ID: 946297126

View in Genome Browser
Species Human (GRCh38)
Location 2:218794138-218794160
Sequence CAAGCTCCTCCCTCTGCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 1, 2: 10, 3: 35, 4: 257}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946297125_946297126 -6 Left 946297125 2:218794121-218794143 CCTGGTACGGGAGAGGACAAGCT 0: 1
1: 0
2: 1
3: 11
4: 116
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297113_946297126 27 Left 946297113 2:218794088-218794110 CCCATCTCACAGATTGAATCCCC 0: 2
1: 19
2: 61
3: 155
4: 321
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297123_946297126 -2 Left 946297123 2:218794117-218794139 CCACCCTGGTACGGGAGAGGACA 0: 1
1: 0
2: 0
3: 20
4: 139
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297117_946297126 8 Left 946297117 2:218794107-218794129 CCCCAGGTTACCACCCTGGTACG 0: 1
1: 0
2: 3
3: 5
4: 86
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297112_946297126 28 Left 946297112 2:218794087-218794109 CCCCATCTCACAGATTGAATCCC 0: 20
1: 44
2: 47
3: 39
4: 194
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297111_946297126 29 Left 946297111 2:218794086-218794108 CCCCCATCTCACAGATTGAATCC 0: 17
1: 48
2: 53
3: 60
4: 475
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297124_946297126 -5 Left 946297124 2:218794120-218794142 CCCTGGTACGGGAGAGGACAAGC 0: 1
1: 0
2: 0
3: 8
4: 80
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297114_946297126 26 Left 946297114 2:218794089-218794111 CCATCTCACAGATTGAATCCCCA 0: 2
1: 5
2: 27
3: 89
4: 296
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297120_946297126 6 Left 946297120 2:218794109-218794131 CCAGGTTACCACCCTGGTACGGG 0: 1
1: 0
2: 4
3: 16
4: 76
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257
946297118_946297126 7 Left 946297118 2:218794108-218794130 CCCAGGTTACCACCCTGGTACGG 0: 1
1: 0
2: 2
3: 17
4: 90
Right 946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG 0: 1
1: 1
2: 10
3: 35
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946297126 Original CRISPR CAAGCTCCTCCCTCTGCAAA CGG Intronic
900519949 1:3100660-3100682 AAAGCTCCTCCCTGGGCAAACGG - Intronic
901260650 1:7868337-7868359 CAAGCTCATCCTCCTGCAACTGG - Intergenic
901451470 1:9339060-9339082 CAAGCTCCACCGTCTCCAAGGGG - Intronic
902199559 1:14823330-14823352 CAACTTCCTTCCTCTGGAAACGG - Intronic
902652474 1:17845518-17845540 ACAGCTCCTCCCTCTGCACATGG - Intergenic
903942858 1:26943529-26943551 CAAGCTCCTACCTCTGGGAAGGG + Intronic
905183457 1:36180007-36180029 AAGGCTTCTGCCTCTGCAAAGGG - Exonic
905590573 1:39159745-39159767 TAAGCACCCTCCTCTGCAAATGG - Intronic
905905200 1:41613169-41613191 CAAGCTGCGTCCTCTCCAAATGG + Intronic
907451106 1:54546461-54546483 CAGAATCCTCCCTCTGCAGAAGG - Intronic
907649882 1:56285112-56285134 GAATCTCCCTCCTCTGCAAAGGG - Intergenic
908191632 1:61709693-61709715 CAATCTCCTGCCTCTGATAAAGG + Intronic
