915930926 1:160060638-160060660 CTGGGGCCTGGGAGGGTGGATGG - Intronic
916809828 1:168295747-168295769 CTGGGAAACGGGGTGGTGGGGGG + Intronic
917416435 1:174815131-174815153 GTGGGGAACGGGGAGGTGGTAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917510269 1:175663813-175663835 CTGGGGAACTGGAGAGTCCAAGG + Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918308365 1:183267605-183267627 CTGGGGAGTGGGGGGGTGTAAGG + Intronic
918760696 1:188401785-188401807 GTGGGGAAAGGGAGGGTGAGGGG + Intergenic
919861233 1:201740475-201740497 CTGGGGACCAGGCGGGTGGAAGG + Intronic
919917636 1:202148581-202148603 CTGGGCCACCGGAGGGTGGCAGG + Exonic
920080509 1:203369482-203369504 GAGGGGAGTGGGAGGGTGGAAGG - Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922322610 1:224501952-224501974 CTGGAGGAAGGTAGGGTGGAGGG + Intronic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922603629 1:226875121-226875143 CTGTGGTCCGGGAGGGTGGTAGG + Intronic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922737842 1:227998959-227998981 CTAGGGAACAGGAGAGTGGGGGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
924455008 1:244212366-244212388 CTGGGCAATGGGAGGGAGCAGGG + Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1064125964 10:12660322-12660344 CTGGGGTACATGAGGCTGGAGGG + Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1066502425 10:36007085-36007107 GTGGGGAAAGGGAGGAGGGAGGG - Intergenic
1067078565 10:43201649-43201671 CTGGGGGAAGGGAGGTTGAATGG + Intronic
1067079008 10:43203259-43203281 CTGGGGCACGGGCGGGGGCAGGG - Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067415314 10:46097877-46097899 CTGGGAAACTGGAGGGAGGTAGG - Intergenic
1068007581 10:51408924-51408946 CTGGGGAAGAGGTGTGTGGATGG - Intronic
1068344402 10:55754716-55754738 CTGGGAAGCTGGAGGGTGGGAGG + Intergenic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1069607532 10:69749218-69749240 CTGGGGAATGGAGGGGTGGGGGG - Intergenic
1069895338 10:71677047-71677069 CTGGTGAAGGGCAGGGTGGTTGG - Intronic
1070282086 10:75057371-75057393 CTGGAGTCCGGGAGAGTGGAGGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070813598 10:79310530-79310552 CCGGGGAGCGGGAGGCAGGAGGG - Intronic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1070891012 10:79942242-79942264 GTGGGGATTGGGAGGGTGCATGG + Intronic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071600375 10:86956007-86956029 CCGGTGGACGGGAGGGAGGAGGG - Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1073677519 10:105665253-105665275 CTGACAAACGAGAGGGTGGAGGG + Intergenic
1073698841 10:105902030-105902052 ATGGGGAACCGAAGGGTGCAAGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074772933 10:116744992-116745014 GGGGGGAATGGGAGAGTGGAAGG - Intergenic
1074830082 10:117241614-117241636 CTGGGGGACGGGAGAATGGGGGG + Intronic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075647502 10:124106178-124106200 GCGGGGAATGGGTGGGTGGACGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076171277 10:128322243-128322265 CGTGGGAACAGGAAGGTGGAAGG + Intergenic
1076189236 10:128470941-128470963 CAGGGGAACCGGGGGCTGGAGGG - Intergenic
1076215433 10:128689539-128689561 TGGGGGTACTGGAGGGTGGAGGG + Intergenic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076535565 10:131174529-131174551 CTGGGGAACGGGCGGGTGAGAGG - Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077078018 11:709948-709970 CTGGGGAAGGGCAGAGTGGGGGG - Intronic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077299986 11:1842319-1842341 CTGGGCACGGGGAGCGTGGAGGG + Intergenic
1077420800 11:2449003-2449025 CAGGGGATCAGGAGGGTGGTAGG + Intronic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077781640 11:5336450-5336472 CTGGGAAACAGGAGGATTGATGG - Intronic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078549756 11:12272034-12272056 CTGGGCTCCAGGAGGGTGGAGGG - Intergenic
1078907880 11:15704372-15704394 CTGGAAAACTGGAGGGTGGGAGG - Intergenic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1079244749 11:18743955-18743977 CTGGAGAGAGGGTGGGTGGAGGG - Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080890287 11:36403151-36403173 CTGAGGAAATGGAGGATGGATGG + Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081807809 11:45899872-45899894 CAGGGGAACGGGAGGGCGCAAGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082803974 11:57435240-57435262 CAGGGAATCTGGAGGGTGGAAGG - Intergenic
1083132665 11:60640307-60640329 CTCAGAAGCGGGAGGGTGGAGGG + Intergenic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1084117308 11:67049799-67049821 CCGGGGAAGGCCAGGGTGGAAGG + Exonic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084275453 11:68049015-68049037 CCGGGGGACGGGAGGCTGGCAGG + Intronic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084457113 11:69274245-69274267 CTGGGCACCAGGTGGGTGGATGG + Intergenic
