ID: 946294663

View in Genome Browser
Species Human (GRCh38)
Location 2:218774370-218774392
Sequence CGTGACACCAGGCAGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946294660_946294663 3 Left 946294660 2:218774344-218774366 CCCTATGGTTAGGAATAGAGGTA No data
Right 946294663 2:218774370-218774392 CGTGACACCAGGCAGAAACAAGG No data
946294661_946294663 2 Left 946294661 2:218774345-218774367 CCTATGGTTAGGAATAGAGGTAC No data
Right 946294663 2:218774370-218774392 CGTGACACCAGGCAGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946294663 Original CRISPR CGTGACACCAGGCAGAAACA AGG Intergenic