ID: 946291180

View in Genome Browser
Species Human (GRCh38)
Location 2:218746624-218746646
Sequence CTCTTTACACATATTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946291180_946291183 -3 Left 946291180 2:218746624-218746646 CCAAGCTGAATATGTGTAAAGAG 0: 1
1: 0
2: 0
3: 16
4: 153
Right 946291183 2:218746644-218746666 GAGGACTTCTGGTCTCACATTGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946291180 Original CRISPR CTCTTTACACATATTCAGCT TGG (reversed) Intronic
901033500 1:6322223-6322245 CTCTTGACGCATATTCAGGAGGG + Intronic
902537986 1:17132570-17132592 CTCTTTACTGATAATGAGCTGGG + Intergenic
902766001 1:18615724-18615746 TTCTTTACATATATTAGGCTAGG - Intergenic
906559184 1:46742537-46742559 CTTTTTACTCACATTCACCTCGG - Intergenic
907973711 1:59410306-59410328 GTCTTTACACATGTTCTTCTAGG + Intronic
913060702 1:115204105-115204127 CACTCTACACATGTGCAGCTTGG - Intergenic
915754417 1:158245448-158245470 TTCTTTACAAATATTATGCTAGG - Intergenic
918111564 1:181459356-181459378 CCCTTTACACATGTTCAGGTAGG + Intronic
918621642 1:186612295-186612317 CTCTTTACCCCTCTTCTGCTTGG - Intergenic
922275373 1:224072602-224072624 CTATTTTCACATATTGTGCTGGG - Intergenic
923995499 1:239489500-239489522 CCCTTTACACATTTTCAACAAGG + Intronic
1065095990 10:22281447-22281469 TTATTTACAGATTTTCAGCTGGG - Intergenic
1067517348 10:46962929-46962951 CTCTCTACACATTTACATCTTGG - Intronic
1067644900 10:48088900-48088922 CTCTCTACACATTTACATCTTGG + Intergenic
1068914814 10:62418693-62418715 CTGTTTAAGCATATTCATCTTGG + Intronic
1070098364 10:73360795-73360817 CTCTTTCTACATAATAAGCTGGG + Intergenic
1072596008 10:96872522-96872544 CTCTCTACAAAAAATCAGCTGGG + Intronic
1074099978 10:110347209-110347231 CTCTTTACATATATTAAGTTAGG + Intergenic
1074744207 10:116515156-116515178 CTCTTTACCCTTCTCCAGCTGGG - Intergenic
1074796642 10:116952841-116952863 CTTTTTACATAAACTCAGCTTGG + Intronic
1075809712 10:125216178-125216200 CTCTTTACACAGCTTCACCTGGG - Intergenic
1077753204 11:4996996-4997018 CTCTAAACACATACTCTGCTGGG + Intergenic
1079154876 11:17936863-17936885 CTCTTGACACATATTTAGGATGG - Intronic
1079803553 11:24900550-24900572 CTCCTTACACATTTTAAGTTTGG + Intronic
1083076569 11:60045468-60045490 CTATTTTCACATATTAAGCAAGG - Intronic
1085797935 11:79560665-79560687 CTATTTACATATATGCAGCTAGG + Intergenic
1089854803 11:121533908-121533930 CTCTGTATTCATATTCAGATTGG + Intronic
1090547652 11:127782890-127782912 CTCTTTAGGCCTATTAAGCTGGG + Intergenic
1093506171 12:19869422-19869444 CTCTTTTCAAACCTTCAGCTTGG + Intergenic
1095749449 12:45695045-45695067 CTCTTTACATATTTTAAGTTCGG + Intergenic
1097231431 12:57514118-57514140 CAGTTAACACATACTCAGCTTGG + Intronic
1099136465 12:78909995-78910017 CTGTTCACATATATCCAGCTTGG + Intronic
1100953475 12:99879218-99879240 CTCTTAACACCTCTTCAGATAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1107077234 13:36335896-36335918 CTCTTAAAATATATTCAGGTAGG - Intronic
1107892742 13:44928662-44928684 CTCTTTACCTAGATTCAGATTGG + Intergenic
1108009187 13:45986605-45986627 CTCTTTACATATATTTAGAAAGG + Intronic
1108210078 13:48129420-48129442 CTCATTACAAATATTCAACATGG + Intergenic