1084515896 11:69637842-69637864 CTGGGGCACGGGAGGGGCGGTGG + Intergenic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084721448 11:70908338-70908360 CTGGGGGATGGGAGGATGCATGG - Intronic
1084779626 11:71399775-71399797 CTGGGGGAGGGCAGTGTGGAGGG + Intergenic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086154312 11:83648822-83648844 TTGGGAAAAGGCAGGGTGGAAGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086685359 11:89727900-89727922 CTGGGAAGCGGGAAGGGGGATGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087762138 11:102111814-102111836 AGGGGAAACGGGAGGGGGGAAGG - Intronic
1088775780 11:113081296-113081318 CTGGCTAACTGGAGGATGGAAGG - Intronic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089347766 11:117802005-117802027 CTGGGGAGCAGTGGGGTGGAAGG + Intronic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091208855 11:133839530-133839552 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1096625486 12:52892873-52892895 GTCGGGAAAGGCAGGGTGGAGGG + Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099144212 12:79018343-79018365 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100177796 12:92050649-92050671 CTGGGGAAGGGTTGGGGGGATGG + Intronic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1101653287 12:106696687-106696709 CTGGGGAACAGGAGTCTGGTGGG - Intronic
1101822426 12:108194330-108194352 CTGGTGACCGGGAGGCTGTAAGG + Intronic
1101967297 12:109290404-109290426 CTGGGGACGGGCAGGTTGGAGGG - Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102543322 12:113637954-113637976 CTGGGGAAGGGGTGGGGGTAGGG - Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102691270 12:114763015-114763037 GTGGGGGCAGGGAGGGTGGAAGG - Intergenic
1103056580 12:117825940-117825962 CGGGTGAACAGGTGGGTGGATGG + Intronic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103961163 12:124610033-124610055 CTGGGGTCCCGGAGGATGGAGGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104842735 12:131832380-131832402 TGGGGGAACGGGAAGGGGGAAGG + Intronic
1105007300 12:132729450-132729472 GAGGGGAATGGGAGGGTGGGAGG + Intronic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1106086873 13:26550731-26550753 GTGGGGAAGGGGAGGGTGCCTGG - Intergenic
1106188781 13:27432089-27432111 TTGAGGAACGTGAGGGTGGCTGG + Intronic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108688898 13:52845734-52845756 CTGGGGGAAGGGAGACTGGAGGG - Intronic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110734799 13:78923974-78923996 GTGGGGTGCGGGAGGGGGGAGGG - Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1112217607 13:97449543-97449565 GTGGGGCAAGGGAGAGTGGATGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113794525 13:113049336-113049358 GTGGGGAAGGGGTGGGTGGTGGG + Intronic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114444828 14:22780411-22780433 ATGGGGAATGGGAGGTAGGAGGG - Intronic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114623772 14:24115254-24115276 CTGGGGAGCGGGAGGGGTGTTGG - Exonic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1118707807 14:68496042-68496064 CTGGGGGAAGGCAGGATGGAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1121235978 14:92391492-92391514 ATGGGGTAAGGGAGTGTGGACGG - Intronic
1121253113 14:92513996-92514018 GTGGGGATCGCGAGGGAGGAGGG - Intronic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122774926 14:104112917-104112939 CTGGGCAAAGGCAGGGTGGCAGG - Exonic
1122994925 14:105257882-105257904 CTGGGGAAAGGCAGGGTGGGTGG + Intronic
1202902290 14_GL000194v1_random:50805-50827 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1124338596 15:28875646-28875668 CTGGGGAACTGGATGGGGGCGGG - Intergenic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126677340 15:51171803-51171825 CTGGGGAACGGCAGGGAGATAGG - Intergenic
1127378443 15:58406758-58406780 GTGGGGATAGTGAGGGTGGAGGG - Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129170701 15:73805836-73805858 CTGGTGGGTGGGAGGGTGGATGG - Intergenic
1130031269 15:80316719-80316741 CTGAGGAACAGGTGGGTGAAGGG - Intergenic
1130556264 15:84924507-84924529 GTGGGGAAAGGGAGGAGGGAAGG - Intronic
1130709127 15:86262154-86262176 CTGGGGAATGGGAGGCTGTTTGG - Intronic
1131467612 15:92668077-92668099 AGGGGGAACGGGAGGGGGAATGG + Intronic
1131714592 15:95094778-95094800 GTGGGGAATGGGAGGTTGGGAGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1132240028 15:100250538-100250560 TTAGGGAAGGGGAGGGTGGCAGG + Intronic
1132394787 15:101464665-101464687 CAGGGAAATGGGAGGCTGGAGGG + Intronic
1132467306 16:83267-83289 CTGGGGCACGGGGGGTTGGAGGG + Intronic
1132570512 16:642055-642077 CCGGGGAACGGGAACGGGGACGG + Intronic
1132626480 16:894060-894082 CAGGGGGACGGGTGGGCGGATGG - Intronic
1132626517 16:894155-894177 CAGGGGGACGGGTGGGCGGACGG - Intronic
1132734588 16:1379276-1379298 CAGGGGAACGGGGCGGGGGAGGG - Intronic