908296393 1:62717679-62717701 CATGCTCCTCCTTTTCCAAATGG + Intergenic
911101353 1:94098298-94098320 CATGCTTCTTCCTCTGGAAATGG - Intronic
911281342 1:95933265-95933287 CAGGCTCCTCCCCCTGCACAAGG + Intergenic
912437815 1:109674211-109674233 CAAGAGCCTCCCTGTGGAAAAGG + Intronic
912440325 1:109692670-109692692 CAAGAGCCTCCCTGTGGAAAAGG + Intronic
912443625 1:109716808-109716830 CAAGAACCTCCCTGTGAAAAAGG + Intronic
913097148 1:115529254-115529276 CAATCTCCTCCAACTGCCAATGG - Intergenic
915741143 1:158119217-158119239 CAAGCTCCTCTCTGTGCAGTGGG - Intergenic
917214743 1:172666244-172666266 CATGCTTCTCCCTCTTCACATGG - Exonic
918041252 1:180915354-180915376 CATGCTCTTCCCTCTCCAAGGGG - Intronic
918175543 1:182041114-182041136 CAGGCTCCTCCCCCTTCAAATGG + Intergenic
920298004 1:204971154-204971176 CAAGTTCCGCTCTCTGCTAAGGG + Intronic
921885080 1:220297247-220297269 CTGGCCCCTGCCTCTGCAAAGGG - Intergenic
922901166 1:229137777-229137799 CAAGCTCCCCTATATGCAAATGG - Intergenic
923413348 1:233731402-233731424 CACGCTCCTCCCCCTGCAAATGG + Intergenic
923512946 1:234668574-234668596 CAGGCTCCTCCCTCTTGAATGGG + Intergenic
1063665996 10:8061002-8061024 CCACCTCCACCCCCTGCAAAAGG - Intronic
1064138109 10:12767842-12767864 CAAAGTCCTCCCTCTGCTCACGG - Intronic
1064552447 10:16518370-16518392 TAAGCTGCTACTTCTGCAAAAGG - Intronic
1064788250 10:18923823-18923845 CAAGACCCTCCGTCGGCAAAAGG - Intergenic
1066049713 10:31621973-31621995 CAGGCTCCTCCCCCTGCATAAGG - Intergenic
1067266250 10:44748037-44748059 TTAGCTCCTCCATCTGCAGATGG + Intergenic
1067730853 10:48810646-48810668 CAAGCCCCTCCCTCCGCACACGG + Exonic
1068338285 10:55667189-55667211 TAGGCCCCTCCCTCTTCAAAGGG + Intergenic
1068534315 10:58223721-58223743 CAGGTTCCTCCCTCAGCACATGG - Intronic
1069712604 10:70499639-70499661 CCTGCTCCTCCCTCTGCCACTGG + Intronic
1070988840 10:80713763-80713785 CTAGCTGCTCCCTCTTCACACGG + Intergenic
1072580689 10:96737407-96737429 CAGGTTCCTCCCTCTACACATGG - Intergenic
1075965024 10:126603867-126603889 TGGGCTCCTCCCTCTGCATATGG - Intronic
1076381115 10:130025093-130025115 TCAGTTCCACCCTCTGCAAATGG + Intergenic
1076504745 10:130964238-130964260 CAGGCTCCTACCTCTGCACTGGG - Intergenic
1076983157 11:216005-216027 CCAGCTCCTCCCTCTGAAGGTGG - Exonic
1077028584 11:452706-452728 GAAGCTCCTTCCTCTGCACAGGG - Intronic
1078535813 11:12172782-12172804 CAGTCTCCTCCCCCTGCTAATGG + Intronic
1080847354 11:36037713-36037735 CAAGCTGCCCCCTCTGAAACTGG + Intronic
1081043551 11:38242294-38242316 CAGGCTCCTCCCTCAACAAATGG + Intergenic
1081781943 11:45719105-45719127 CAAGTTCTTCCCTCTGCCAGTGG - Intergenic
1083731009 11:64652671-64652693 CCAGCTCCTCCATCTACAATGGG + Intronic
1085125585 11:74000095-74000117 CCAGCTCCTGCTTCTGCAAAAGG - Intergenic
1086458878 11:86985831-86985853 CAGGCTCCTTCCCCTGCAAATGG - Intergenic
1087083422 11:94193846-94193868 CAAGCCCCTCACTGGGCAAATGG - Intergenic
1087492768 11:98849025-98849047 CAGGCTCCTCCCTCTGCATAAGG - Intergenic