1108214190 13:48167719-48167741 CTCTTTTCTCATCTTCAGTTTGG - Intergenic
1109844681 13:67971889-67971911 CTTTTAACACATAATGAGCTTGG + Intergenic
1110075277 13:71232566-71232588 CTCTTTATACTTACTCTGCTTGG - Intergenic
1111969107 13:94892157-94892179 CTCCTTACATATATTAAGCTCGG + Intergenic
1114392063 14:22320325-22320347 TTCTTTACACATTTTCAGGAGGG - Intergenic
1115539638 14:34408298-34408320 TTCTTTACATTTATTCTGCTTGG - Intronic
1117187846 14:53260215-53260237 CTCTTTACCCTATTTCAGCTAGG + Intergenic
1117631025 14:57691695-57691717 CCATTTAAAGATATTCAGCTGGG + Intronic
1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG + Intergenic
1124710059 15:32001460-32001482 CTTTTTAAACATATCCTGCTAGG - Intergenic
1130647203 15:85738907-85738929 CTATTCACACATATACAACTCGG - Intronic
1132376044 15:101328779-101328801 TTGTTTACAGATATTCATCTAGG - Intronic
1133896123 16:9930628-9930650 CTCTTTGCAAATATTTATCTGGG - Intronic
1136916591 16:34207854-34207876 CTCTAAAGAAATATTCAGCTCGG + Intergenic
1138763230 16:59568758-59568780 CTTTTTAAACATTTTAAGCTAGG + Intergenic
1143139406 17:4732656-4732678 TTATTTACACATCTTCTGCTAGG - Intronic
1145773489 17:27510083-27510105 CTCTTCACACAAGTTCACCTGGG + Intronic
1147517390 17:41133882-41133904 CTCTTTACATATTTTAGGCTTGG - Intergenic
1149181119 17:53938005-53938027 CTCTTTGAAATTATTCAGCTGGG + Intergenic
1149303499 17:55327079-55327101 CTCTTTGGACATCTTTAGCTAGG + Intergenic
1150665559 17:67133440-67133462 TTCTTTAAAAATATTCAGGTTGG + Intronic
1152358435 17:79818098-79818120 CTCTGAAGCCATATTCAGCTTGG + Intergenic
1153126937 18:1804628-1804650 CACTTTACAAATTTTAAGCTGGG - Intergenic
1156987601 18:43366834-43366856 CTCTTTAACCCTATTTAGCTGGG + Intergenic
1158575118 18:58630540-58630562 CTCTTTACATTTATTTTGCTAGG - Intergenic
925507200 2:4580812-4580834 CTGTTTAAATATATTCAGTTTGG + Intergenic
926356502 2:12045576-12045598 CTTTTTAGTCATTTTCAGCTGGG + Intergenic
926667080 2:15537323-15537345 CTGTTTACACAGACTCATCTTGG - Intronic
931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG + Intergenic
931899664 2:66773346-66773368 CTCTTTTCACATTTGCATCTGGG + Intergenic
932545988 2:72710288-72710310 CTCTTTACTGATATTGAGTTGGG - Intronic
933034974 2:77385021-77385043 CTTTTTGCACATTTTTAGCTTGG - Intronic
934310864 2:91862391-91862413 CTCTTTATACAGATTCTGATAGG - Intergenic
934865141 2:97802185-97802207 CTCTTTACACATTTTTAGAAGGG + Intronic
939255735 2:139742977-139742999 CTCTATACATATATTAAGTTTGG + Intergenic
939508848 2:143081957-143081979 CTCCTTACATATCTTAAGCTTGG + Intergenic
940514181 2:154659229-154659251 CTCTTTACCCATACTCACCCTGG + Intergenic
941195468 2:162445553-162445575 CTCTTAAATAATATTCAGCTTGG - Intronic
942193672 2:173496148-173496170 TTATTTACACATACTCAACTGGG + Intergenic
944734015 2:202544664-202544686 ATCTTTACACACATTTTGCTTGG + Intronic
946291180 2:218746624-218746646 CTCTTTACACATATTCAGCTTGG - Intronic
1170257992 20:14367749-14367771 CTCTTTACAGTTATTCGTCTTGG + Intronic
1171204805 20:23270525-23270547 CTCTGTACACATTTTTAGGTTGG - Intergenic
1171757142 20:29120818-29120840 CTCGTCACACATACTCAGCCAGG - Intergenic