1132829003 16:1918484-1918506 CGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1134112430 16:11523949-11523971 GAGGGGAGCGGGTGGGTGGATGG - Intergenic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135023881 16:18984259-18984281 CTGGGGAACAGCAGGTGGGAAGG + Intronic
1135147468 16:19975016-19975038 CTGGGGAAGTGCAGGGTTGAGGG - Intergenic
1135169248 16:20168730-20168752 CTGGGAGAAGGGAGGGTGAAGGG - Intergenic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136222438 16:28836866-28836888 CTGGGGAACGGGGGGATGGGGGG - Exonic
1136598330 16:31266804-31266826 TTGGGGAACAGGGGTGTGGAAGG - Intronic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138543931 16:57705389-57705411 TTGGCGAATGGGAGGATGGATGG - Intronic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1139379224 16:66520049-66520071 CAGAGGAGCGGGAGAGTGGACGG + Intronic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1139908212 16:70380942-70380964 CGGGTGAACGGGAGGGTCGAGGG + Exonic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140170414 16:72598736-72598758 CTGGAGAATGGGAGGAGGGAGGG + Intergenic
1141271781 16:82547493-82547515 CTGGGGAGCGGGAGGGATCAAGG + Intergenic
1141642010 16:85346913-85346935 ATGGTGAACAGGTGGGTGGATGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142128586 16:88422137-88422159 TGGGTGAACGGGTGGGTGGATGG + Intergenic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142363281 16:89637165-89637187 CTGGGGGCTGTGAGGGTGGACGG + Intronic
1142399710 16:89852523-89852545 CAGGGGATCCGGGGGGTGGAGGG - Intronic
1142399742 16:89852601-89852623 CAGGGGATCTGGGGGGTGGAGGG - Intronic
1142967003 17:3588042-3588064 GTGGGGAACGTGAGGCTGCAGGG + Intronic
1143173448 17:4943403-4943425 CTGGGGGAAGCGGGGGTGGATGG - Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143481117 17:7227880-7227902 ATGGGGAATGGGTGGGAGGAGGG - Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143524855 17:7466151-7466173 CTGGGGAGTGGGAGGGTGACAGG - Exonic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144523014 17:15966941-15966963 CTGGCGAACGGAAGGACGGAAGG + Intronic
1144754745 17:17672347-17672369 CGGGGGATCAGGAGGGTGGAGGG + Intergenic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1146076794 17:29738068-29738090 TGGGGTCACGGGAGGGTGGAGGG - Intronic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146445484 17:32929398-32929420 CTGGGGACCGGGGGAGGGGAAGG + Intronic
1146456793 17:33015047-33015069 CTGTGGAACGGAAGTGGGGAAGG - Intronic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147212433 17:38879710-38879732 CCAGGGAACGGGAGGGGGTAAGG - Intronic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148232857 17:45947934-45947956 CTAGGGAATGGGAGTGGGGAAGG - Intronic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148550179 17:48545472-48545494 CTGGGGAAGGGGAGAAGGGAAGG - Intergenic
1148640500 17:49183836-49183858 CTGGGGCACCCGAGGGTGCAGGG + Intergenic
1148680425 17:49470428-49470450 CTGGGGATCGGGGTGGGGGAGGG + Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1149000263 17:51749812-51749834 CTGGGGAACGGGGGAGGGAATGG + Intronic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150633851 17:66898929-66898951 CTTGGGAAAGGAAGGGTGGGAGG - Intergenic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151143068 17:72013974-72013996 TAGAGGAACTGGAGGGTGGAGGG - Intergenic
1151393527 17:73803941-73803963 ATGGGGAATGGGAGGGAGAAAGG - Intergenic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151585460 17:75005631-75005653 CTGGGGGAGAGGAGTGTGGAAGG + Exonic
1152100809 17:78300883-78300905 TGGGGGAACAGGAAGGTGGAGGG - Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152358902 17:79821045-79821067 CTGGGGAAGGGTAGATTGGAAGG - Intergenic
1152420208 17:80188696-80188718 CTGGGGAACAGCAGGAAGGAAGG - Intronic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1152795460 17:82304162-82304184 CTGGAGACCGGGAGGCTCGAGGG + Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153131184 18:1857070-1857092 ATGGGGAACGGGTATGTGGATGG - Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153679657 18:7488579-7488601 CTGAGGAATGGGAGGGCGCATGG - Intergenic
1153746590 18:8185907-8185929 CTGGGGAACAGGACTGTGTATGG - Intronic
1155392695 18:25352208-25352230 GCGGGGAGCGGGAGGGAGGAGGG + Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157299918 18:46472151-46472173 CGGGTGAATGGGTGGGTGGATGG - Intergenic
1157492881 18:48136509-48136531 CTTGGGGACGGGAGGGAGGGGGG - Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1157886975 18:51378077-51378099 CGTGGAAACTGGAGGGTGGAGGG - Intergenic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1159019517 18:63131823-63131845 CTGGGAAACCGGAGGATGCAGGG + Intronic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1160329953 18:77982236-77982258 CACGGGTACTGGAGGGTGGAGGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160753250 19:745196-745218 CTGGGGAACTGGAGGTTACAGGG - Intronic