1089611367 11:119671341-119671363 CAAGCTGCTCCCTTTGTAAGAGG - Intronic
1089851328 11:121499262-121499284 CTGGCTCCTCCTTCTGCACATGG + Intronic
1090324562 11:125873850-125873872 GAACCCCCTCCCTCTGCACAGGG + Intergenic
1093268770 12:17031747-17031769 CAAGCTGCTTCCTCTGTCAAGGG + Intergenic
1093788669 12:23221293-23221315 CACACTCATCCCTCTGTAAAAGG - Intergenic
1097118792 12:56717634-56717656 GTAACTCCTCCCTCTCCAAAAGG - Intronic
1097278896 12:57832265-57832287 CAAGCTCCTGGCTCTGGAAGAGG + Intronic
1099149968 12:79098174-79098196 CACGAATCTCCCTCTGCAAAAGG + Intronic
1099669591 12:85673543-85673565 CAAGTCCCTCCCTCGGCACATGG + Intergenic
1100032561 12:90210531-90210553 CAGGACCCTCCCTCTGCATATGG - Intergenic
1100233539 12:92634354-92634376 CAGGCTCCTCCCTCTGCATAAGG + Intergenic
1100271556 12:93029948-93029970 CAGGCTCCTCCCCCTGCAAATGG - Intergenic
1100617358 12:96241390-96241412 CAGACTCCTTCCTCTTCAAAGGG + Intronic
1100766797 12:97875195-97875217 CTGGCTCCTCCCACTGCATAAGG + Intergenic
1101137256 12:101757018-101757040 CAGGCTCATCCCTCTGCATGGGG + Intronic
1101273139 12:103169358-103169380 GAACCTCTTCCCTCTGCACAAGG + Intergenic
1101537894 12:105636567-105636589 GAAGCTCTTCCGTCTGCAACAGG + Intergenic
1102355518 12:112231524-112231546 CGAGTTCCTCTCTCGGCAAATGG + Exonic
1104220331 12:126776440-126776462 CAAGCTCCTCCCACTGCATAAGG - Intergenic
1104339095 12:127930468-127930490 CATGCTCAACCCTCTGCAGAAGG - Intergenic
1105851555 13:24340290-24340312 CCAGCTCCTCCCGCTGCTACCGG - Intergenic
1106172367 13:27298956-27298978 CAAACTTCTCATTCTGCAAATGG - Intergenic
1107265007 13:38542981-38543003 CAAGCTCGTGCCTTTGTAAATGG + Intergenic
1107290437 13:38846701-38846723 ACAGATCCTCCCTCTGCAGATGG + Exonic
1109462993 13:62687942-62687964 CAAGCTCCTCCCACTGCAAAGGG + Intergenic
1109826377 13:67727609-67727631 CAGGCTCCTCCCTCAACATATGG + Intergenic
1110524661 13:76522134-76522156 CAGGCTCCTCCCCCTGAATAAGG + Intergenic
1112376214 13:98843830-98843852 GCAGCTCTTCCCACTGCAAATGG - Intronic
1112565006 13:100545304-100545326 CCAGCTTCCCCATCTGCAAAAGG - Intronic
1115694427 14:35881327-35881349 CAAGCTGCTCAGTCTGCATATGG + Intronic
1119032960 14:71206777-71206799 CATGCTCCAGCCTCTGCACAAGG + Intergenic
1119170698 14:72534177-72534199 CAAGACCCTCCCCCAGCAAAAGG + Intronic
1119171632 14:72540292-72540314 CAAGCGGCTCCCTCTGCAGAAGG + Intronic
1119703582 14:76770765-76770787 CCAGCTCCTCCTTCTGCCAGTGG + Intronic
1121126776 14:91412894-91412916 TAAGCTTCTACATCTGCAAAAGG + Intronic
1121518497 14:94569827-94569849 CAAGTTTCTGCCTCTGGAAAGGG + Exonic
1122100160 14:99402128-99402150 CAAGCTCCTCCCTATGCTAAAGG + Intronic
1123205960 14:106713661-106713683 CAAAAGCTTCCCTCTGCAAAGGG - Intergenic
1125687608 15:41572773-41572795 CAAGTCCCTCCCTCTAGAAAGGG - Intronic
1126666164 15:51077789-51077811 CAGGCTCCTCCCCCTGCCCAAGG - Intronic
1126905681 15:53362324-53362346 CAAGCCCCTCATTTTGCAAATGG - Intergenic
