ID: 946294661

View in Genome Browser
Species Human (GRCh38)
Location 2:218774345-218774367
Sequence GTACCTCTATTCCTAACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946294661_946294663 2 Left 946294661 2:218774345-218774367 CCTATGGTTAGGAATAGAGGTAC No data
Right 946294663 2:218774370-218774392 CGTGACACCAGGCAGAAACAAGG No data
946294661_946294666 27 Left 946294661 2:218774345-218774367 CCTATGGTTAGGAATAGAGGTAC No data
Right 946294666 2:218774395-218774417 GTTTCTGTTAATGGCAGCATTGG No data
946294661_946294665 18 Left 946294661 2:218774345-218774367 CCTATGGTTAGGAATAGAGGTAC No data
Right 946294665 2:218774386-218774408 AACAAGGATGTTTCTGTTAATGG No data
946294661_946294662 -9 Left 946294661 2:218774345-218774367 CCTATGGTTAGGAATAGAGGTAC No data
Right 946294662 2:218774359-218774381 TAGAGGTACATCGTGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946294661 Original CRISPR GTACCTCTATTCCTAACCAT AGG (reversed) Intergenic