1160833480 19:1113812-1113834 CTGAGGGACGGCAGGGTGGCGGG + Intronic
1160953190 19:1677285-1677307 CTGAGGATCTGGGGGGTGGAGGG + Intergenic
1160989918 19:1856272-1856294 GAGGGGCACGGGAGGGTGGAGGG + Intronic
1161000327 19:1907611-1907633 CTGGTGAACAGGAGGCTGGGAGG - Intronic
1161317784 19:3626386-3626408 CAGGGGACCGGGCGGTTGGAGGG - Intronic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162470691 19:10870942-10870964 CTGGGGAATGGGCGGGGGAAAGG - Intergenic
1162781497 19:13009300-13009322 CTGGGCAGCGGGTGGGTGGGGGG + Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162913386 19:13861923-13861945 CTGGGGACCGGGGGTGTGTAGGG + Intergenic
1162926044 19:13930938-13930960 CAGGGGAACCGGGGGGTGGGTGG - Intergenic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163112422 19:15169823-15169845 CTGGGGAGGGGCAGGATGGAGGG + Intronic
1163398833 19:17079574-17079596 CTTGGGAACGGGCGGGCGAAAGG - Intronic
1163675639 19:18654071-18654093 CTGATGAAAGGGTGGGTGGATGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1164867637 19:31618064-31618086 CTCGGGAACTGGAGGTTGCAGGG - Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166044927 19:40224454-40224476 GTGGGGTTTGGGAGGGTGGATGG - Intronic
1166046273 19:40232854-40232876 CTGGGGAGAGGGAGGGGTGAGGG + Exonic
1166288211 19:41845285-41845307 CTGGGGCACGGGAAGGGGGGAGG + Intronic
1166668482 19:44695788-44695810 CTTGGGAGCGGGAGGGAGGCTGG - Intergenic
1166679429 19:44758004-44758026 CGGGGGAGCTGGAGGGGGGAAGG - Intronic
1166746030 19:45142280-45142302 CTGGGGACGGGGAGGGGGCACGG - Intronic
1166864718 19:45828934-45828956 CTCGGGGACAGGAGGGTGCAGGG + Intronic
1167121690 19:47521113-47521135 CAGGGGACAGGGAGGGTGGGGGG + Exonic
1167173387 19:47848815-47848837 CTGGGGGAAGGGAGGGTGTTTGG - Intergenic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167633214 19:50638696-50638718 CGGTCGAACGGGAGGATGGATGG + Intronic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1168146008 19:54420497-54420519 CTGGGAACCGGGAGGGTGTCAGG + Intronic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168322522 19:55518539-55518561 GTGGGGTATGGGTGGGTGGAGGG - Exonic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
925073225 2:987747-987769 CTGGAGGACAGGAGGGTTGATGG + Intronic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925511060 2:4625945-4625967 CTGGGAAACAGGAGGATGGCTGG + Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
927099845 2:19779672-19779694 CTTGGGGACGGTAGGTTGGATGG + Intergenic
927130139 2:20051727-20051749 ATGGGGAGCGGAAGGCTGGATGG + Exonic
927519597 2:23690874-23690896 CTGGGGAACTGGGGGGAGCAGGG - Intronic
927884367 2:26709603-26709625 CGAGGGAAGGGGAGGGTGGTGGG + Intronic
927885473 2:26715677-26715699 CTGAGGGCCGGGAGGGTGTAGGG + Intronic
927944125 2:27124301-27124323 TTGGGGAAAGGTGGGGTGGAAGG + Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
931168693 2:59779011-59779033 CTGGGGATTGGGGGAGTGGAGGG + Intergenic
931224917 2:60321367-60321389 CTGGGGAAGTGCTGGGTGGAAGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
932577937 2:72972933-72972955 TTGGGGAGCTGGAGGGTGGCGGG + Intronic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
933775791 2:85770434-85770456 CTGGGGAAAAGGGGGGTGGGTGG + Intronic
933831185 2:86210307-86210329 CCGGGGGAAGGGAGGGTGGCGGG - Intronic
934504378 2:94879603-94879625 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935059154 2:99593156-99593178 CTGGGGTGCGGGGGCGTGGAGGG - Intronic
935514806 2:104022687-104022709 CTTGGGAACGGGGGAGGGGATGG + Intergenic
935820420 2:106887409-106887431 TTGGGGACCGGCAGTGTGGAGGG - Intergenic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
937333440 2:121045991-121046013 CTGGGGAGCCTGTGGGTGGAGGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938220786 2:129565634-129565656 CTGGGAACAGGGAGTGTGGAGGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938548890 2:132361313-132361335 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
940901663 2:159131507-159131529 CAGGGGAAGGGGCGGGGGGAGGG - Intronic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942760864 2:179395650-179395672 CTGGGGAACAGGATGTTGAAGGG + Intergenic
944474778 2:200092488-200092510 GTGGGGATAGGGAGGATGGAGGG + Intergenic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
945463615 2:210141133-210141155 GTGGGGAAGGGAAGGGAGGAAGG - Intronic
945851181 2:215009294-215009316 GAGGGGAACAGAAGGGTGGAGGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946355581 2:219182391-219182413 CTGGGGAACAGGTGGGAGAATGG - Exonic
946409592 2:219509504-219509526 CTGGGGAAGGGGAGCGGGGGTGG - Intergenic
946441979 2:219704387-219704409 CTGGGGGAGGGCAGTGTGGAGGG - Intergenic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