1128861039 15:71072493-71072515 CGGGCCCCTTCCTCTGCAAAAGG - Intergenic
1129908538 15:79207122-79207144 TAAGCTCCTCCCTCTGCCTTAGG + Intergenic
1130688209 15:86057662-86057684 CAAGGTCCTCTCTCTGCACGTGG + Intergenic
1131946891 15:97631971-97631993 CAGGCTCCTCCCTCAACACATGG - Intergenic
1133438274 16:5798972-5798994 TCAGATCCTTCCTCTGCAAAAGG + Intergenic
1133661664 16:7924262-7924284 TAAGCTCCTCCCACTGCCAGGGG + Intergenic
1134053234 16:11152309-11152331 CAAGATCTTCCCTCTGCAGGCGG + Intronic
1135951484 16:26918365-26918387 CCAGCTCCTCCCTCTGGGCAAGG + Intergenic
1136265957 16:29118553-29118575 CAAGCTCCGCCCTGTGCAGATGG - Intergenic
1137523874 16:49216735-49216757 AGAGCTCCTCCCTCTCCACAGGG - Intergenic
1138770448 16:59656436-59656458 CAAGCTGAGCCCTCTGCAGATGG + Intergenic
1139328132 16:66167583-66167605 TAAGCTCCTCCTTCTACTAAGGG - Intergenic
1139843855 16:69904749-69904771 CTGGTTCCTCCCACTGCAAAAGG - Intronic
1141106666 16:81239463-81239485 GACTCTCCTCCCTTTGCAAACGG - Intronic
1141598716 16:85112628-85112650 CAAGAGCCTCCATCTTCAAAGGG - Intergenic
1142054769 16:87986459-87986481 CAAGCTCCGCCCTGTGCAGATGG - Intronic
1142429424 16:90018561-90018583 CAAGTTCCTACCTAGGCAAATGG + Intronic
1142703031 17:1676014-1676036 CTAGCTCCTCCCTCTGAGACTGG + Exonic
1143992245 17:10975529-10975551 CCAGCTCCTTCATTTGCAAAGGG + Intergenic
1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG + Intergenic
1145318255 17:21747879-21747901 CAATCTCCTCCCTGTGAAATGGG - Intergenic
1145843048 17:28012536-28012558 CAAGCACCGCCATCTGCAATTGG + Intergenic
1146762674 17:35492244-35492266 CAAGCTCCTCCTTCTGGGAATGG - Intronic
1147553888 17:41464191-41464213 TAAGCTCCTCCATCTGCAGTTGG + Exonic
1148226803 17:45904508-45904530 CAAGATCCTGTCTCTACAAAAGG + Intronic
1148913112 17:50953908-50953930 CATGCCCCTACCTCTGCACAGGG - Intergenic
1149350159 17:55778670-55778692 CAAGGTCCTCTCTCTGTTAAGGG + Intronic
1149647418 17:58250199-58250221 CAAGGTCCTGCCGCTACAAAGGG - Intronic
1150839145 17:68591769-68591791 CAGGCTCCTCCCCACGCAAACGG - Intronic
1153172146 18:2328484-2328506 CTGGCTCCTACCTCTGCAACTGG + Intergenic
1155772673 18:29722470-29722492 CAGGCTCCTCCCACAGCACATGG + Intergenic
1156137803 18:34065116-34065138 TAAGCTCCTTTCTCTGCTAAAGG - Intronic
1156311587 18:35927201-35927223 CATGCTCCCCCTCCTGCAAAGGG + Intergenic
1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG + Intergenic
1156881698 18:42088144-42088166 CCACCTCCTCCCACTGCAACTGG + Intergenic
1158942199 18:62415066-62415088 CAAGCTCCTCAGACAGCAAAAGG + Intergenic
1160416679 18:78716874-78716896 CCTGCTCCTCCCTCTGGGAACGG + Intergenic
1160936315 19:1597414-1597436 CATTCTCCTCCCTCTGCACGTGG + Exonic
1163319852 19:16568249-16568271 CCCTCTCCTCCCTCAGCAAAGGG + Intronic
1163624989 19:18384075-18384097 CAAACTCCTCCTCCTGGAAATGG - Intronic
1164903182 19:31945738-31945760 CCAGCTTCTCCCACTGGAAAAGG + Intergenic
1164910455 19:32006864-32006886 GAACCTTCTCCCTCTGCAGATGG - Intergenic