1173337409 20:42124049-42124071 CTCTTTACTCAGATGCAGCGTGG - Intronic
1174743172 20:53035650-53035672 CCCTTTCCTCATATCCAGCTTGG - Intronic
1177006430 21:15678134-15678156 CTCTTTACAGATTATCAACTAGG - Intergenic
1181591832 22:23890028-23890050 CAGTTTACACATATCCACCTAGG + Intronic
949196437 3:1314990-1315012 CTTTTTACAAAAATTGAGCTTGG - Intronic
949503824 3:4707460-4707482 CTCTCTACACACACTCATCTTGG - Intronic
950498306 3:13347631-13347653 CTGTTGATACATATTCAGCACGG - Intronic
952164280 3:30729401-30729423 CCCTTTCCACATATTCACATAGG - Intronic
953520737 3:43640243-43640265 CTCTTTCCACATTATAAGCTGGG - Intronic
955307326 3:57846852-57846874 CTCTTTATCCATTTTCGGCTAGG - Intronic
955580711 3:60417801-60417823 CTCTTAACACATAATTAGCCAGG - Intronic
955754235 3:62211998-62212020 CACTTTACTCAGATTCTGCTGGG + Intronic
956449660 3:69361172-69361194 TTCTTTACTGATATTCAGATTGG + Intronic
965008041 3:163051401-163051423 CTTCTTACACAAATTTAGCTGGG + Intergenic
970219573 4:13796952-13796974 CTCTTTACACAGATCCAGAGAGG + Intergenic
971483660 4:27138210-27138232 CTGTTTAAACATATTCAGATAGG - Intergenic
972516983 4:39818236-39818258 CTCTCTACACATACACAGCTTGG - Intergenic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
976051798 4:81018640-81018662 CTCTTTCCACATATAGAGATAGG - Intergenic
977479231 4:97553691-97553713 CTCTTGACACATTCTCAACTTGG + Intronic
977802457 4:101252722-101252744 TTCTTTACACATTTGCAGCCTGG + Intronic
978142964 4:105338563-105338585 ATCTTTGCAGATATTCAGGTGGG + Intergenic
980156014 4:129107233-129107255 CTCATTACAAATATTAACCTTGG + Intronic
980225754 4:129982866-129982888 TACTTTGCAAATATTCAGCTTGG + Intergenic
980541146 4:134198236-134198258 CTCTCTACATATATACACCTAGG - Exonic
982408527 4:155046461-155046483 CTCATAAAACATAGTCAGCTGGG - Intergenic
983180986 4:164648851-164648873 CCCTTTACACATTTTAAGTTTGG + Intergenic
984072380 4:175131269-175131291 TACTTTTCACATATTCACCTGGG - Intergenic
986985658 5:13498525-13498547 CTTAGTACACATAGTCAGCTAGG - Intergenic
987844746 5:23268530-23268552 CTCCTTACATATTTTAAGCTTGG - Intergenic
989550263 5:42726689-42726711 ATATTCACACATATTCATCTAGG + Intergenic
990856768 5:60276391-60276413 CTCCTTACACATTTTAAGTTAGG + Intronic
991395551 5:66201155-66201177 CTCTTTACACATGTTAAGTTTGG - Intergenic
991725798 5:69534735-69534757 CTCTTTCCACATAGTCAGATGGG - Exonic
991869156 5:71093129-71093151 CTCTTTCCACATAGTCAGATGGG + Intergenic
993774625 5:91976013-91976035 GTCTTTTCACATATTGAGGTGGG + Intergenic
994963376 5:106634462-106634484 TTCTTTACACATGATCATCTGGG - Intergenic
995534545 5:113121916-113121938 CTCTTTCCAAATATCCAGGTAGG + Intronic
995783485 5:115802923-115802945 CTATATACACATATTCAGCATGG - Intergenic
996233277 5:121092746-121092768 CTCTTTACACATAGGCACCAGGG - Intergenic
996259156 5:121444897-121444919 TGCTTTACAAATAATCAGCTTGG + Intergenic
1000601085 5:163275162-163275184 CTCTTTACATATTTTAAGTTTGG + Intergenic
1005254135 6:23981796-23981818 CTCTTTATAAATACTCAGGTTGG + Intergenic
1008855452 6:56080878-56080900 CTCTTTACTGATAATCAGATTGG - Intronic