948178489 2:235961992-235962014 CTGGGGCAGGGCGGGGTGGAGGG + Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169357270 20:4917711-4917733 CTGGGCAACAGGAGGGTAGCAGG - Intronic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1169923554 20:10759843-10759865 ATGGGGGACGGGGGGGTGGGGGG - Intergenic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170821456 20:19758504-19758526 GTGGGGAACGGAAGGGGGAAGGG + Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1171877713 20:30593840-30593862 GTGGGGAAGGGGAGGGACGAAGG + Intergenic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172428623 20:34872865-34872887 CGGGGGAGTGGGAGGGCGGAGGG + Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172763241 20:37336604-37336626 CTGGGGGACGGGGGGCTGGTGGG - Intergenic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1174514695 20:51082852-51082874 GTCGGGAAGGGGAGAGTGGAGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174565728 20:51463217-51463239 CTGGGAAGTGGGAGAGTGGAGGG + Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175261630 20:57678196-57678218 CTGGGGAAAGGTAAGGTTGATGG + Intronic
1175733627 20:61370915-61370937 CGGGGGAAAGGGAGGGAGAAAGG - Intronic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176621658 21:9065572-9065594 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178914482 21:36699047-36699069 GGGGGGAGCGGGAGGGGGGAGGG - Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179508793 21:41858748-41858770 CTGGGGAAGAGGGGGGTTGATGG + Intronic
1179905412 21:44420249-44420271 ATGGGGACAGGGTGGGTGGAGGG - Intronic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180958090 22:19750185-19750207 CTGGGAGACGGGAGGGGGCATGG - Intergenic
1181528306 22:23502358-23502380 GTGGGGGATGGGAGGATGGAGGG - Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1182310972 22:29406217-29406239 CCCGGGCAGGGGAGGGTGGAAGG - Intronic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182428802 22:30288671-30288693 CTGGGGAACGGGAGTACGGGAGG - Intronic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1182690138 22:32154885-32154907 CCCGGGCAGGGGAGGGTGGAAGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183463597 22:37967958-37967980 CTGGGGAACAGGGAGATGGAGGG - Exonic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184219409 22:43089575-43089597 CTGGGCCCCGAGAGGGTGGACGG - Intergenic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184631829 22:45787478-45787500 CTTGGGAACTGGAGGCTAGAAGG - Intronic
1184839391 22:47043668-47043690 CAGCTGAACAGGAGGGTGGAAGG + Intronic
1184889227 22:47369282-47369304 ATGGGGGACAGGAGGGTTGACGG + Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
949414508 3:3800269-3800291 CCGGGGACGGGGAGGGAGGAGGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949725647 3:7041294-7041316 CCTGGGAATGGGAAGGTGGAAGG - Intronic
950120382 3:10478558-10478580 CAGGGGAGCAGGAGGTTGGATGG - Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950187491 3:10954036-10954058 CTGGGGAAGGGGAGCTTGCAGGG - Intergenic
950654059 3:14425709-14425731 CTCGGGGCAGGGAGGGTGGAAGG + Intronic
951297196 3:20952468-20952490 GTGGGGAAGGGTAGGGAGGAGGG + Intergenic
951696282 3:25448884-25448906 CTGGGGATTGCGGGGGTGGAGGG - Intronic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952618083 3:35299889-35299911 CTCAGAAACGGGAGGGTGGTGGG - Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
953019845 3:39106633-39106655 CTAGGGAAAGGGGGGGTGCAGGG + Intronic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953215865 3:40917507-40917529 CTGGGGGACAGGATGGTGAACGG - Intergenic
953319750 3:41961557-41961579 CTGGGGAGCGGGGGGGGGGGGGG - Intronic
953460214 3:43076111-43076133 GTGGGGACTGGGAGGGTGCAGGG + Intergenic
953788606 3:45929521-45929543 CTGGGGAACGTGATGGTGAGTGG + Intronic
954390202 3:50264729-50264751 CTGGAGCCCGGCAGGGTGGAGGG - Intergenic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954801513 3:53189735-53189757 CTGGGGAACGGTGGGGCTGAGGG - Intronic
954902544 3:54032129-54032151 CTGGGGCAAGGGATGATGGATGG + Intergenic
954990890 3:54839823-54839845 CTGGGGAACGAGGGATTGGAGGG - Intronic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955952568 3:64257293-64257315 GTTGGGAACAGAAGGGTGGAGGG - Intronic
956413656 3:69004714-69004736 TTGGGGAATGGGTGGGGGGATGG - Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
959618569 3:108375328-108375350 GTGGGGTAGGGGAGGGGGGAGGG + Intronic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960734621 3:120765024-120765046 TTGGGGATGGGGAGGGTGGGGGG - Intronic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961654158 3:128432488-128432510 CTGGGCAGCGGGAGTGTGGAGGG + Intergenic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961781487 3:129323325-129323347 GTGGAGAACGAGAGGGTGGCAGG - Intergenic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962858235 3:139370045-139370067 CTGGGGAATGGGTGGATGGGGGG + Intronic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963541934 3:146602454-146602476 CTTGGGAAAGGGAGGATGCATGG + Intronic