1165480073 19:36057947-36057969 CAAGATCCTACATCTGCAAGTGG - Intronic
1168427954 19:56254432-56254454 CAATGTCCTCCCTTTGGAAAGGG + Intronic
925277383 2:2659860-2659882 CAAATTCCTCCCACTGAAAATGG + Intergenic
928288974 2:30020799-30020821 CAAGCACCTGCAACTGCAAATGG + Intergenic
928316691 2:30252035-30252057 CAAGTTCCATCCTTTGCAAATGG - Intronic
929439763 2:41955911-41955933 CAGGCTCCATCCTCTGCCAAAGG + Intergenic
929612251 2:43279834-43279856 CTTGCTCCTCACTCTGCAGAAGG + Exonic
930229030 2:48825092-48825114 CAAAATCCTTCCTCAGCAAATGG - Intergenic
931744323 2:65278761-65278783 CAGGCTCCTCCCTCTGCTCCTGG - Intergenic
935055753 2:99565253-99565275 CAGCCTCCTCCCTCAGCAATTGG + Intronic
935634029 2:105236302-105236324 CAAGCTGTTCCCACAGCAAAGGG + Intergenic
935887176 2:107634904-107634926 CAAGTTCCTCCCTCGACACATGG + Intergenic
937413329 2:121695311-121695333 CAAGTGCCTCCCACAGCAAAAGG + Intergenic
938213100 2:129485202-129485224 CCAGCTCCACCCTCCACAAAAGG - Intergenic
938307952 2:130267407-130267429 TATGCTCCTCTCTCTGTAAACGG + Intergenic
943492389 2:188571308-188571330 CAAGCTCATCACTATGAAAAAGG + Intronic
943880403 2:193137403-193137425 CAGGTTCCTCCCACTACAAATGG - Intergenic
945848477 2:214977080-214977102 CAAACTCATATCTCTGCAAAAGG + Intronic
946297126 2:218794138-218794160 CAAGCTCCTCCCTCTGCAAACGG + Intronic
946652952 2:221913881-221913903 CAGGCTCCTCCCCCTGCAAAGGG + Intergenic
948459565 2:238122641-238122663 CAAGCCCCTCACTCTGCCAGGGG + Intronic
948896663 2:240930870-240930892 CCAGGCCCTCCCTCTGCAGATGG + Intronic
1169483941 20:6010521-6010543 CATTCTCCTCCCTCAGCAGATGG + Intronic
1170946991 20:20900430-20900452 CAGGATCCTCCCCCTGCATAAGG + Intergenic
1171228463 20:23461123-23461145 CAAGACCCTCCATCAGCAAAAGG + Intergenic
1172938005 20:38634444-38634466 CAAGCTCCACCTCTTGCAAACGG - Intronic
1173055765 20:39611132-39611154 CAATCCCTTCACTCTGCAAAAGG - Intergenic
1173252400 20:41371107-41371129 CAAGCTCTTCCTGCTGCAGATGG + Intergenic
1174535916 20:51251413-51251435 CAGGCTCCTCCCCCTGCCAAGGG - Intergenic
1175050794 20:56153335-56153357 CAGGTGCCTCCCTCTGCACAGGG + Intergenic
1175122939 20:56730311-56730333 CACTCTCCTTCCTCTGAAAACGG - Intergenic
1175645215 20:60665021-60665043 CAAGCCCCACCCTCAGCAGAAGG + Intergenic
1175789599 20:61733003-61733025 CCAGCTCCCACCTCTGAAAACGG + Intronic
1175935437 20:62511784-62511806 CCAGCTCCTCCCTGTGCTGATGG + Intergenic
1176660469 21:9630301-9630323 CAACCTCCTCTCCATGCAAATGG - Intergenic
1176981064 21:15381355-15381377 CATGCTCCCCCTTCTGTAAAGGG + Intergenic
1177607313 21:23398274-23398296 CAAGCTTCTCCTCCTGAAAATGG + Intergenic
1178411040 21:32363967-32363989 CAAGACCCTGCCTCTACAAAAGG - Intronic
1179905536 21:44420854-44420876 AAAATACCTCCCTCTGCAAAAGG - Intronic
1182359424 22:29738026-29738048 CAGGCCCCTCCCTCTGGCAACGG + Intronic
1182775353 22:32827433-32827455 CAAGCTCCTACTTGTACAAATGG + Intronic
1182947842 22:34341450-34341472 CAATGTCTTCCCTCTGAAAAAGG + Intergenic