1009641368 6:66341742-66341764 CTCATAACTCATATTCAGTTGGG - Intergenic
1010931371 6:81807717-81807739 CTCTTTACGCAAGTTGAGCTTGG - Intergenic
1012015831 6:93849993-93850015 CTCTTTACACTTATGTACCTAGG + Intergenic
1012880385 6:104781111-104781133 CTCTTTGCAATTATTCTGCTGGG + Intronic
1012895183 6:104939975-104939997 ATATATACACATATTTAGCTTGG - Intergenic
1014987222 6:128026312-128026334 CACTTTACACATATACAAATAGG - Intronic
1015775405 6:136809167-136809189 ATCTTTACTCAGACTCAGCTGGG - Intergenic
1015845505 6:137516224-137516246 CTCCTTACATATTTTAAGCTTGG - Intergenic
1015861389 6:137683992-137684014 TTCTTGACTCATATTCAGCTTGG + Intergenic
1016083436 6:139882849-139882871 CTTTTACCACATATTCATCTGGG - Intergenic
1017737314 6:157377209-157377231 CTCTTTACATATTTTAAGTTTGG - Intergenic
1018360475 6:163062738-163062760 TTCTTTTCACCTATGCAGCTGGG - Intronic
1020686549 7:11303074-11303096 TTCTTTACACATATTTTGATTGG - Intergenic
1022255469 7:28652719-28652741 CCTCTTACACATATTCACCTGGG + Intronic
1026610146 7:71851250-71851272 CACATCACACATATACAGCTGGG + Intronic
1027647454 7:80821218-80821240 CACTTTACACATATTCATTCAGG + Intronic
1028895302 7:96034368-96034390 CTCATTACACATATTTATTTAGG + Intronic
1035412310 7:158654671-158654693 ATCTTTACACACAGTCAGGTAGG + Exonic
1037467394 8:19173453-19173475 CTCTTTACATATTTTAAGTTTGG - Intergenic
1041978044 8:63821744-63821766 CTCTTTATTCATTTTCAGCAAGG - Intergenic
1043500406 8:80848674-80848696 ATCTTTACAAAAAATCAGCTAGG + Intronic
1044429700 8:92094961-92094983 CTCTTTAAACCTATTCAGACTGG + Intronic
1044694322 8:94907602-94907624 CTCATTCCAATTATTCAGCTTGG - Intronic
1044811075 8:96062803-96062825 CTCTATCTACATACTCAGCTGGG - Intergenic
1046181989 8:110661678-110661700 CTCTTTAAAAATTGTCAGCTTGG - Intergenic
1047503405 8:125459871-125459893 CAGTTTCCACATATTCAGCATGG + Intergenic
1047596904 8:126387015-126387037 CTCCTTACACATTTTAAGTTAGG - Intergenic
1047930706 8:129726002-129726024 CTCTTTAAATAAATTCAGCCAGG - Intergenic
1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG + Intergenic
1048415829 8:134226721-134226743 CTCTTTACATATTTTAAGTTTGG + Intergenic
1052612510 9:30793853-30793875 CTGATTACACATATTGAGCTAGG - Intergenic
1054956977 9:70922803-70922825 TTCTTTCCACATATTGAGCTTGG + Intronic
1058151119 9:101464742-101464764 CTGTTTACACTTATTCAGGCTGG + Intergenic
1058260670 9:102826552-102826574 CTATTTAGTAATATTCAGCTAGG - Intergenic
1059662020 9:116411220-116411242 CTCTAGACACATACTCATCTTGG - Intergenic
1059839598 9:118198617-118198639 CTCTTTAGAAATATTCGGCCAGG + Intergenic
1059981954 9:119783065-119783087 GTCTTTACACATTTTCCTCTGGG - Intergenic
1202801356 9_KI270720v1_random:2527-2549 CTCGTCACACATACTCAGCCAGG + Intergenic
1186184094 X:7002978-7003000 CTCTGTCCACATATTCAGGTAGG + Intergenic
1186557501 X:10575156-10575178 CTCTTAACCCCTATTCACCTGGG + Intronic
1186811448 X:13192836-13192858 CTCATTACAGACATTCAGGTGGG - Intergenic
1197673503 X:129304505-129304527 CTGTTTACAAATATTAACCTAGG + Intergenic
1198021924 X:132667353-132667375 CTCTTTGCACATTTTGAGATAGG - Intronic
1199001351 X:142640635-142640657 CATTTTATACATATTCAGGTAGG - Intergenic