963582714 3:147147170-147147192 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
966302485 3:178495103-178495125 CTGGGCACCTGGAGGATGGAGGG - Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967307665 3:188074817-188074839 CTGGGCAACGGCGGGGTGGGGGG + Intergenic
967840749 3:194003134-194003156 CCTGGGAGCGGGAGGGAGGAGGG - Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968614621 4:1571745-1571767 CAGGGGGAAGGGAGCGTGGAAGG + Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968939329 4:3629919-3629941 CTCGGGCCCGGGAGGGTGGGAGG + Intergenic
969326487 4:6447338-6447360 CATGGAAACGGGAGGGTGGGAGG - Intronic
969343402 4:6556613-6556635 CTGGGGAAGAGGTGTGTGGATGG - Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969599374 4:8166921-8166943 ATGGTGAATGGGTGGGTGGATGG - Intergenic
969618753 4:8268502-8268524 TCGGGGAATGGGAAGGTGGAGGG - Intergenic
972109552 4:35541135-35541157 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972738359 4:41866754-41866776 CTGGGGAGCGGAAGAGTGGAGGG - Intergenic
972836747 4:42880292-42880314 CTGTGGAACGTGAGGGGGCATGG - Intergenic
972935665 4:44131846-44131868 CTGGAGGAAGGGAGAGTGGAGGG + Intergenic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973545241 4:51974293-51974315 CTGGGGAATGGGATGGTTGTAGG - Intergenic
973656511 4:53053706-53053728 CTGAGGAACAGGAGGGTGTTGGG - Intronic
973712203 4:53641192-53641214 CTGGGGAAGGGCGGGGTGGGGGG + Intronic
973907635 4:55546956-55546978 CTGGGGAAAGGGAGAGTGAGGGG - Intronic
973926881 4:55747877-55747899 CTGGGGATGGGGAGTATGGAAGG + Intergenic
974107540 4:57487256-57487278 CAGGGGAATGTGAGGGTTGAGGG - Intergenic
975409750 4:74036890-74036912 GTGGGGAACTGGAGGGTGGGGGG - Exonic
975765764 4:77666217-77666239 TTGAGGGGCGGGAGGGTGGAGGG + Intergenic
979938059 4:126722381-126722403 GGGGGGGGCGGGAGGGTGGAGGG + Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
983559150 4:169083941-169083963 CTGGGGAGCGGAAGAGAGGAGGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986282274 5:6333404-6333426 CTGGGGATCTGGATGGTGGCAGG + Intergenic
987148131 5:15012446-15012468 TTGGGGAAGTGGAGGATGGAGGG + Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988062488 5:26190398-26190420 TTGGGGGATTGGAGGGTGGAGGG + Intergenic
988631296 5:32934259-32934281 TGGGAGAACGGGAGGGCGGAGGG - Intergenic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
990675590 5:58181161-58181183 TTGGGGACAGGGAGGGTGGGAGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992534843 5:77689421-77689443 CTTGGGAAGGGGTGGGTGGGTGG - Intergenic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994301426 5:98152726-98152748 GTGGGAAACTGGAAGGTGGAAGG - Intergenic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995044640 5:107632014-107632036 CTGGGCAACTGGTGGCTGGAAGG - Intronic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
995562300 5:113395901-113395923 CTGGGAAATGGGAGAGGGGAAGG + Intronic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996396056 5:123015201-123015223 CTGTTGAATGGGTGGGTGGATGG + Intronic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996893604 5:128453913-128453935 GTGAGGTACAGGAGGGTGGAAGG - Intronic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997852738 5:137347101-137347123 TTGGTGCAAGGGAGGGTGGAGGG - Intronic
997860800 5:137413943-137413965 CAGGAGAACAGGTGGGTGGAGGG - Intronic
997920625 5:137975918-137975940 ATGGGGGACGGGAGTGGGGAAGG + Intronic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998135534 5:139672442-139672464 CTGGGGAACTTAAGAGTGGAAGG + Intronic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999313707 5:150570364-150570386 TTAGAGAACTGGAGGGTGGAGGG - Intergenic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1001191535 5:169637169-169637191 CTGCCCAACGGGAGGGAGGAGGG + Intergenic
1001230083 5:169979147-169979169 ATGGGGAACAGAGGGGTGGAGGG - Intronic
1001287478 5:170434611-170434633 CTGGGGGACGGGTCGGTGGGTGG + Intronic
1001396400 5:171421731-171421753 CTTGGGGATGGAAGGGTGGACGG + Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1002854817 6:1027332-1027354 CTGGGGAACTGGGGGCAGGAAGG + Intergenic
1003186863 6:3839742-3839764 CTGGGGTATGGGAGGGAGGGAGG - Intergenic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1004061710 6:12204381-12204403 CGGGGGAAAGGGAGGGAGAAAGG - Intergenic
1004167564 6:13270389-13270411 CTGGGAAGCAGGAGGGTGGGGGG - Intronic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005311427 6:24563099-24563121 CTGGGGAACAGCAGGGGAGACGG - Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006096474 6:31659618-31659640 CTGGGAGACTGGAGGCTGGAGGG - Exonic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1007224851 6:40305976-40305998 CTGGGGGACAGGAGGTTGAAGGG - Intergenic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1007789177 6:44299191-44299213 ATGGGGATCAGGAGTGTGGATGG - Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1009952433 6:70413249-70413271 CTTGGGAACGGGAGCCTGGTAGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1013162143 6:107555131-107555153 TGGGAGAACGGGTGGGTGGATGG - Intronic