1183186329 22:36293549-36293571 CCAGCTCCTCCCTCTCCTCAAGG - Intronic
1184342050 22:43891503-43891525 CACGATCCCTCCTCTGCAAATGG + Intronic
1184704819 22:46203731-46203753 CAGGCTCCTCCCGCTGCGCAAGG + Intronic
1185151718 22:49167609-49167631 CAAGCTCCTGTCTCTGCACCTGG - Intergenic
1185272359 22:49935270-49935292 CGGGGTCCTTCCTCTGCAAAGGG - Intergenic
949220924 3:1632942-1632964 GAAGCTCCTCTCTCTAAAAAGGG + Intergenic
950086215 3:10259794-10259816 CAAGCTCTTCCCACTGGAAAGGG - Intronic
950312444 3:11970297-11970319 TCAGCTTCTCCATCTGCAAAAGG - Intergenic
950658354 3:14451315-14451337 TATGCTCCTCCATCTGCAGATGG - Intronic
951122171 3:18942114-18942136 CTTGCTCCTCAGTCTGCAAATGG + Intergenic
951712100 3:25593637-25593659 CCAGCTCCTGCCTTTGGAAATGG + Exonic
953364169 3:42327925-42327947 CAATCTCTTCCCTCTGCCAGAGG + Intergenic
953647450 3:44768468-44768490 CAGGCTTCTCCCCCTGCATAAGG + Intronic
955469799 3:59274625-59274647 CATGCTCCTCCTTGTGCTAAGGG + Intergenic
957808338 3:85182209-85182231 TAAGCTCCTCCCCCTGGAGAAGG - Intronic
958780241 3:98532335-98532357 CGGGCTCCTTCCTGTGCAAAGGG + Exonic
959660596 3:108863906-108863928 CAGGCTCCTCCCCCTGCCAATGG + Intergenic
960502712 3:118456434-118456456 TGAACTCCTCCCTCTGCAAGTGG + Intergenic
960687578 3:120309671-120309693 GAACCCCCTCCCTCTGCACAAGG - Intergenic
961620964 3:128224824-128224846 CTACCTCCTCCCTCCACAAAAGG + Intronic
962126721 3:132627180-132627202 CAGGCTCCTCCCCTTGCATAAGG - Intronic
962582596 3:136811856-136811878 CAGGCTCTTCCCCCTGCATAAGG + Intergenic
969903526 4:10371953-10371975 CAGGCTCCTCCCTCTGCCTGTGG + Intergenic
970248136 4:14085190-14085212 CAACCTCCACCCTCTGAAAAGGG + Intergenic
975830621 4:78364403-78364425 CAAGCTCCACTCTCTGCCTAGGG - Intronic
978145220 4:105364769-105364791 CAAGCCCCTCCCTCAACACATGG - Intergenic
979053691 4:115969904-115969926 CCAGCTCCTCCCCCTGCATTAGG + Intergenic
980984542 4:139682971-139682993 CAGGCTCCTCCCTCTGCACAAGG + Intronic
981115104 4:140980554-140980576 CCAGCTCCTCCCACTACACATGG - Intronic
982255096 4:153443875-153443897 CAAGCTTCTCCCTCTGCGCTGGG - Intergenic
982854497 4:160363631-160363653 CGAGCTCCTCCCTCAACACATGG + Intergenic
983852954 4:172605943-172605965 CAGGCTCCTCCCCTTGCATAAGG + Intronic
984219102 4:176951759-176951781 CAGGCTCCCCCCCCTGCAAATGG + Intergenic
984405324 4:179321754-179321776 CAAGCTAGTCTCTCTGCTAAAGG - Intergenic
984448588 4:179869927-179869949 CAATCCCATCCCTCTCCAAAAGG - Intergenic
985245508 4:187976341-187976363 CAAGCTCTCCACTGTGCAAAGGG + Intergenic
985414891 4:189726114-189726136 CAACCTCCTCTCCATGCAAATGG + Intergenic
985926173 5:3020818-3020840 GAACCCCCTCCCTCTGCACAAGG + Intergenic
987358385 5:17084690-17084712 CAGGCTCCTCCCCCTGCATAAGG + Intronic
987751942 5:22051157-22051179 ACAGCTCCTCCTTCTGCAGATGG + Intronic
990185612 5:53206351-53206373 CCTGCTGCTCCCTCTGCACAAGG + Intergenic
991083020 5:62621431-62621453 CAGGCTCCTCCCCCTGCAAATGG + Intronic
