ID: 946295105

View in Genome Browser
Species Human (GRCh38)
Location 2:218777789-218777811
Sequence CTGCTGCCCTTGGGCAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946295095_946295105 28 Left 946295095 2:218777738-218777760 CCTGTCAGGGAAACATCTCAAGC No data
Right 946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946295105 Original CRISPR CTGCTGCCCTTGGGCAACAT GGG Intergenic
No off target data available for this crispr