1013173709 6:107659887-107659909 CAGGGGAAGGGGAGGCGGGAGGG + Exonic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013450101 6:110272113-110272135 CGGGGGAATGGGTGGGAGGAGGG - Intronic
1014196237 6:118562937-118562959 CTTGGGGAAGGTAGGGTGGAAGG - Intronic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017539991 6:155391158-155391180 CTGGGGAAGGGTAGCGGGGAGGG + Intergenic
1018273155 6:162102182-162102204 CTGGGGGATGGGTGGGGGGACGG - Intronic
1018534941 6:164809870-164809892 TTGGGGAACAGGTAGGTGGATGG - Intergenic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019419856 7:945894-945916 CTGGGGCACGGGCAGGGGGAAGG + Intronic
1019427616 7:984810-984832 CAGGGGGACGGGAGTGGGGATGG + Intronic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019527992 7:1489405-1489427 CTAGGGAACCGGAGGGTGTGGGG + Intronic
1019549508 7:1595003-1595025 TGGATGAACGGGAGGGTGGATGG - Intergenic
1019683538 7:2366837-2366859 CTGGGTGGCGGGTGGGTGGATGG + Intronic
1019704557 7:2491339-2491361 ATGGGGGATGGGTGGGTGGATGG - Intergenic
1019704588 7:2491446-2491468 TTGGGGGATGGGTGGGTGGATGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019779125 7:2929436-2929458 CTGGGGAACGGGCGGCAGGCAGG - Intronic
1019950756 7:4370423-4370445 CTGGGGAAATGAAGGTTGGAAGG + Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022469784 7:30675098-30675120 CTGGGGCAAGGGAGAGTGGGAGG - Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1023362478 7:39430863-39430885 CTGGGGAAGGCCAGAGTGGATGG + Intronic
1023425874 7:40035766-40035788 TGGGGGGACGGGTGGGTGGAGGG - Intronic
1023654474 7:42406049-42406071 ATGGGGAGCTGGAGGATGGATGG + Intergenic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1024099489 7:46015712-46015734 CTGGAGCCAGGGAGGGTGGACGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024818238 7:53295884-53295906 CTGGGGCACTGGAGAGTGGTGGG + Intergenic
1024930362 7:54662670-54662692 CTCTGGAACGCGACGGTGGAAGG - Intergenic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026739031 7:72966977-72966999 CTGGGGAAGGGGAGGAGAGAAGG - Intronic
1027049127 7:75010562-75010584 CTGGGGAATGGCAGGGTCGAGGG - Intronic
1027104702 7:75398096-75398118 CTGGGGAAGGGGAGGAGAGAAGG + Intronic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029383893 7:100231085-100231107 CTGGGGAATGGCAGAGTCGAGGG + Intronic
1030294350 7:107906588-107906610 CTAGGAAATGGAAGGGTGGAAGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032616438 7:133477315-133477337 CAGGGGTTAGGGAGGGTGGAGGG - Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033513403 7:142082897-142082919 CTGGGGATTGTGAGGGTGTATGG + Intronic
1033754194 7:144384554-144384576 CTTGGGAACTGCAGGGTGAATGG - Intergenic
1033885600 7:145941170-145941192 GAGGGGAACAGCAGGGTGGAGGG - Intergenic
1033943235 7:146681500-146681522 GTGGGGAGTGGGAGGGTGGGAGG + Intronic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034479237 7:151307231-151307253 CCAGGGAACTGAAGGGTGGAGGG + Intergenic
1034766229 7:153723985-153724007 CTGGAGAACAGAAGGCTGGAGGG - Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034972952 7:155430536-155430558 CAGGGGTACGGGAGGATGGGAGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035164087 7:156973969-156973991 CTGGAGAACGGAAGGAGGGAAGG + Intergenic
1035307605 7:157943324-157943346 CTGGGGCATGGGAGGGGGCATGG - Intronic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1037041651 8:14243806-14243828 CTGAGGAACTGAAGGGTGGGAGG - Intronic
1037838925 8:22230532-22230554 CTGGGGAAGGGCAGGGTGTGAGG + Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038931878 8:32202654-32202676 AAGGGGAACGGGAGAGGGGACGG + Intronic
1039117963 8:34113342-34113364 CAGGGGCACGGGAAGGGGGAAGG + Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1039456822 8:37712701-37712723 TTTGGGAACAGGTGGGTGGAGGG + Intergenic
1040532971 8:48280867-48280889 GTGTGGAATGGGTGGGTGGATGG - Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041012753 8:53559990-53560012 TTGGGGAGCAGGAGGGTTGAGGG - Intergenic
1041839035 8:62248430-62248452 CTGGGGGTTGGGAGGGTGGTCGG - Intergenic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043511608 8:80955526-80955548 GTGGGGTAGGGGAGGGGGGAGGG + Intergenic
1044356158 8:91225015-91225037 CTGGGGCCAGGGAGGCTGGATGG - Intronic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045251524 8:100487045-100487067 AAGGGGAACAGGAGTGTGGAAGG - Intergenic
1045947794 8:107816449-107816471 GTGGGGTAGGGGAGGGGGGAGGG - Intergenic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1047465799 8:125112734-125112756 TTGGGGAAGGGAAGGGTGGGAGG + Intronic