991568392 5:68029231-68029253 CAAGCTGCTCCCTCTTAAAGAGG - Intergenic
991675164 5:69083574-69083596 CAGGCTCCTCCTGCTGTAAAGGG - Intergenic
993773321 5:91959657-91959679 CAAGCTCCTCTATATGCAAAGGG - Intergenic
994360005 5:98839758-98839780 CAGGCTCCTCCCCCTGCATAAGG + Intergenic
996979278 5:129470679-129470701 CAAGTTTCTCTCTCTGGAAAAGG - Intronic
997381750 5:133443494-133443516 CAGGCCCATCCCTCTGGAAAAGG + Intronic
998384720 5:141750179-141750201 CTGGCTCCACCCTCTGCCAAGGG + Intergenic
998907086 5:146917399-146917421 CAAGCGCCTACCTCAGTAAAAGG + Intronic
1001173369 5:169442770-169442792 CAAGCTCCTGCCAAAGCAAAGGG + Intergenic
1002997315 6:2298987-2299009 CAGACTCCTCCCCCTGCATAAGG + Intergenic
1004158564 6:13192842-13192864 CAAACTCCTCCTTCAGCAACAGG - Intronic
1006456875 6:34136992-34137014 CCAGCTCTTCCCTCTGCAGAAGG - Intronic
1007841776 6:44722389-44722411 CAAGGTCCTCCCTAAGCACATGG - Intergenic
1007992418 6:46270584-46270606 CAAGCCCCTCCCTTTGAATATGG + Intronic
1008652102 6:53574134-53574156 CAAACTCCTCCATGTGCAATGGG + Intronic
1009418407 6:63440304-63440326 CAGGCTCCTCCACCTACAAACGG - Intergenic
1009907477 6:69887874-69887896 CAGGCTCCTCCCGCTAAAAAGGG + Intronic
1010271870 6:73924655-73924677 CAAGTTCCTTCTTCTGAAAAAGG + Intergenic
1010937135 6:81875576-81875598 CTAGCTCCTCACCCTGCAACAGG - Intergenic
1011518886 6:88182537-88182559 CAAGCCCCTCCCTCGACACATGG - Intergenic
1012604790 6:101144690-101144712 CAGCTGCCTCCCTCTGCAAAGGG - Intergenic
1013376305 6:109518221-109518243 CAAGCTCCCCTTTCTCCAAAAGG + Intronic
1013483556 6:110573828-110573850 CAAGATCCATCCTCTGCTAATGG + Intergenic
1015365519 6:132393303-132393325 TTAGCTCCTCTCTCTGGAAAAGG - Intronic
1016300301 6:142623026-142623048 AAAGCTCCTCTCTTTGGAAAAGG + Intergenic
1017298030 6:152821902-152821924 CATGCTCCTCTCTCCTCAAAGGG + Intergenic
1021732911 7:23613976-23613998 CAAGATCCTCCACCAGCAAAAGG - Intronic
1022528126 7:31051479-31051501 CAACCTCCTCCTAGTGCAAATGG - Intergenic
1023235607 7:38082765-38082787 CAAGTTCCTCCCTCAACACATGG + Intergenic
1024108856 7:46124186-46124208 CAGGCTCCATCCTCTGCATATGG + Intergenic
1024397884 7:48889932-48889954 CCAGCTCCTCCCCCTGCACAAGG - Intergenic
1025762086 7:64404741-64404763 AAAGTTCCTCCTTCTGCAAGGGG - Intergenic
1026501515 7:70946964-70946986 CAAGCTCCTTACATTGCAAAGGG - Intergenic
1027557715 7:79686882-79686904 CAAGCTCCTGGCTCTGAAGATGG - Intergenic
1028015832 7:85710894-85710916 AAAGCTCTTCACTCTACAAAGGG - Intergenic
1028107968 7:86902713-86902735 CAGACTCCTCCCCCTGCAAAGGG - Intronic
1029404970 7:100369273-100369295 CAAGCACCTCCCTGTGCAGAAGG + Intronic
1030247469 7:107399368-107399390 CAGGTTCCTCCCTCTACACATGG - Intronic
1030519690 7:110582592-110582614 CAAACACCTCCTTCTTCAAATGG + Intergenic
1031473281 7:122192225-122192247 CAAGCTCCTCCCACAGCATGTGG - Intergenic
1033909045 7:146243706-146243728 CAAGCTCCTTCCTCTCTGAATGG + Intronic
1034126000 7:148672153-148672175 CAGGCTCCTCTCTCTGCATAAGG + Intergenic
1034446429 7:151116296-151116318 CAGGCTCCTCCCTCTTCACCCGG + Intronic
1035007804 7:155681731-155681753 AAAGCTACTCCCATTGCAAATGG - Intronic
1035943300 8:3929188-3929210 AAAGCTCTTGCCTCTGCACATGG + Intronic
1036931122 8:12956455-12956477 CAAGCGCCTGCCTCTGCATACGG + Intronic
1038311389 8:26448906-26448928 CGCGCTGCTCCCTCTGCGAAAGG + Intronic
1041164779 8:55080529-55080551 CAAGCACCTCTCTGTGAAAATGG - Intergenic
1041779912 8:61566728-61566750 CAAGACCCTCCATCAGCAAAAGG + Intronic
1042159164 8:65874743-65874765 CAAGCCACTCCCTCTGCCACAGG - Intergenic
1044158647 8:88884048-88884070 TAAGCCACTCCCCCTGCAAATGG - Intergenic
1044386863 8:91599238-91599260 AAAGCTCCTCCTTCTGCATGAGG - Intergenic
1046337900 8:112813909-112813931 CAGGCTCCACCCCCTGCAAATGG + Intronic
1046412129 8:113859283-113859305 CAGGCTCCTCCCCCTGCACAAGG - Intergenic
1046941247 8:119933598-119933620 CCAGATGCTCCCTCTGAAAATGG - Intronic
1047764736 8:127981244-127981266 CAACCTCTTTCCTCTGCAAGAGG + Intergenic
1049344061 8:142129101-142129123 TCAGCTCCTCCATCTGCAGACGG + Intergenic
1051173941 9:14345823-14345845 CACACCCCTCCCTCTTCAAACGG + Intronic
1051838181 9:21364003-21364025 CAAGCCCCTGCCTCTGCATTTGG - Intergenic
1052331300 9:27271663-27271685 CTAGCTCCATCCTCTGCACAGGG - Intergenic
1053862198 9:42397967-42397989 CGGGCTCCTCCCTCATCAAAGGG - Intergenic
1055569390 9:77601060-77601082 CACGCTCCTCCCCCTGCACAAGG - Intronic
1056657646 9:88522416-88522438 TGAGATCCTCCCTCTGGAAAGGG + Intergenic
1058630910 9:106985454-106985476 CAACTTCCTCACTCTGCACAGGG + Intronic
1059539694 9:115118188-115118210 CGAGCTCCTTCCTCTGTAATGGG + Exonic
1061225219 9:129277312-129277334 CCTGCTCCTCCCACAGCAAATGG + Intergenic
1061253104 9:129437847-129437869 CAACCCCCTCTCTCTGCAGATGG + Intergenic
1203638039 Un_KI270750v1:132144-132166 CAACCTCCTCTCCATGCAAATGG - Intergenic
1185648438 X:1631512-1631534 GAAGCTCCTCACTCTGCAAAGGG - Intronic
1185711751 X:2309728-2309750 CAAGACCCTACCTCTACAAAAGG + Intronic
1187542688 X:20213479-20213501 CTAACTCTTCCCTTTGCAAAAGG + Intronic
1188518135 X:31009524-31009546 CAGGCTCCTCTCACTGCATAAGG - Intergenic
1190044778 X:47102826-47102848 CAAGCTCCTCCAACTGCAGCAGG + Intergenic
1190183533 X:48215130-48215152 CAAGATCCTCCACCAGCAAAAGG - Intronic
1190707573 X:53043504-53043526 CCCTCTCCTCCCACTGCAAAGGG + Intergenic
1191910551 X:66144674-66144696 CGGGCTCCTCCCACTGCAAATGG - Intergenic
1192029619 X:67495315-67495337 CAAGTTCCTCCCTCAACATATGG - Intergenic
1195619923 X:106942736-106942758 CAAGCTCCTCTCTGTTAAAAGGG + Exonic
1195779576 X:108446964-108446986 CAAGCTCCACCTTCTGCCCAGGG - Intronic
1197061750 X:122190053-122190075 CAGGCTCATCCCGCTGCAAGTGG - Intergenic
1197971334 X:132118520-132118542 CAAGCTCCTCCCCCTGCCCATGG + Intronic
1198891458 X:141402163-141402185 CTTGCTCCTCAGTCTGCAAATGG - Intergenic
1199981104 X:152920952-152920974 CAAGCTCTTCCATTTGCCAATGG + Intronic