1047698117 8:127423391-127423413 CCAGGGAAGTGGAGGGTGGAAGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1049070605 8:140352690-140352712 CTGGGGAAGGGGTGAGTGGGAGG - Intronic
1049104174 8:140601104-140601126 CTGGGGAACTTGAGAGTGGAGGG - Intronic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049359816 8:142207140-142207162 CTGGGGAATGGATGGGTGAATGG + Intergenic
1049359994 8:142207808-142207830 ATGGGGAATGGGAGGATGGATGG + Intergenic
1049664358 8:143836430-143836452 GTGGGGAAAGGGAGGTTGGGCGG + Intronic
1049752532 8:144291903-144291925 GTGGGGACCGGGAGGGAGCAGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050498688 9:6271284-6271306 CTTGGGCAGGGGAGTGTGGAGGG - Intergenic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051340372 9:16104684-16104706 TGGGTGAACGGGTGGGTGGATGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051524768 9:18031602-18031624 CTGGGGAAGGGGAGATGGGAGGG + Intergenic
1053752011 9:41266612-41266634 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054257532 9:62830942-62830964 GTGGGGAAGGGGAGGGACGAGGG - Intergenic
1054333781 9:63784780-63784802 GTGGGGAAGGGGAGGGACGAGGG + Intergenic
1054451429 9:65405405-65405427 CTCGGGCCCGGGAGGGTGGGAGG - Intergenic
1055791922 9:79931580-79931602 CTGGAGAGAGGCAGGGTGGAGGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058748589 9:108016614-108016636 CTGGGGCATGAGAGTGTGGAAGG + Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059427666 9:114231226-114231248 CTGGGGGAAGGGAGGATGGCAGG + Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1060124034 9:121024294-121024316 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060124067 9:121024349-121024371 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060768048 9:126309647-126309669 CTGGGGAGAGGGAGGGTGCTGGG - Intergenic
1061064376 9:128268297-128268319 CTGGGGACCGGGCCGGGGGAAGG - Intronic
1061239505 9:129361184-129361206 CTGAGGAACAAGAGGGTCGAGGG - Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061788022 9:133042473-133042495 CTGGGGAACTGTTGGCTGGAGGG - Intronic
1061920264 9:133778732-133778754 CTGGGGCCCGGGAGGGTCGAGGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062247725 9:135578060-135578082 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062247794 9:135578406-135578428 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062247863 9:135578752-135578774 CAGGTGAATGGGTGGGTGGATGG - Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062464631 9:136675582-136675604 CTGGGGACCGGGAGCAGGGACGG + Intronic
1062480314 9:136747998-136748020 CTGCAGAACTGGAGGCTGGAGGG - Intronic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062480345 9:136748119-136748141 TTGGAGAACTGGAGGCTGGAGGG - Intronic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1062552925 9:137098382-137098404 CTGGAGAACGGGAGGGTGAGTGG - Intronic
1203744842 Un_GL000218v1:35982-36004 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1203492345 Un_GL000224v1:118994-119016 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG + Intergenic
1203565262 Un_KI270744v1:83502-83524 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185583364 X:1227375-1227397 CTGAGGAATGGGTGGATGGATGG + Intergenic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1186862633 X:13689033-13689055 CTGGGGGACGGGCGCGGGGAAGG - Intergenic
1187344360 X:18449491-18449513 CTGGGGGGCGGCAGGGGGGAAGG - Intronic
1187416112 X:19094785-19094807 ATGGTGTACGGTAGGGTGGAGGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188111238 X:26197933-26197955 CTGAGGACCGTGAGGATGGAAGG + Intergenic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189123858 X:38425047-38425069 ATGGGGAACGGGAAGCTGGCTGG + Intronic
1189261591 X:39682769-39682791 ACGGGGAACGGGAGAGAGGAAGG + Intergenic
1189700584 X:43714237-43714259 ATGGGGACTGGAAGGGTGGATGG + Intronic
1189710727 X:43809045-43809067 CTGGGGAAAGGAAGGAGGGATGG - Intronic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1192180754 X:68914345-68914367 GAGGGGAGCGGGAGGGGGGATGG - Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194344379 X:92745189-92745211 GTGGGGAATGGGAGGAGGGAGGG - Intergenic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1195112171 X:101659303-101659325 CTGGGGGATGGGAGGGTGCCGGG + Intronic
1195174913 X:102305851-102305873 CGGGGGTGCGGGAGGGTGGGGGG + Intergenic
1195183952 X:102381242-102381264 CGGGGGTGCGGGAGGGTGGGGGG - Intronic
1195250066 X:103034931-103034953 CTGGGGAAACGTAGTGTGGAGGG - Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198711329 X:139507746-139507768 CTCTGGTACGGGAGGGTGGCAGG + Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200216282 X:154369502-154369524 CTGGGGAAAGGGGGGTGGGATGG - Intronic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200652724 Y:5861830-5861852 GTGGGGAATGGGAGGAGGGAGGG - Intergenic
1201158180 Y:11151025-11151047 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic